Optimised Expression and Activity Assessment of Bacterial Staphylokinase in E. coli BL21(DE3)

doi:10.21203/rs.3.rs-3346280/v1

Download PDF

Research Article

Optimised Expression and Activity Assessment of Bacterial Staphylokinase in E. coli BL21(DE3)

https://doi.org/10.21203/rs.3.rs-3346280/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The application of recombinant proteins is rare following the high production costs of expressing proteins with expensive inducers, such as isopropyl-β-D-1-thiogalactopyranoside (IPTG). Staphylokinase (SAK), a fibrinolytic enzyme, is a small bacterial thrombolytic agent that specifically clots and converts plasminogens to plasmins and lysis fibrin clots. The primary objective of the present investigation sought to increase the yield and lower the cost of staphylokinase production using Escherichia coli BL21 (DE3). Although the influence of the culture medium, culture density, and IPTG concentration on the production of SAK protein was explored. The results indicated that only culture density and concentration of IPTG were significant. This study achieved cost reduction by decreasing the IPTG inducer concentration (1.0 and 0.5 mM), which acted as the inducer. The production rate was also maintained or increased in low culture density. In conclusion, suitable production conditions, particularly diminished inducer concentration, effectively reduced upstream production costs and yielded high sak gene expression.

Staphylokinase

E. coli

Protein expression

Culture density

IPTG

In accordance with (Castellino 1981), fibrinolysis entails the degradation of fibrin blood clots in blood vessels by an enzyme system found in all mammalian blood. A dormant proenzyme designated plasminogen, which has the capability to transform into an active enzyme, plasmin, a trypsin-like serine protease that breaks down fibrin into soluble fibrin degradation products, are components of the blood fibrinolytic system (Hassan et al. 2021).

Inactive plasminogens are converted to fibrinolytic plasmins via a limited proteolytic cleavage mediated by various plasminogen activators (PAs) (Baruah et al. 2006). PAs are classified as “non-fibrin specific”, for example, streptokinase, anisoylated plasminogen streptokinase activator complex (APSAC), and two-chain urokinase-type plasminogen activator (tcu-PA), or “fibrin specific”, which includes tissue-type plasminogen activator (t-PA) and single-chain u-PA (scu-PA), and staphylokinase (SAK) (Collen and Lijnen 1991). The majority of Staphylococcus aureus strains produce a protein SAK. The protein reportedly possesses profibrinolytic properties (Lack 1948). The SAK is of 15.5 kDa molecular weight, consists of 163 amino acids, and is encoded by the sak gene of 489 base pairs (Collen and Lijnen 1994).

Studies on the SAK protein revealed its action mechanisms as a fibrinolysis factor. The protein is not an enzyme but forms a one-to-one stoichiometric complex with plasmins that activate other plasminogen molecules. SAK reacts poorly with reaction plasminogen in plasma when added to fibrin clot-containing human plasma. Conversely, the protein demonstrated high affinity towards plasmin traces on clot surfaces, converting them into plasmin-SAK complex, which efficiently activates plasminogen to plasmin. The half-life of SAK in plasma is 6.3 min (Toul et al. 2022)

The manufacturing process and purification of SAK employing sak gene coding clones across different expression systems, such as Escherichia coli (E. coli) and yeast, has been extensively investigated (Moussa et al. 2012). SAK has also been utilised to convert streptokinase from non-specific clots to specific clots by producing staphylokinase- streptokinase recombinant protein (Buniya et al. 2023). In this study, the sak gene was cloned and expressed in varying culture conditions with E. coli under the T7 expression system.

2-1 Bacteria, a vector, and reagents

Competent E. coli BL21 (DE3) strain [NEB, USA - C2527H) was employed as the expression host in this study. Either a 1.5% Luria Bertani agar supplemented with 100 mg/mL ampicillin or a Luria Bertani broth (LB) comprising 10% tryptone, 5% yeast extract, and 10% sodium chloride (NaCl) have been employed to grown the bacteria.

The sak gene has been cloned in the current study by employing pGEM®-3Zf (+) expression vector from Promega, USA. Restriction enzymes BamHI and EcoRI (Promega, USA) were also utilised to restrict digestions in the buffers recommended by the manufacturer for the respective recombinant DNA.

Bioneer (Korea) furnished the AccuPower® polymerase chain reaction (PCR) Premix that was employed in the present study, and Promega (USA) contributed the T4 DNA ligase. Geneaid (Taiwan) contributed the PCR purification kit, and Eurofins Genomics India Pvt. Ltd. (India) generated the PCR oligos.

2-2 Constructing and molecular cloning the sak gene

The present study employed the SAK F1 (5ʹ- CGCGAATTCTCAAGTTCATTCGAC -ʹ3) and SAK R1 (5ʹ- CCGGGATCCTTTCCTTTCCTATAACAAC -ʹ3) gene-specific primers to amplify the 390 bp sak gene at 56°C (Buniya and Farhan, 2016) before recording its sequence in the National Centre for Biotechnology Information (NCBI) database. The EcoRI and BamHI restriction sites were present in the forward and reverse primers, respectively. The PCR amplicons were thereafter ligated into the pGEM®-3Zf (+) expression vector after having been digested by the same enzymes.

2-3 Expression analysis of the constructs

According to Mandel and Higa's (1970) position, the constructs accomplished in this investigation were inserted into the protein's expression host, E. coli BL21 (DE3), for SAK protein expression. The transformants were first cultivated in a Luria-Bertani (LB) medium at 37°C and shaken at 200 rpm. After that, the culture was incubated for 4 hours containing isopropyl-D-1-thiogalactopyranoside (IPTG) to promote the expression of the target protein. The expression sequences of the constructs were evaluated using a 12% SDS-PAGE (Solar Bio, China), and the gels were then stained with Coomassie brilliant blue R-250.

2-4 Protein protocol expression

2-4-1 Culture medium

In this study, the expression host was cultured in LB (10% tryptone, 5% yeast extract, 10% NaCl, and 0.8% glucose) and GYE (6 g K₂HPO₄, 3 g KH₂PO₄, 0.5 g NaCl, 1 g NH₄Cl, 5 g yeast extract, 20% glucose, and MgSO₄ 1 M) media. Both media were supplemented with 100mg/ml of ampicillin.

2-4-2 Optical density

To obtain 0.3 and 0.6 absorbance an O.D600 optical density (T80 Visible/UV Spectrophotometer; PG Instruments Limited), the cells were grown in the current investigation at 37°C and 200 rpm. The cells were then stimulated to start expressing the target protein.

2-4-3 Inducer concentration

For induction in this investigation, IPTG was administered to final concentrations of 1 and 0.5 mM.

2-5 Biological activity

Activities of the expressed SAK were determined through a caseinolytic plate assay (Buniya et al.,2014). The caseinolytic-agarose base for the investigation was developed by melting 90 mg of agarose in 9 ml of a buffer solution consisting 50 mM Tris-HCl, 150 mM NaCl, 1% plasminogen, and 1% skim milk. Subsequently, the solution gelled, and 5 mm-diameter wells were formed on the caseinolytic-agarose base. The wells were filled with 50 µL of the lysis-induced cells and incubated for 24 h at 37°C before observing the development of clear zones in the wells.

Generally, sak genes are expressed in different expression hosts, including E. coli. The current study assessed whether SAK could be expressed under various conditions before evaluating the activities of the expressed protein. The 390 bp sak gene, which generates the SAK protein, was successfully amplified in this work using certain primers (see Fig. 1). The PCR products were then confirmed via sequence alignments in the NCBI database before being submitted to NCBI with the accession number LC626454.1.

In advance of being put through to restriction digestion with EcoRI and BamHI, the amplicons employed in the present research were purified. Complementary enzymes have been employed to digest and linearize the pGEM®-3Zf (+) expression vector beforehand it was ligated with a T4 DNA ligase. The ligation products were subsequently incorporated into E. coli BL21 (DE3) before IPTG was applied in order to stimulate the constructs for expression. The expression profile of the SAK protein (16 kDa) in E. coli BL21 (DE3) observed in a 12% SDS-PAGE is illustrated in Fig. 2.

In this study, protein expression was measured via protein profile in SDS-PAGE and biological activities for expressed protein (see Fig. 3). Alterations in the parameters applied resulted in sak gene expression level changes. Low culture optical density (0.3 O.D₆₀₀) and low inducer concentration (0.5 mM and 1 mM IPTG) led to increased SAK protein levels with high activity (see Figs. 2, A and B). Conversely, different culture media produced no effects on the expression levels.

The sak gene has been cloned and expressed in different expression systems, including E. coli BL21 (Nguyen and Quyen 2012), E. coli GJ1158 (Kotra et al. 2012), E. coli DH5α (Reddy et al. 2014), Bacillus subtilis (Ye et al. 1999), and Pichia pastoris yeast (Apte-Deshpnade et al. 2009) to varied levels. SAK is one of third-generation thrombolytic agents, which is specific to clotting. Moreover, the protein possesses the potential as a cost-effective thrombolytic agent with the least side effects (Nedaeinia et al. 2019).

Selecting a suitable expression system to manufacture recombinant protein is essential in therapeutic protein production. A bacterial expression system is optimal to produce numerous recombinant proteins, as it allows the manipulation of several parameters to obtain a high target protein yield (Yin et al. 2004). Typically, easily expressed proteins are assembled in E coli.

Numerous studies reported the effects of IPTG concentration on gene expression in E. coli hosts with a T7 expression system. This study obtained similar results as when normal induction concentration is utilised. The finding could lead to cost-effectiveness in research. Nonetheless, the conditions to manufacture soluble sak proteins are required in future studies.

Reducing inducer concentration increased the expression rate for recombinant protein in its active form (Studien 2005; Lopes et al. 2013; Rizkia et al. 2015). Furthermore, low IPTG concentration might result in the strong affinity of T7 promoters and lac repressors, thus producing an appropriate form. Consequently, production during cultivation occurred slowly, which improved with culture density. The high inducer level also led to the high protein expressed, which formed inclusion bodies, hence inactivating the proteins (Baneyx and Mujacic 2004).

Culture media are necessary to optimise protein expression levels, The compositions for culture growth are easier to manipulate (Joseph et al. 2015). Different types of nutritional factors influence the production of recombinant SAK variants (Kotra et al. 2012). Some components could improve the concentration of desired recombinant proteins, which is essential for the correct folding and for preventing inclusion bodies formations (Chambers et al. 2009; Larentis et al. 2011).

In conclusion, the present study successfully demonstrated that reduced inducer concentration produced similar results as employing the normal concentration for induction. The findings could lead to cost-effectiveness in future studies. Nevertheless, the conditions to obtain soluble sak protein still require investigation.

1	*E. coli*	*Escherichia coli*
2	F	Forward
3	R	Reverse
4	PCR	Polymerase Chain Reaction
5	rpm	Revaluation per minute
6	SAK	Staphylokinase

Acknowledgments

For their assistance in completing this work, the author are grateful to all of the employees at the Department of Biology, College of Education for Pure Science, University Of Anbar, and colleagues at the Molecular Biology Lab (Dr. Almuthana K. Hameed).

Conflict of interest: The Author of the manuscript declare that there is no conflict of interest.

Funding: Not Applicable

Ethical approval: Not Applicable

Informed consent: Not Applicable

Apte-Deshpnade A, Mandal G, Soorapaneni S, Prasad B, Kumar J, Padmanabhan S (2009) High-level expression of non-glycosylated and active staphylokinase from pichia pastoris. Biotechnol Lett 31(6):811–817. https://doi:10.1007/s10529-009-9938-z
Baneyx F, Mujacic M (2004) Recombinant protein folding and misfolding in Escherichia coli. Nat Biotechnol 22:1399
Baruah DB, Dash RN, Chaudhari MR, Kadam SS (2006) Plasminogen Activators: a comparison. Vascul Pharmacol 44(1):1–9. https://10.1016/j.vph.2005.09.003
Buniya HK, Murugan V, Thangadurai C (2014) Cloning and expression of hybrid streptokinase towards clot-specific activity. J Microbiol methods 98:84–88. https://doi:10.1016/j.mimet.2014.01.006
Buniya HK, Farhan HA (2016) Cloning and Expression of Staphylokinase gene produced from Staphylococcus aureus in E. coli DH5α. Al-Anbar J Vet Sci 9: 7–14
Buniya HK, Hameed AK, Al-Hayawi AY (2023) Cloning and expression of staphylokinase-streptokinase recombinant protein in E. coli BL21(DE3). Biologia 78:1113–1117
Castellino FJ (1981) Recent Advances in the Chemistry of the Fibrinolytic system. Chemi Rev 81:431–446. https://doi.org/10.1021/cr00045a001
Chamber SP, Swalley SE Designing experiments for high-throughput protein expression. Methods Mol Biol 498: 19–29. https://doi:10.1007/978-1-59745-196-3_2., Collen D, Lijnen HR (2009) (1994) ‘Staphylokinase, a fibrin-specific plasminogen activator with therapeutic potential?’. Blood 84: 680–686
Collen D, Lijnen HR (1991) Basic and clinical aspects of Fibrinolysis and Thrombolysis. Blood 78:3114–3124
Hassan MM, Sharmin S, Kim J, Hong ST (2021) Identification and Characterization of plasmin-Independent Thrombolytic Enzyme. Circul Res 128:386–400. https://doi:10.1161/CIRCRESAHA.120.317245
Joseph BC, Pichaimuthu S, Srimeenakshi S, Murthy M, Selvakumar K et al (2015) An Overview of the Parameters for Recombinant Protein Expression in Escherichia Coli. J. Cell Sci Ther 6: 221. https://doi:10.4172/2157-7013.1000221. Kotra SR, Kumar1 A, Sambasiva Rao KRS, Pulicherla KK, (2012) Statistical Optimization of Media Components for Enhanced Production of the Recombinant Staphylokinase Variant from Salt Inducible E.coli GJ1158. International J Bio-Science and Bio-Technology 4(4): 27–40
Larentis AL, Argondizzo APC, Esteves GD, Jessouron E, Galler R, Medeiros MA (2011) Cloning and optimization of induction conditions for mature PsaA (pneumococcal surface adhesin A) expression in Escherichia coli and recombinant protein stability during long-term storage. Protein Expr Purif 78:38–47. https://doi:10.1016/j.pep.2011.02.013
Lopes C, Santos NV, Dupont J, Pedrolli DB, Valentini SR, Santos-Ebinuma VC, Pereira JFB (2019) Improving the cost effectiveness of enhanced green fluorescent protein production using recombinant Escherichia coli BL21 (DE3): Decreasing the expression inducer concentration. Biotechnol Appl Biochem 66(4):27–536. https://doi:10.1002/bab.1749
Mandel M, Higa A (1970) Calcium-dependent bacteriophage DNA infection. J Mol Biol 53:159–162. https://doi:10.1016/0022-2836(70)90051-3
Moussa M, Ibrahim M, El Ghazaly M, Rohde J, Gnoth S, Anton A, Kensy F, Mueller F (2012) Expression of recombinant staphylokinase in the methylotrophic yeast Hansenula polymorpha. BMC Biotechnol 12:96. https://doi:10.1186/1472-6750-12-96
Nedaeinia R, Faraji H, Javanmard SH, Ferns GA, Mobarhan MG, Goli M, Mashkani B, Nedaeinia M, Haghighi MHH, Ranjbar M (2020) Bacterial staphylokinase as a promising third-generation drug in the treatment for vascular occlusion. Mol Biol Rep 47:819–841. https://doi:10.1007/s11033-019-05167-x
Nguyen THT, Quyen DT (2012) Cloning, high-level expression, purification and characterization of a staphylokinase variant, SakϕC, from Staphylococcus aureus QT08 in Escherichia coli BL21. Afr J Biotechnol 11(22):5995–6003. https://doi:10.5897/AJB11.1690
Reedy Y, Prakash R, Anandakumar S (2014) Isolation, cloning and expression of recombinant Staphylokinase gene against Thrombosis. Int J Pharm Pharm Sci 6(4):266–270
Rizkia R, Silaban S, Hasan K, Kamara DS, Subroto T, Soemitro S, Maksum IP (2015) Effect of Isopropyl- β-D-thiogalactopyranoside Concentration on Prethrombin-2 Recombinan Gene Expression in Escherichia Coli ER2566. Procedia Chem 17:118–124. https://doi:10.1016/J.PROCHE.2015.12.121
Studier WF (2005) Protein production by auto-induction in high-density shaking culture. Protein Expr Purif 41(1):207–234. https://doi.org/10.1016/j.pep.2005.01.016
Toul M, Nikitin D, Marek M, Damborsky J, Prokop Z (2022) Extended mechanism of the plasminogen activator staphylokinase revealed by global kinetic analysis: 1000-fold higher catalytic activity than That of clinically used alteplase. ACS Catal 12:3807–3814. https://doi:10.1021/acscatal.1c05042
Ye R, Kim JH, Kim BG, Szarka S, Sihota E, Wong SL (1999) High-level secretory production of intact, biologically active staphylokinase from Bacillus subtilis. Biotechnol Bioeng 62(1):87–96
Yin J, Li G, Ren X, Herrler G (2007) Select what you need: a comparative evaluation of the advantages and limitations of frequently used expression systems for foreign genes. J Biotechnol 127(3):335–347. https://doi:10.1016/j.jbiotec.2006.07.012

Download PDF

Version 1

posted

You are reading this latest preprint version

Optimised Expression and Activity Assessment of Bacterial Staphylokinase in E. coli BL21(DE3)

Status:

Version 1

Abstract

Figures

1- Introduction

2- Materials and Methods:

3- Results

4- Discussion

5- Conclusion

Abbreviations

Declarations

References

Status:

Version 1