Th17/Treg balance is restored during the suppression of experimental autoimmune encephalomyelitis treated by Astragalus polysaccharides via the microbiota-gut-brain axis

doi:10.21203/rs.3.rs-3350930/v1

Download PDF

Research Article

Th17/Treg balance is restored during the suppression of experimental autoimmune encephalomyelitis treated by Astragalus polysaccharides via the microbiota-gut-brain axis

https://doi.org/10.21203/rs.3.rs-3350930/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The Th17/Treg imbalance is an important cause of immune cell infiltration into the central nervous system (CNS) and subsequent neuroinflammation, demyelination, and neurodegeneration in multiple sclerosis (MS). Increasing attention has been given to the role of the microbiota-gut-brain axis in MS pathogenesis. The gut microbiota affects the Th17/Treg balance in the gut as well as in distal areas, such as the CNS, which further contributes to the onset and progression of MS. Our previous studies have shown that Astragalus polysaccharide (APS) has a role in alleviating the clinical symptoms and demyelination of experimental autoimmune encephalomyelitis (EAE) mice, a classic MS model. However, the mechanism of action is not fully understood. In this study, we found that APS suppressed inflammation and regulated the Th17/Treg balance in the CNS and peripheral blood of EAE mice. It was further shown that APS inhibited gut inflammation and reduced Th17 function. The experiment with an antibiotic cocktail interfering with the gut microbiota proved that APS alleviated EAE by regulating the gut microbiota. Through 16S rRNA sequencing, we showed that APS regulated gut microbiota diversity and composition in EAE mice. Then, we found that APS regulated metabolite composition in feces and plasma, thus altering gut and blood metabolic functions. The neuroactive ligand‒receptor interaction pathway was enriched in both fecal and plasma metabolites. Metabolites related to this pathway, including sphingosine 1 phosphate (S1P), prostaglandin E2 (PGE2), ADP, and ATP, were downregulated by APS. The levels of bile acid metabolites such as taurochenodeoxycholate-7-sulfate and N-palmitoyl aspartic acid were upregulated by APS. In summary, our study demonstrated that APS exerts a suppressive effect on EAE by regulating gut microbiota composition, affecting metabolite composition, and improving the Th17/Treg balance in the peripheral blood and CNS.

Th17/Treg balance

microbiota-gut-brain axis

neuroinflammation

Astragalus polysaccharide

experimental autoimmune encephalomyelitis (EAE)

Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system (CNS). It is characterized by triggering autoreactive T-cell activation, which leads to infiltration of activated immune cells into the CNS, demyelination, and axonal damage. The most commonly used experimental model for MS is experimental autoimmune encephalomyelitis (EAE), which better mimics the pathological mechanism of inflammatory demyelination caused by autoreactive T cells.

Although a variety of immune cells may orchestrate the inflammatory response within the CNS in MS, autoreactive CD4⁺ T cells play a significant role. In fact, it has been found that high levels of T helper (Th) cells and related cytokines, such as Th1 and Th17 cells, can be strongly associated with MS progression. The Th1-related cytokine interferon γ (IFN-γ) and the Th17-related cytokines interleukin (IL)-17 and IL-22 enhance immune activation in the CNS by inducing the release of additional proinflammatory mediators, increasing antigen presentation, or directly affecting the viability or function of CNS-resident cells. T regulatory cells (Tregs) inhibit the function of Th1 and Th17 cells by secreting IL-4, IL-10, transcriptional growth factor-β (TGF-β), and other cytokines, which play a key role in re-establishing CNS homeostasis after tolerance is broken[1]. The imbalance in the amount and function of Th1 and Th17/Treg cells induces the expansion of CNS inflammation, aggravation of demyelination, and promotion of disease progression[2]. The peripheral activation and subsequent migration of autoreactive Th1 and Th17 cells to the CNS is widely recognized as an important step in the pathogenesis of MS[3]. Deficiency of Treg immunosuppressive function in MS and loss of peripheral tolerance can lead to activation and proliferation of Th1 and Th17 cells[4]. In turn, these cells disrupt the blood‒brain barrier (BBB) and subsequently infiltrate into the CNS[5]. Therefore, the peripheral Th1 and Th17/Treg imbalance is the main cause of immune cell infiltration into the CNS and subsequent neuroinflammation.

The microbiota-gut-brain axis is increasingly thought to play a crucial role in the pathogenesis of MS. In MS/EAE, it has been demonstrated that gut microbial alteration, also known as dysbiosis, causes “leaky gut” syndrome, which is characterized by increased intestinal permeability, allowing bacteria, toxic metabolites, and small molecules to translocate into the bloodstream, ultimately inducing “leaky brain”[6, 7]. Gut inflammation leads to the activation of T cells, which enter the peripheral blood and further enter the CNS, inducing neuroinflammatory damage[8]. In EAE, gut barrier permeability and morphological changes have been observed on day 7 after immunization, occurring before the onset of clinical symptoms[9]. T cells to be activated have been observed in the gut in EAE, and intestinal CD4⁺ T cells can play a role in the initiation of CNS autoimmunity[10, 11]. In MS patients and EAE mouse models, specific components of the microbiota have been shown to modulate Th17 and Treg responses, thereby regulating disease progression[7]. Therefore, altered gut microbiota not only has an impact on the immune response in the gut but also on distal effector immune sites such as the CNS. The microbiota mainly communicates with the host through a variety of bacterial metabolites (including short-chain fatty acids (SCFAs), bile acids, etc.) and influences the metabolic functions of the body[8].

Astragalus polysaccharide (APS), the main active component of Astragalus membranaceus, has bidirectional immune regulatory effects, such as anti-inflammatory, antioxidant and antitumor effects[12–14]. In a mouse model of diarrhea caused by Salmonella typhimurium, APS reduced the intestinal inflammatory response, improved intestinal mucosal permeability, and increased the intestinal contents of Lactobacillus and Bifidobacterium spp., indicating that APS can regulate gut microbiota and intestinal immunity[15]. Our previous studies found that APS could reduce the disease symptoms and severity of EAE, inhibit CNS inflammation, and regulate microglial polarization[16, 17]. However, whether APS can suppress CNS inflammation by regulating the balance of Th1 and Th17/Treg cells by modulating the microbiota-gut-brain axis in EAE remains unclear.

In this study, we demonstrated that APS improved clinical symptoms and CNS inflammation in EAE mice by regulating the Th17/Treg balance in the CNS and peripheral blood. Furthermore, we found that APS played a role in treating EAE by regulating the gut microbiota. We showed that APS modulated the composition of the gut microbiota and metabolites in the gut and plasma, affecting metabolic function in the blood, which may be the mechanism by which APS plays a role in treating EAE through the microbiota-gut-brain axis.

Animals

Adult C57BL/6 female mice aged 6–8 weeks were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The mice were fed at the specific pathogen-free (SPF) animal experimental center of Yue-yang Hospital of Integrative Medicine, Shanghai University of Traditional Chinese Medicine (Yue-yang Hospital). The mice were randomly assigned to each experimental group and were free to eat and drink water under a 12 h light-dark alternating cycle.

EAE introduction and evaluation

Each mouse was injected subcutaneously with a 0.2 mL emulsifier containing 50% MOG_{35 − 55} (Genescript, USA) and 50% complete Freund’s adjuvant (CFA; Sigma‒Aldrich, USA) at the posterior neck and root of the tail on day 0. The emulsifier was prepared from 200 µg of MOG_{35 − 55} dissolved in 0.1 mL of PBS with an additional 4 mg/mL Mycobacterium tuberculosis H37Ra (Sigma‒Aldrich, USA). At the same time, 300 ng of PTX (List Biological Laboratories 181, USA) was injected intraperitoneally on days 0 and 2. Clinical signs of EAE were scored as follows [18]: 0, no clinical signs; 0.5, partially limp tail; 1, paralyzed tail; 2, loss in coordinated movement; hind limb paresis; 2.5, one hind limb paralyzed; 3, both hind limbs paralyzed; 3.5, hind limbs paralyzed; weakness in forelimbs; 4, forelimb paralysis; and 5, moribund.

Treatment and sample collection

The duration of the experimental administration is shown in Fig. 1A. After 7 days of adaptive feeding, the mice were randomly divided into EAE and APS groups, with six mice in each group. The EAE model was induced on day 0 in both groups. The APS treatment group was administered 500 mg/kg/d APS (UV ≥ 98%, Shanghai Yuanye Bio-Technology Co., Ltd) by gavage starting on the day post-immunization (0 DPI). The EAE group was administered normal saline (200 µL/day) by gavage. Blood, plasma, brain, and colon samples were collected at 19 DPI. After anesthesia with isoflurane, 500–800 µL of eyeball blood was placed in a sterile anticoagulant tube, 200 µL of whole blood was collected for flow cytometry immune cell analysis, and the remaining whole blood was centrifuged (centrifuged at 2000 × rpm at 4°C for 10 min) to obtain plasma. It was then stored at -80°C for metabolomic analysis. The brain was immediately removed to analyze immune cell infiltration in the CNS. The 5 mm middle colon segment was rinsed with PBS, and immune cell analysis was performed by flow cytometry.

Flow cytometry

For immune profiling, the brain and colon tissues were processed into a single-cell suspension and filtered with a 70 µm strainer, followed by Percoll gradient (30%/70%) centrifugation and collection of lymphocytes in the middle layer. Peripheral blood was centrifuged after erythrocytolysis, and the cell precipitate was collected. Viable cell populations were identified by fixable viability stain 780 (565388, BD Pharmingen, USA) and then surface stained with antibodies against CD45 PE (553081, BD Pharmingen, USA), CD3e PerCP-Cy5.5 (551163, BD Pharmingen, USA), CD4 FITC (340133, BD Pharmingen, USA), and CD25 APC (557192, BD Pharmingen, USA). For intracellular factor staining, cells were fixed, permeabilized, and labeled with T-bet PerCP-Cy5.5 (561316, BD Pharmingen, USA), ROR-γt PE-Cy7 (25-6981-82, Invitrogen, USA), and Foxp3 APC (560401, BD Pharmingen, USA) antibodies. Unstained controls were used for autofluorescence correction, and appropriate monochromatic controls were used for spectral separation. The cells were analyzed using a flow cytometer (BD FACSVerse). Data analysis was performed using FlowJo software version 10.8.1 (BD Biosciences) and GraphPad Prism 9.5.1.

Quantitative real-time PCR

Total RNA was extracted from brain and colon tissues using an EZB kit (EZB-RN001. A, EZBioscience, China). The quantification and purity of RNA were evaluated by absorbance at 260 nm and 280 nm, respectively, and RNA concentration was detected using an IMPLEN ultramicro spectrophotometer. cDNA was obtained using a reverse transcription kit (1708891; Bio-Rad, USA). After reverse transcription, the cDNA was amplified by RT‒qPCR. GAPDH was used as a control, and the relative mRNA expression level was calculated using the 2^-ΔΔCt method. The primers used in this study are listed in Supplementary Table 1.

Histopathology

After anesthetizing the mice with isoflurane, they were intracardially perfused with PBS, followed by 4% paraformaldehyde. Midsection colon samples were collected, fixed in 4% paraformaldehyde and embedded in paraffin. Paraffin-embedded colon tissue sections (thickness 4 µm) were obtained and stained with hematoxylin and eosin (HE) according to the manufacturer's instructions using a commercial kit (G1080, Solarbio, China).

Antibiotic experiment

A schematic design of the antibiotic interference experimental grouping and administration is shown in Fig. 3A. To induce intestinal dysbiosis, an antibiotic cocktail (ABX), including vancomycin (0.5 mg/mL), neomycin (1 mg/mL), metronidazole (1 mg/mL), and penicillin (1 mg/mL), was administered by oral gavage seven days before immunization until the end of the experiment.

16S rRNA gene sequencing

Fecal samples from five groups of mice were collected aseptically at 15–19 DPI and stored at -80°C for 16S rRNA gene sequencing, as shown in Fig. 4A. DNA was extracted from feces using the PF Mag-Bind Stool DNA Kit (Omega Biotek, Georgia, U.S.). DNA purity and concentration were detected using NanoDrop2000 (Thermo Scientific Inc., USA), and DNA integrity was detected by 1.0% agarose gel electrophoresis. The V3-V4 region of the bacterial 16S rRNA gene was amplified with the upstream primer 338F (ACTCCTACGGGAGGCAGCAG) and the downstream primer 806R (GGACTACHVGGGTWTCTAAT) using an ABI GeneAmp® 9700 PCR thermocycler (ABI, CA, USA). PCR products were extracted from a 2% agarose gel and purified. Quantification was performed using a Quantus fluorometer (Promega, USA). The MiSeq library was constructed using the NEXTFLEX Rapid DNA-Seq Kit (Bioo Scientific, USA) and sequenced using an Illumina PE300 (Illumina, San Diego, USA) by Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China). The optimized sequences were clustered into operational taxonomic units (OTUs) using UPARSE 11 with a 97% sequence similarity level[19]. The taxonomy of each OTU representative sequence was analyzed using RDP Classifier version 2.13 against the 16S rRNA gene database (e.g., Silva v138) using a confidence threshold of 70%[20]. Data processing and bioinformatic analysis of the gut microbiota were carried out using the Majorbio Cloud platform (https://cloud.majorbio.com).

Nontargeted metabolomics of feces and plasma

Fecal samples from the EAE group and APS groups of mice were collected aseptically at 15–19 DPI and stored at -80°C for metabolomic analysis. Fecal samples (50 mg) were accurately weighed, and metabolites were extracted using 400 µL methanol:water (4:1, v/v) solution. The mixture was allowed to grind for 6 min (-10℃, 50 Hz) by a Wonbio-96c high-throughput tissue crusher (Shanghai Wanbo Biotechnology Co., LTD), followed by low-temperature ultrasonic extraction for 30 min (5℃, 40 kHz). The sample was statically placed at -20°C for 30 min. After centrifugation for 15 min (4°C, 13000 g), the supernatant was obtained for LC‒MS/MS analysis. Plasma samples from the EAE and APS groups of mice were obtained as shown in Fig. 1A. 200 µL) was collected from each sample and stored at -80°C for metabolomics analysis. Plasma samples (100 µL) were extracted using a 400 µL methanol:acetonitrile (1:1, v/v) solution. The mixture was then sonicated for 30 min (5℃, 40 kHz). The samples were placed at -20°C for 30 min to precipitate proteins. After centrifugation for 15 min (4℃, 13000 g), the supernatant was carefully transferred to new microtubes and evaporated to dryness under a gentle stream of nitrogen. The samples were reconstituted in 100 µL loading solution in a 5°C water bath. The extracted metabolites were centrifuged for 15 min (4°C, 13000 g), and the supernatant was obtained for LC‒MS/MS analysis. A pooled quality control sample (QC) was prepared by mixing equal volumes of all samples for quality control. The UHPLC-Q Exactive system (Thermo Fisher) was used for LC‒MS analysis. After mass spectrometry detection was completed, the data were uploaded to the Majorbio cloud platform (https://cloud.majorbio.com) for data analysis.

Fecal SCFA content detection

Fecal samples from five groups of mice were collected aseptically at 15–19 DPI and stored at -80°C for SCFA content detection, as shown in Fig. 4A. Fecal samples (50 mg) were weighed into 2 mL grinding tubes, and 500 µL of water containing 0.5% phosphoric acid was added. The samples were frozen and ground for 3 min, repeated twice, followed by ultrasonication for 10 min and centrifugation for 15 min. The supernatant (400 µL) was transferred to a new 1.5 mL centrifuge tube, and 0.2 mL of N-butanol solvent was added for extraction. Then, the samples were ultrasonicated at a low temperature for 10 min, followed by centrifugation for 5 min, and the supernatant was transferred for analysis. Gas chromatography‒mass spectrometry (GC‒MS) analysis was performed using an Agilent 8890B gas chromatograph coupled to an Agilent 5977B/7000D mass-selective detector. The sample compounds were identified and quantified using Masshunter software (v10.0.707.0, Agilent, USA). The concentration of each sample was calculated using a standard curve, and the actual content of short-chain fatty acids in the sample was calculated.

Statistical analysis

Statistical analysis and data processing were performed using GraphPad Prism 9.5.1 software (GraphPad Software, San Diego, CA, USA). All continuous variables are presented as the mean ± SEM. If the data met the normal distribution and the homogeneity of variance, the difference comparison between the two samples was performed by the t test, and the difference comparison between multiple samples was performed by one-way ANOVA. If the sample distribution did not meet the normal analysis or homogeneity test of variance criteria, a nonparametric test was performed. P < 0.05 indicated that the difference was considered statistically significant.

CNS Th17/Treg balance is restored by APS in EAE

In our previous studies, APS was found to have a therapeutic effect on the clinical symptoms of EAE, reducing CNS inflammation and demyelination [16, 17]. To further investigate the immune mechanism of APS treatment on EAE, a mouse model of active EAE using MOG_{35 − 55} was induced, which was administered APS from the day of immunization until the peak of EAE (Fig. 1A). Consistent with previous findings, we found that APS-treated mice had significantly less severe disease than the EAE group (Fig. 1B). Flow cytometry was used to analyze the effects of APS on the immune profiles of the brain, blood, and colon on the 19th day post immunization (DPI). First, we determined the proportion of CD4 + T cells and their subtypes, Th1, Th17, and Treg, in the brain. APS significantly reduced the frequency of CD4 + T cells but had no significant effect on the frequency of Th1 cells. APS reduced the frequency of Th17 cells and increased that of Treg cells (Fig. 1C-F). Furthermore, the effects of APS on the mRNA expression levels of cytokines in the brain tissue were observed, including IL-17A, IL-22, IL-4, IL-10, and TGF-β, which are related to the function of Th17 and Treg cells. We found that APS significantly downregulated the mRNA expression levels of IL-17A and IL-22 and upregulated the mRNA expression levels of IL-4, IL-10, and TGF-β (Fig. 1G-H). APS downregulated the proportion of Th17 cells in the brain and downregulated the cytokines IL-17A and IL-22, which are related to Th17 cell function. Correspondingly, APS upregulated the proportion of Treg cells as well as the cytokines IL-4, IL-10, and TGF-β, which are related to the function of Treg cells. Taken together, these results indicate that APS restores the Th17/Treg balance in the CNS of EAE mice.

The Th17/Treg balance in peripheral blood is restored and colon inflammation is inhibited by APS in EAE

Since the autoreactive T cells in the CNS in EAE infiltrate from the periphery, we hypothesized that the regulatory effect of APS on the Th17/Treg balance in the CNS might be exerted by changing the proportion of peripheral blood immune cells. Thus, the effects of APS on the proportion of peripheral blood CD4 + T cells and their subtypes (Th1, Th17, and Treg cells) were assessed. The results showed that APS had no significant effect on the frequency of CD4 + T and Th1 cells in peripheral blood. However, the proportion of Th17 cells was significantly reduced, and the proportion of Treg cells was higher in the APS group than in the EAE group (Fig. 2A-D), which was consistent with the regulatory effect of APS on Th17/Treg balance in the brain.

Considering that orally administered APS is first absorbed and metabolized through the gut, gut immunity may be changed earliest and subsequently affect peripheral immunity. Therefore, we observed the effects of APS on immune profiles, including CD4 + T cells and Th1, Th17, and Treg cells, in colon tissue. The results showed that APS significantly reduced the frequency of CD4 + T cells. We found no differences in the frequency of Th1 cells. There was a decreasing trend in Th17 cells, but the difference was not statistically significant. Interestingly, APS significantly decreased Treg cells (Fig. 2E-H). Additionally, we examined the effect of APS on the mRNA expression levels of IL-17A, IL-22, IL-4, IL-10, and TGF-β in colon tissue. The results showed that APS significantly downregulated the expression level of IL-17A and had certain downregulatory effects on IL-22, IL-4, IL-10, and TGF-β, but no significant difference was observed in these four cytokines (Fig. 2I-J). HE staining was also used to observe the effect of APS on colonic tissue inflammation. In the normal group, the colonic mucosa and crypt structures were intact, the glands were arranged regularly, and there was no inflammatory infiltration, edema, congestion, or necrosis. Compared with the normal group, the colonic mucosa and crypt structure of the EAE group mice were destroyed, and there was more inflammatory cell infiltration, tissue congestion, and fewer glands. Furthermore, compared with the EAE group, there was less inflammatory cell infiltration, close to the complete crypt structure, and a basic regular glandular arrangement in colon tissue after APS treatment (Fig. 2K). These findings indicate that APS alleviates gut inflammation and protects colon structural integrity by reducing the proportion and function of Th17 cells.

Amelioration of EAE by APS is mediated via the microbiota

Until now, it was unclear whether the neuroprotective effects of APS on EAE mice were driven by changes in the composition of the gut microbiota. To investigate this, an antibiotic cocktail (ABX) experiment was performed. Six-week-old C57BL/6J mice were divided into four groups: EAE, APS, ABX, and ABX_APS. A schematic diagram of the time progression of EAE induction, APS treatment, and ABX intervention is shown in Fig. 3A. As expected, APS-treated mice showed significantly less severe EAE. However, the therapeutic effect of APS was abolished in the ABX_APS group compared to the EAE group (Fig. 3B-D). These results indicated that APS may play a therapeutic role in EAE through the gut microbiota. Additionally, we observed the mRNA expression levels of IL-17A, IL-22, IL-4, IL-10, and TGF-β in the brains of the four groups. We found that, compared with the EAE group, the Th17-related cytokines IL-17A and IL-22 were significantly decreased, while the Treg-related cytokines IL-4, IL-10, and TGF-β were significantly increased in the APS group, which was consistent with the results in Fig. 1. However, when ABX interfered with the gut microbiota, APS still reduced the Th17-related cytokines IL-17A and IL-22 and had no significant regulatory effect on the Treg-related cytokines IL-4, IL-10, and TGF-β (Fig. 3E-F). This suggests that the regulatory effect of APS on the Th17/Treg balance in the brains of EAE mice may be partially mediated by the gut microbiota.

Gut microbial diversity is altered by APS in EAE

Given that the protective effect of APS in EAE mice is mediated by the microbiome, we conducted high-throughput sequencing of the V3-V4 regions of the 16S rRNA gene in the feces of mice in five groups, including the normal, EAE, APS, ABX, and ABX_APS groups (Fig. 4A). The rarefaction curves of the Sobs and Shannon index tended to flatten, indicating that the amount of sequencing data was sufficient to reflect the diversity of the vast majority of the microbiota in the sample (Supplementary Fig. 1). By detecting alpha diversity, we found that the Chao and Shannon indices of the APS group were not significantly different from those of the EAE group (Fig. 4B-C). A Venn diagram was used to observe the differences in microflora composition between the five groups of mice. The results showed that 220 operational taxonomic units (OTUs) were shared among the five groups, and the number of unique OTUs in each group was 90 in the normal group, 19 in the EAE group, 8 in the APS group, 3 in the ABX group, and 2 in the ABX_APS group (Fig. 4D). To identify the effect of APS on the gut flora composition of EAE mice, we performed partial least squares discriminant analysis (PLS-DA) on the gut flora of mice in the normal group, EAE group and APS group at the genus and OTU levels. Significant differences were observed in the distribution of microflora among the three groups of mice (Fig. 4E-F). In addition, analysis of similarities (ANOSIM) showed a significant difference among the three groups (Fig. 4G-H). In summary, the beta diversity of the gut microbiota was mainly altered by APS in EAE mice.

The composition of the gut flora at the multispecies level is altered by APS in EAE

To investigate the specific changes in bacterial communities, we observed the gut microflora composition of the five groups at the phylum, family, genus, and species levels. Interestingly, differences in the composition of the gut microbiota were found between the groups at all levels (Fig. 5A-D, Supplementary Fig. 2). Linear discriminant analysis effect size (LEfSe) and linear discriminant analysis (LDA) were used to analyze the differences in microflora structure and the influence of each species abundance on microflora differences between the three groups. According to the evolutionary branching diagram (Fig. 5E, Supplementary Table 1) and differential strain classification diagram (Supplementary Fig. 3), the different effects were significantly affected by the abundance of 12 bacteria at different levels in the normal group, such as o_Lactobacillales, g_Lactobacillus, and f _Lactobacillaceae; 20 bacteria in the EAE group, such as g_Lachnospiraceae_NK4A136_group, g_Odoribacter, and f_Marinifilaceae; and 15 bacteria in the APS groups, such as c_Clostridia, f_Clostridiaceae, and o_Clostridiales. Next, we observed the relative abundances of the dominant bacteria at the phylum, family, genus, and species levels in the normal, EAE, and APS groups. At the phylum level, the bar plot of the Kruskal‒Wallis H test for multiple group comparisons showed that only Deferribacterota differed between the groups. The abundance of Deferribacterota in the EAE group was significantly increased, and APS treatment reduced the abundance of Deferribacterota (Fig. 5F, Supplementary Fig. 4A). At the family level, 11 bacteria were differentially abundant. Among them, Marinifilaceae, Deferribacteraceae, unclassified_o__Oscillospirales, and unclassified_o_Peptostreptococcales-Tissierellales increased in the EAE group, and APS treatment reduced the abundance of these bacteria (Fig. 5G, Supplementary Fig. 4B). At the genus level, 20 bacteria were found to have differences in abundance, and the top 15 different bacteria are shown in Fig. 5H. It can be seen that Lachnospiraceae_NK4A136_group, Prevotellaceae_UCG-001, Odoribacter, Anaerostipes, Mucispirillum, UBA1819, Bilophila, nclassified_o__Oscillospirales, unclassified_f__Clostridiaceae, Paludicola, and unclassified_o__Peptostreptococcales-Tissierellales were increased in the EAE group, and APS treatment reduced the abundance of these bacteria. Although Tuzzerella was significantly reduced in the EAE group, APS treatment increased the abundance of this bacterium (Fig. 5H, Supplementary Fig. 4C). At the species level, 36 species showed significant differences among the groups, and the top 15 different bacteria are shown in 5I. The difference analysis of single species showed that compared to the normal group, Lactobacillus_johnsonii in the EAE and APS groups was significantly decreased. APS treatment tended to increase the abundance of Lactobacillus_johnsonii compared to that in the EAE group, but the difference between the two groups was not statistically significant. Lactobacillus_murinus and Akkermansia_muciniphila abundance increased significantly in the EAE group but significantly decreased in the APS group, which was close to that in the normal group. However, there was no significant difference in the abundance of Akkermansia_muciniphila between the groups, which may be due to the large differences in sample data within the groups (Fig. 5J). Consistently, the proportional distribution of different levels of dominant bacteria in the corresponding groups was visualized in the Circos sample and species relationship diagram (Supplementary Fig. 5).

The metabolites in the gut and plasma are regulated by APS in EAE

It is well known that alteration of the gut microbiota composition causes changes in gut metabolites, which in turn leads to changes in metabolites in the blood. Hence, we observed the effects of APS on the metabolite composition in the feces and plasma of EAE mice. The PLS-DA model was used to show the differences in metabolite composition. The cation and anion sets of metabolites in feces and plasma were significantly separated, indicating that APS significantly changed the metabolite composition in the gut and blood (Fig. 6A-B). A Venn diagram was used to visualize the shared and unique differentially abundant metabolites in the feces and plasma (Fig. 6C-D). Differentially abundant metabolite analysis of fecal and plasma metabolites using volcanic maps showed a total of 815 differentially abundant metabolites in feces (247 upregulated metabolites and 568 downregulated metabolites) and 106 differentially abundant metabolites (53 upregulated metabolites and 53 downregulated metabolites) in plasma compared to those in the EAE group (Fig. 6E-F). Furthermore, we classified the compounds of the differentially abundant metabolites based on the HMDB. The classification statistical pie chart showed that lipids and lip-like molecules, organic acids and derivatives, and organoheterocyclic compounds were the most abundant types of metabolites in feces and plasma (Fig. 6G-H). We then performed cluster and variable importance (VIP) analysis for differentially abundant metabolites in feces and plasma, and the top 15 VIP differentially abundant metabolites are shown in Fig. 6I-J. APS had a significant regulatory effect on the metabolic composition in the feces and plasma of EAE mice.

Metabolic function is regulated by APS in EAE

Given that the metabolites of APS-treated mice were altered, we performed Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment of differentially abundant metabolites in feces and plasma to analyze metabolic function. The results showed that 20 biological pathways were significantly affected in the feces and plasma (Fig. 7A-B). Furthermore, we found that the neuroactive ligand‒receptor interaction pathway is affected by both fecal and plasma metabolites. We analyzed the metabolites involved in the neuroactive ligand‒receptor interaction pathway. The levels of sphingosine 1-phosphate (S1P), prostaglandin E2 (PGE2), adenosine diphosphate (ADP), and adenosine 5'-triphosphate (ATP) were significantly reduced by APS treatment (Fig. 7C). These results suggest that the protective effect of APS on EAE may affect the neuroactive ligand‒receptor interaction pathway by reducing S1P, PGE2, ADP, and ATP levels.

Bile acid metabolites are regulated by APS in EAE

From the above results, it has been proven that APS has a regulatory effect on metabolite composition in both feces and plasma. We suspected that the differentially abundant metabolites common to both samples might have an essential effect on the treatment of EAE by APS. Therefore, a Venn diagram was used to screen the different metabolites shared by the two samples. Twenty-six common differentially abundant metabolites were present in both feces and plasma (Fig. 8A). The classification statistical pie chart showed that lipids and lip-like molecules, organic acids and derivatives, and organoheterocyclic compounds were the most abundant types of metabolites among the 26 common differentially abundant metabolites (Fig. 8B). Cluster analysis was then conducted on the 26 common differentially abundant metabolites. The heatmap shows the relative expression levels of the common metabolites (Fig. 8C). In this cluster analysis, 10 subcluster trend diagrams were observed. It was found that only in subcluster 6 did APS treatment have the same trend of influence on metabolites in feces and plasma, both increasing the abundance of differentially abundant metabolites (Supplementary Fig. 6). Subcluster 6 contained two bile acid metabolites, taurochenodeoxycholate-7-sulfate and N-palmitoyl aspartic acid. We compared the effects of APS on the expression levels of these two metabolites in feces and plasma. The levels of Taurochenodeoxycholate-7-sulfate and N-palmitoyl aspartic acid were significantly increased by APS treatment in feces and plasma (Fig. 8D-E). These results indicate that bile acid metabolism may be a protective pathway of APS against EAE.

SCFAs are not regulated by APS in EAE

SCFAs are widely recognized as mediators of gut microbiota and host metabolic interactions. SCFAs are a class of bacterial metabolites with anti-inflammatory and immune-regulatory properties. The level of SCFAs in MS patients is significantly altered compared to that in healthy individuals. We speculated that APS may have a protective effect against EAE by regulating SCFAs levels. Therefore, we analyzed the expression levels of eight SCFAs: propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid, caproic acid, and isocaproic acid. APS had no significant regulatory effect on eight SCFAs compared to the EAE group (Fig. 9A-H), suggesting that the protective effect of APS on EAE was not mediated by SCFAs.

Multiple sclerosis is currently widely recognized as an autoimmune disease caused by the interaction between genetic and environmental factors. Th17 cells are key pathogenic cells of MS, secreting IL-17 and IL-22, which can disrupt BBB tight junctions by binding to the IL-17 receptor and IL-22 receptor expressed on BBB endothelial cells (BBB-EC). Subsequently, Th17 cells efficiently cross BBB-EC, expressing granzyme B, killing neurons and oligodendrocytes (OLs), and promoting CNS inflammation by recruiting more CD4 + T cells [21]. Tregs inhibit central inflammation and peripheral immune cell activation. The Th17/Treg balance is a critical factor in the disease progression of MS [22]. In this study, it was found that APS could regulate the Th17/Treg balance in the CNS and peripheral blood of EAE mice, reducing the proportion of Th17 cells and increasing the proportion of Treg cells, with no significant effect on Th1 cells. IL-17A and IL-22 were significantly downregulated, while IL-4, IL-10, and TGF-β were upregulated in the brain by APS. IL-17A and IL-22 can directly induce OL apoptosis, leading to demyelination and preventing OL maturation to further reduce the generation of new myelin. On the other hand, these two cytokines can act on microglia, induce microglia to M1-type polarization, and aggravate CNS inflammation [2]. One study has shown that the expression of the IL-17A receptor in microglia is low in the resting state and significantly upregulated in the onset of EAE [23]. Another study showed that stimulating microglia with IL-17 could upregulate the expression of inflammatory mediators, trigger the cytotoxic effect of microglia, and induce apoptosis or necrosis of OLs [24]. When microglia were cocultured with Th1 and Th17 cells that produce IL-17, microglia produced a large amount of IL-1β, IL-6, and TNF-α, which promote tissue damage and T lymphocyte differentiation into Th17 cells. However, these cytokines were not produced when microglia were cocultured with Th1 cells alone [25]. Th17 cells play an irreplaceable role in demyelinating lesions.

Increasing evidence has focused on the microbiota-gut-brain axis in relation to the maintenance of brain homeostasis and the pathophysiology of MS [26]. The immune system is an important way to connect the gut to the brain. The gut microbiota can influence the activation and proliferation of Th17 and Treg cells in EAE mice [27, 28]. Ivanov II et al. showed that colonization of the small intestine of mice with a single commensal microbe, segmented filamentous bacterium (SFB), is sufficient to induce the appearance of Th17 cells that produce IL-17 and IL-22 in the lamina propria [29]. Lee YK et al. found that SFB also induced Th17 in the CNS [27]. Compared with healthy people, patients with active relapsing-remitting multiple sclerosis (RRMS) had a significantly higher proportion of Th17 cells in the intestinal mucosa [30]. In two murine MS models, active and adoptive transfer EAE, encephalitogenic Th17 cells infiltrated the colonic lamina propria before neurological symptom development. Specifically, targeting Th17 cell intestinal homing impaired T-cell migration to the large intestine and dampened EAE severity [11]. In this study, we found that APS had a certain downregulation effect on the frequency of Th17 cells in colon tissue and significantly downregulated the cytokine IL-17A. However, APS also had a significant downregulation effect on Treg cells in colon tissue and had a certain downregulation trend on Treg-related cytokine IL-4, IL-10, and TGF-β levels, with no significant difference. First, Treg cells could not be stimulated to increase after APS downregulation of Th17 cell-induced intestinal inflammation; second, some Treg cells may migrate to peripheral blood, leading to an increase in the frequency of Treg cells in peripheral blood, which exerts an anti-inflammatory effect on EAE.

APS is one of the main bioactive components in the Chinese herbal medicine Astragalus membranaceus, which has favorable bioactivity in vivo and in vitro, including immunomodulatory, anti-inflammatory, antioxidant, anti-glomerulonephritis, anti-atherosclerosis, anti-diabetes and antitumor effects [12–14, 31]. More than 10 monosaccharides, including rhamnose, arabinose, xylose, ribose, galactose, glucose, mannose, fructose, fucose and so on, are polymerized to form APS through glycosidic bonds [32]. Mammals lack active carbohydrate enzymes for polysaccharide digestion, and most polysaccharides cannot be directly absorbed by the gut, while the gut microbiota can utilize and biotransform polysaccharides through its large carbohydrate active enzyme system [33]. A large number of studies have found that traditional Chinese herbs and their active components can promote health and prevent diseases by affecting the structure of gut microbiota [34–36]. Therefore, the gut microbiota may be one of the important links for APS to treat EAE. In the present study, we observed that antibiotic cocktail treatment abrogated the ameliorating effect of APS on disease severity in EAE mice, suggesting a therapeutic effect in a gut microbiota-dependent manner. Additionally, the regulatory effect of APS on the Th17/Treg balance in the CNS is partially dependent on the gut microbiota. Therefore, we investigated the effects of APS on the composition of gut flora in EAE mice. Obviously, we noted that APS had a regulatory effect on the levels of Lactobacillus_johnsonii, Lactobacillus_murinus, and Akkermansia_muciniphila in EAE. Lactobacillus is a beneficial symbiotic bacterium that protects the gut from various diseases. A study has shown that Lactobacillus_johnsonii can regulate the gut-brain axis to play a role in regulating memory dysfunction by modulating intestinal inflammation and permeability [37]. Another study provided evidence that Lactobacillus_johnsonii and Bacteroides thetaiotaomicron decreased the development of colitis mediated by TLR9 and promoted the elimination of Escherichia coli, Enterococcus faecalis and Candida glabrata from the gut via chitinase-like and mannosidase-like activities [38]. In this study, the abundance of Lactobacillus_johnsonii decreased significantly in EAE mice, while it increased in the APS group, which may have a protective effect on EAE. Studies have reported that an increase in Lactobacillus_murinus is correlated with an increase in intestinal inflammation and plays a proinflammatory role [39]. However, multiple studies have also shown that Lactobacillus_murinus has an immunosuppressive effect. Treatment with Lactobacillus_murinus significantly prevented intestinal ischemia/reperfusion injury, improved mouse survival through macrophages, and promoted the release of IL-10 from macrophages [40]. Intranasal administration of Lactobacillus_murinus can increase the proportion of Th17 and RORγt⁺ Tregs, a subtype of Tregs. Local lung Th17 and RORγt⁺ Treg cells can exert immunosuppressive effects. Therefore, Lactobacillus_murinus has a protective function in mitigating chronic inflammation induced by Mycobacterium tuberculosis [41]. In this study, the abundance of Lactobacillus_murinus was increased in EAE mice, and APS significantly suppressed its abundance, which contributed to alleviating intestinal inflammation and reducing Th17 cells. It is well known that the proportion of Akkermansia_muciniphila in MS patients is significantly increased, and it may interact directly or indirectly with spore-forming bacteria, thus exacerbating the inflammatory effect of MS-related intestinal microbiota [42]. In this study, APS had a downregulation effect on Akkermansia_muciniphila.

Metabolites derived from gut bacteria regulate the maturation and development of Th17 cells and Tregs [43, 44]. This study found that APS regulates the composition of metabolites in the gut and blood of EAE mice and affects the metabolic function of the body. We showed that the neuroactive ligand‒receptor interaction pathway is enriched in both fecal and plasma metabolites through pathway enrichment analysis of metabolome function. Therefore, we analyzed the metabolites related to this pathway and found that APS significantly reduced the expression of S1P, PGE2, ADP, and ATP, thereby playing a protective role against EAE. S1P is a pleiotropic signaling molecule derived from the sphingolipid metabolic pathway and is involved in the migration, proliferation, and differentiation of immune cells. Fingolimod is a nonselective S1P receptor modulator that significantly reduces the annual recurrence rate of RRMS [45]. It inhibits the migration of lymphocytes from secondary lymphoid tissues and reduces neuroinflammation in the CNS [46]. In this study, APS significantly reduced the level of S1P in peripheral blood, which may inhibit the migration of lymphocytes from secondary lymphoid tissues, reduce neuroinflammation in the CNS, and play a role in the treatment of EAE. Studies have demonstrated that PGE2 can directly promote the differentiation and proinflammatory function of IL-17-producing Th17 cells in humans and mice [47]. Additionally, PGE2 can regulate the differentiation direction of Th1/Th17 cells by regulating memory T cells, increasing IL-17, and decreasing IFN-γ production [48]. PGE2 also restricts the differentiation of initial T cells into Treg cells [49]. In this study, APS significantly downregulated the level of PGE2 in the blood, which may further contribute to downregulating the level and function of Th17 cells and increasing the level of Treg cells, thus regulating the Th17/Treg balance. Purinergic signaling nucleotides such as ATP and ADP are released in large quantities from cells under stress and activate inflammation. ATP is an activator of the NLRP3 inflammasome, which can promote the Th17 cell response [50]. In this study, APS significantly reduced the expression levels of ATP and ADP in peripheral blood, which may inhibit peripheral inflammation by suppressing purinergic signaling. However, the limitation of this study is the absence of further experiments aimed at elucidating the underlying mechanism of APS following the downregulation of S1P, PGE2, and ATP/ADP expression levels in the blood. We will further explain this mechanism in future studies.

Furthermore, some metabolites, such as bile acids and SCFAs, are known to exert a substantial influence on MS and EAE pathology. The results showed that APS might protect against EAE by regulating bile acids rather than SCFAs. Primary bile acids are produced mainly by the liver and are subsequently modified by gut microbes to produce secondary bile acids. The circulating levels of bile acid metabolites were altered in both children and adult patients with MS and EAE mice [51, 52]. In fact, Bhargava et al. found dysregulation of secondary bile acid metabolism in MS, with mice supplemented with the secondary bile acid taurine deoxycholic acid (TUDCA), an endogenous bile acid, reducing the clinical symptoms of EAE compared to untreated mice. TUDCA can block astrocyte polarization to the neurotoxic A1 phenotype and microglial polarization to the proinflammatory phenotype in vitro [51]. Cluster analysis of metabolites in feces and plasma detected by the nontargeted metabolome showed that APS significantly upregulated taurochenodeoxycholate-7-sulfate and N-palmitoyl aspartic acid in feces and plasma, both of which are bile acid metabolites and participate in bile acid metabolism. Taurochenodeoxycholate-7-sulfate can be converted to TUDCA. N-palmitoyl aspartic acid is classified as a long-chain N-acylamide that has a variety of physiological signaling functions, including metabolic homeostasis, memory, cognition, pain, and motor control. It has been suggested that APS can treat EAE by affecting bile acid metabolism. SCFAs are processed from indigestible dietary fibers by gut bacteria and have immunomodulatory properties. MS patients have reduced levels of propionic acid, an SCFA, in serum and fecal samples and an altered microbiome. Propionic acid supplementation shifted the Th17/Treg balance to a more regulatory phenotype, and long-term propionic acid supplementation in MS patients contributed to a reduced annual relapse rate and disease progression [53]. However, the results of this study showed that APS did not have a significant regulatory effect on eight SCFAs, suggesting that its regulatory effect on EAE may not be mediated by SCFA metabolism.

To conclude, we demonstrated that APS exerts a positive therapeutic effect on EAE, effectively suppressing neurological dysfunction and neuroinflammation by regulating the gut microbiota. APS regulates gut microbiota composition and alters gut metabolite composition, leading to a reduction in intestinal inflammation and the function of intestinal Th17 cells. Furthermore, APS regulates the composition of metabolites in the blood, such as downregulating the expression levels of S1P, PGE2, ADP, and ATP and upregulating the expression levels of taurochenodeoxycholate-7-sulfate and N-palmitoyl aspartic acid, thus regulating the Th17/Treg balance in peripheral blood. APS then restores the Th17/Treg balance in the CNS, resulting in reduced microglial activation, which reduces CNS inflammation and demyelination. In short, the microbiota-gut-brain axis may be the pathway through which APS exerts its therapeutic effect on EAE (Fig. 10). Our findings provide evidence that APS can be used as a potential therapeutic agent in patients with MS.

Ethics approval and consent to participate

All experiments were conducted in accordance with the regulations of the Experimental Animal Ethics Committee of Yue-yang Hospital (ethics number: YYLAC-2023-191).

Consent for publication

All authors have consented for publication.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

MJY and CXD designed the study. MJY, CXD and WYH provided funding. MJY, LQJ, ZY performed the experiments, analyzed the data, and drafted the manuscript. LXJ and DGQ performed some of the experiments. CYX and ZT helped perform some of the experiments. WYH, WXH and CXD revised the manuscript. All authors reviewed and approved the final manuscript.

Funding

This study was supported by grants from the National Natural Science Foundation of China (No. 81973543, 81703782), Shanghai Yang-fan Program (No. 22YF1449800), and Yue-yang Hospital of Integrative Medicine Foundation of Shanghai University of TCM (No. 2021yyjm05, 2021yygm02).

Availability of data and materials

The data generated from 16S rRNA gene high-throughput sequencing, nontargeted metabolomics of feces and plasma, and fecal SCFA content detection were deposited in the Science Data Bank (ScienceDB, https://www.scidb. cn/, DOI: 10.57760/sciencedb.10846).

Calahorra L, Camacho-Toledano C, Serrano-Regal MP, Ortega MC, Clemente D. Regulatory Cells in Multiple Sclerosis: From Blood to Brain[J]. Biomedicines, 2022, 10(2). DOI: 10.3390/biomedicines10020335.
Kunkl M, Frascolla S, Amormino C, Volpe E, Tuosto L. T Helper Cells: The Modulators of Inflammation in Multiple Sclerosis[J]. Cells, 2020, 9(2). DOI: 10.3390/cells9020482.
Miljković D, Spasojević I. Multiple sclerosis: molecular mechanisms and therapeutic opportunities[J]. Antioxid Redox Signal, 2013, 19(18):2286–334. DOI: 10.1089/ars.2012.5068.
Carbone F, De Rosa V, Carrieri PB, Montella S, Bruzzese D, Porcellini A, Procaccini C, La Cava A, Matarese G. Regulatory T cell proliferative potential is impaired in human autoimmune disease[J]. Nat Med, 2014, 20(1):69–74. DOI: 10.1038/nm.3411.
Alvarez JI, Saint-Laurent O, Godschalk A, Terouz S, Briels C, Larouche S, Bourbonnière L, Larochelle C, Prat A. Focal disturbances in the blood-brain barrier are associated with formation of neuroinflammatory lesions[J]. Neurobiol Dis, 2015, 74:14–24. DOI: 10.1016/j.nbd.2014.09.016.
Ding M, Lang Y, Shu H, Shao J, Cui L. Microbiota-Gut-Brain Axis and Epilepsy: A Review on Mechanisms and Potential Therapeutics[J]. Front Immunol, 2021, 12:742449. DOI: 10.3389/fimmu.2021.742449.
Ghezzi L, Cantoni C, Pinget GV, Zhou Y, Piccio L. Targeting the gut to treat multiple sclerosis[J]. J Clin Invest, 2021, 131(13). DOI: 10.1172/jci143774.
Parodi B, Kerlero de Rosbo N. The Gut-Brain Axis in Multiple Sclerosis. Is Its Dysfunction a Pathological Trigger or a Consequence of the Disease?[J]. Front Immunol, 2021, 12:718220. DOI: 10.3389/fimmu.2021.718220.
Nouri M, Bredberg A, Weström B, Lavasani S. Intestinal barrier dysfunction develops at the onset of experimental autoimmune encephalomyelitis, and can be induced by adoptive transfer of auto-reactive T cells[J]. PLoS One, 2014, 9(9):e106335. DOI: 10.1371/journal.pone.0106335.
Miyauchi E, Kim SW, Suda W, Kawasumi M, Onawa S, Taguchi-Atarashi N, Morita H, Taylor TD, Hattori M, Ohno H. Gut microorganisms act together to exacerbate inflammation in spinal cords[J]. Nature, 2020, 585(7823):102–106. DOI: 10.1038/s41586-020-2634-9.
Duc D, Vigne S, Bernier-Latmani J, Yersin Y, Ruiz F, Gaïa N, Leo S, Lazarevic V, Schrenzel J, Petrova TV, et al. Disrupting Myelin-Specific Th17 Cell Gut Homing Confers Protection in an Adoptive Transfer Experimental Autoimmune Encephalomyelitis[J]. Cell Rep, 2019, 29(2):378–390.e4. DOI: 10.1016/j.celrep.2019.09.002.
Ding G, Gong Q, Ma J, Liu X, Wang Y, Cheng X. Immunosuppressive activity is attenuated by Astragalus polysaccharides through remodeling the gut microenvironment in melanoma mice[J]. Cancer Sci, 2021, 112(10):4050–4063. DOI: 10.1111/cas.15078.
Zhong M, Yan Y, Yuan H, A R, Xu G, Cai F, Yang Y, Wang Y, Zhang W. Astragalus mongholicus polysaccharides ameliorate hepatic lipid accumulation and inflammation as well as modulate gut microbiota in NAFLD rats[J]. Food Funct, 2022, 13(13):7287–7301. DOI: 10.1039/d2fo01009g.
Jiao R, Liu Y, Gao H, Xiao J, So KF. The Anti-Oxidant and Antitumor Properties of Plant Polysaccharides[J]. Am J Chin Med, 2016, 44(3):463–88. DOI: 10.1142/s0192415x16500269.
Dong N, Li X, Xue C, Wang C, Xu X, Bi C, Shan A, Li D. Astragalus polysaccharides attenuated inflammation and balanced the gut microflora in mice challenged with Salmonella typhimurium[J]. Int Immunopharmacol, 2019, 74:105681. DOI: 10.1016/j.intimp.2019.105681.
Liu X, Ma J, Ding G, Gong Q, Wang Y, Yu H, Cheng X. Microglia Polarization from M1 toward M2 Phenotype Is Promoted by Astragalus Polysaccharides Mediated through Inhibition of miR-155 in Experimental Autoimmune Encephalomyelitis[J]. Oxid Med Cell Longev, 2021, 2021:5753452. DOI: 10.1155/2021/5753452.
Sun Y, Jing Y, Huang M, Ma J, Peng X, Wang J, Li G, Cheng X. The PD-1/PD-Ls pathway is up-regulated during the suppression of experimental autoimmune encephalomyelitis treated by Astragalus polysaccharides[J]. J Neuroimmunol, 2019, 332:78–90. DOI: 10.1016/j.jneuroim.2019.03.019.
Stromnes IM, Goverman JM. Active induction of experimental allergic encephalomyelitis[J]. Nat Protoc, 2006, 1(4):1810–9. DOI: 10.1038/nprot.2006.285.
Edgar RC. UPARSE: highly accurate OTU sequences from microbial amplicon reads[J]. Nat Methods, 2013, 10(10):996–8. DOI: 10.1038/nmeth.2604.
Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy[J]. Appl Environ Microbiol, 2007, 73(16):5261–7. DOI: 10.1128/aem.00062-07.
Kebir H, Kreymborg K, Ifergan I, Dodelet-Devillers A, Cayrol R, Bernard M, Giuliani F, Arbour N, Becher B, Prat A. Human TH17 lymphocytes promote blood-brain barrier disruption and central nervous system inflammation[J]. Nat Med, 2007, 13(10):1173–5. DOI: 10.1038/nm1651.
Liu R, Du S, Zhao L, Jain S, Sahay K, Rizvanov A, Lezhnyova V, Khaibullin T, Martynova E, Khaiboullina S, et al. Autoreactive lymphocytes in multiple sclerosis: Pathogenesis and treatment target[J]. Front Immunol, 2022, 13:996469. DOI: 10.3389/fimmu.2022.996469.
Das Sarma J, Ciric B, Marek R, Sadhukhan S, Caruso ML, Shafagh J, Fitzgerald DC, Shindler KS, Rostami A. Functional interleukin-17 receptor A is expressed in central nervous system glia and upregulated in experimental autoimmune encephalomyelitis[J]. J Neuroinflammation, 2009, 6:14. DOI: 10.1186/1742-2094-6-14.
Kawanokuchi J, Shimizu K, Nitta A, Yamada K, Mizuno T, Takeuchi H, Suzumura A. Production and functions of IL-17 in microglia[J]. J Neuroimmunol, 2008, 194(1–2):54–61. DOI: 10.1016/j.jneuroim.2007.11.006.
Murphy AC, Lalor SJ, Lynch MA, Mills KH. Infiltration of Th1 and Th17 cells and activation of microglia in the CNS during the course of experimental autoimmune encephalomyelitis[J]. Brain Behav Immun, 2010, 24(4):641–51. DOI: 10.1016/j.bbi.2010.01.014.
Rebeaud J, Peter B, Pot C. How Microbiota-Derived Metabolites Link the Gut to the Brain during Neuroinflammation[J]. Int J Mol Sci, 2022, 23(17). DOI: 10.3390/ijms231710128.
Lee YK, Menezes JS, Umesaki Y, Mazmanian SK. Proinflammatory T-cell responses to gut microbiota promote experimental autoimmune encephalomyelitis[J]. Proc Natl Acad Sci U S A, 2011, 108 Suppl 1(Suppl 1):4615–22. DOI: 10.1073/pnas.1000082107.
Yokote H, Miyake S, Croxford JL, Oki S, Mizusawa H, Yamamura T. NKT cell-dependent amelioration of a mouse model of multiple sclerosis by altering gut flora[J]. Am J Pathol, 2008, 173(6):1714–23. DOI: 10.2353/ajpath.2008.080622.
Ivanov, II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U, Wei D, Goldfarb KC, Santee CA, Lynch SV, et al. Induction of intestinal Th17 cells by segmented filamentous bacteria[J]. Cell, 2009, 139(3):485–98. DOI: 10.1016/j.cell.2009.09.033.
Cosorich I, Dalla-Costa G, Sorini C, Ferrarese R, Messina MJ, Dolpady J, Radice E, Mariani A, Testoni PA, Canducci F, et al. High frequency of intestinal T(H)17 cells correlates with microbiota alterations and disease activity in multiple sclerosis[J]. Sci Adv, 2017, 3(7):e1700492. DOI: 10.1126/sciadv.1700492.
Jin M, Zhao K, Huang Q, Shang P. Structural features and biological activities of the polysaccharides from Astragalus membranaceus[J]. Int J Biol Macromol, 2014, 64:257–66. DOI: 10.1016/j.ijbiomac.2013.12.002.
Zeng P, Li J, Chen Y, Zhang L. The structures and biological functions of polysaccharides from traditional Chinese herbs[J]. Prog Mol Biol Transl Sci, 2019, 163:423–444. DOI: 10.1016/bs.pmbts.2019.03.003.
Cantarel BL, Lombard V, Henrissat B. Complex carbohydrate utilization by the healthy human microbiome[J]. PLoS One, 2012, 7(6):e28742. DOI: 10.1371/journal.pone.0028742.
Hu Q, Zhang W, Wu Z, Tian X, Xiang J, Li L, Li Z, Peng X, Wei S, Ma X, et al. Baicalin and the liver-gut system: Pharmacological bases explaining its therapeutic effects[J]. Pharmacol Res, 2021, 165:105444. DOI: 10.1016/j.phrs.2021.105444.
Chen Z, Zhang Z, Liu J, Qi H, Li J, Chen J, Huang Q, Liu Q, Mi J, Li X. Gut Microbiota: Therapeutic Targets of Ginseng Against Multiple Disorders and Ginsenoside Transformation[J]. Front Cell Infect Microbiol, 2022, 12:853981. DOI: 10.3389/fcimb.2022.853981.
Buti S, Bersanelli M, Perrone F, Tiseo M, Tucci M, Adamo V, Stucci LS, Russo A, Tanda ET, Spagnolo F, et al. Effect of concomitant medications with immune-modulatory properties on the outcomes of patients with advanced cancer treated with immune checkpoint inhibitors: development and validation of a novel prognostic index[J]. Eur J Cancer, 2021, 142:18–28. DOI: 10.1016/j.ejca.2020.09.033.
Wang H, He S, Xin J, Zhang T, Sun N, Li L, Ni X, Zeng D, Ma H, Bai Y. Psychoactive Effects of Lactobacillus johnsonii Against Restraint Stress-Induced Memory Dysfunction in Mice Through Modulating Intestinal Inflammation and permeability-a Study Based on the Gut-Brain Axis Hypothesis[J]. Front Pharmacol, 2021, 12:662148. DOI: 10.3389/fphar.2021.662148.
Charlet R, Bortolus C, Sendid B, Jawhara S. Bacteroides thetaiotaomicron and Lactobacillus johnsonii modulate intestinal inflammation and eliminate fungi via enzymatic hydrolysis of the fungal cell wall[J]. Sci Rep, 2020, 10(1):11510. DOI: 10.1038/s41598-020-68214-9.
Selmin OI, Papoutsis AJ, Hazan S, Smith C, Greenfield N, Donovan MG, Wren SN, Doetschman TC, Snider JM, Snider AJ, et al. n-6 High Fat Diet Induces Gut Microbiome Dysbiosis and Colonic Inflammation[J]. Int J Mol Sci, 2021, 22(13). DOI: 10.3390/ijms22136919.
Hu J, Deng F, Zhao B, Lin Z, Sun Q, Yang X, Wu M, Qiu S, Chen Y, Yan Z, et al. Lactobacillus murinus alleviate intestinal ischemia/reperfusion injury through promoting the release of interleukin-10 from M2 macrophages via Toll-like receptor 2 signaling[J]. Microbiome, 2022, 10(1):38. DOI: 10.1186/s40168-022-01227-w.
Bernard-Raichon L, Colom A, Monard SC, Namouchi A, Cescato M, Garnier H, Leon-Icaza SA, Métais A, Dumas A, Corral D, et al. A Pulmonary Lactobacillus murinus Strain Induces Th17 and RORγt(+) Regulatory T Cells and Reduces Lung Inflammation in Tuberculosis[J]. J Immunol, 2021, 207(7):1857–1870. DOI: 10.4049/jimmunol.2001044.
Cekanaviciute E, Pröbstel AK, Thomann A, Runia TF, Casaccia P, Katz Sand I, Crabtree E, Singh S, Morrissey J, Barba P, et al. Multiple Sclerosis-Associated Changes in the Composition and Immune Functions of Spore-Forming Bacteria[J]. mSystems, 2018, 3(6). DOI: 10.1128/mSystems.00083-18.
Luu M, Pautz S, Kohl V, Singh R, Romero R, Lucas S, Hofmann J, Raifer H, Vachharajani N, Carrascosa LC, et al. The short-chain fatty acid pentanoate suppresses autoimmunity by modulating the metabolic-epigenetic crosstalk in lymphocytes[J]. Nat Commun, 2019, 10(1):760. DOI: 10.1038/s41467-019-08711-2.
Chen L, Sun M, Wu W, Yang W, Huang X, Xiao Y, Ma C, Xu L, Yao S, Liu Z, et al. Microbiota Metabolite Butyrate Differentially Regulates Th1 and Th17 Cells' Differentiation and Function in Induction of Colitis[J]. Inflamm Bowel Dis, 2019, 25(9):1450–1461. DOI: 10.1093/ibd/izz046.
Malpas CB, Roos I, Sharmin S, Buzzard K, Skibina O, Butzkueven H, Kappos L, Patti F, Alroughani R, Horakova D, et al. Multiple Sclerosis Relapses Following Cessation of Fingolimod[J]. Clin Drug Investig, 2022, 42(4):355–364. DOI: 10.1007/s40261-022-01129-7.
Tsai HC, Han MH. Sphingosine-1-Phosphate (S1P) and S1P Signaling Pathway: Therapeutic Targets in Autoimmunity and Inflammation[J]. Drugs, 2016, 76(11):1067–79. DOI: 10.1007/s40265-016-0603-2.
Boniface K, Bak-Jensen KS, Li Y, Blumenschein WM, McGeachy MJ, McClanahan TK, McKenzie BS, Kastelein RA, Cua DJ, de Waal Malefyt R. Prostaglandin E2 regulates Th17 cell differentiation and function through cyclic AMP and EP2/EP4 receptor signaling[J]. J Exp Med, 2009, 206(3):535–48. DOI: 10.1084/jem.20082293.
Napolitani G, Acosta-Rodriguez EV, Lanzavecchia A, Sallusto F. Prostaglandin E2 enhances Th17 responses via modulation of IL-17 and IFN-gamma production by memory CD4 + T cells[J]. Eur J Immunol, 2009, 39(5):1301–12. DOI: 10.1002/eji.200838969.
Li H, Chen HY, Liu WX, Jia XX, Zhang JG, Ma CL, Zhang XJ, Yu F, Cong B. Prostaglandin E(2) restrains human Treg cell differentiation via E prostanoid receptor 2-protein kinase A signaling[J]. Immunol Lett, 2017, 191:63–72. DOI: 10.1016/j.imlet.2017.09.009.
Naviaux RK. Metabolic features of the cell danger response[J]. Mitochondrion, 2014, 16:7–17. DOI: 10.1016/j.mito.2013.08.006.
Bhargava P, Smith MD, Mische L, Harrington E, Fitzgerald KC, Martin K, Kim S, Reyes AA, Gonzalez-Cardona J, Volsko C, et al. Bile acid metabolism is altered in multiple sclerosis and supplementation ameliorates neuroinflammation[J]. J Clin Invest, 2020, 130(7):3467–3482. DOI: 10.1172/jci129401.
Lee G, Hasan M, Kwon OS, Jung BH. Identification of Altered Metabolic Pathways during Disease Progression in EAE Mice via Metabolomics and Lipidomics[J]. Neuroscience, 2019, 416:74–87. DOI: 10.1016/j.neuroscience.2019.07.029.
Duscha A, Gisevius B, Hirschberg S, Yissachar N, Stangl GI, Eilers E, Bader V, Haase S, Kaisler J, David C, et al. Propionic Acid Shapes the Multiple Sclerosis Disease Course by an Immunomodulatory Mechanism[J]. Cell, 2020, 180(6):1067–1080.e16. DOI: 10.1016/j.cell.2020.02.035.

No competing interests reported.

Supplementalmaterials.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Th17/Treg balance is restored during the suppression of experimental autoimmune encephalomyelitis treated by Astragalus polysaccharides via the microbiota-gut-brain axis

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Animals

EAE introduction and evaluation

Treatment and sample collection

Flow cytometry

Quantitative real-time PCR

Histopathology

Antibiotic experiment

16S rRNA gene sequencing

Nontargeted metabolomics of feces and plasma

Fecal SCFA content detection

Statistical analysis

Results

CNS Th17/Treg balance is restored by APS in EAE

Amelioration of EAE by APS is mediated via the microbiota

Gut microbial diversity is altered by APS in EAE

The metabolites in the gut and plasma are regulated by APS in EAE

Metabolic function is regulated by APS in EAE

Bile acid metabolites are regulated by APS in EAE

SCFAs are not regulated by APS in EAE

Discussion

Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1