2.1. Cell culture and miR transfection
We purchased a MCF-7 cell line from Pasteur Institute of Tehran, Iran. 10% culture media generating from RPMI-1640 (Gibco), 1% penicillin and streptomycin mixed, and fetal bovine serum (FBS) (Gibco) were used to culturing the cells. The culture condition was contained 95% humidity, 5% CO2, and 37°C temperature. We detached and sub-cultured the cells with 80% confluency. MiR-424-5p and miR-142-3p nucleotide sequences were 5´-CAGCAGCAAUUCAUGUUUUGAA-3´ and 5´-UGUAGUGUUUCCUACUUUAUGGA-3´, respectively, which were obtained from “miRbase”. MiR control, miR-424-5p and miR-142-3p mimics were provided from GenePharma (Shanghai). Then, the electroporation strategy (BioRad instrument) was applied to mimic transfection into the cells. We assessed four cellular groups in the experiments, including miR-424-5p, miR-142-3p, miR-424 + miR-142, and negative controls (NCs). The mimics under study is endotoxin free.
2.2. RNA extraction and qRT-PCR
We used a Trizol extraction kit to extract RNAs from the BC cells, according to kit protocols. Extracted RNAs were assessed in terms of purification and concentration by measuring A260/A280 and A260/A230 absorbance using the NanoDrop (TermoFisher). Electrophoresis of the RNAs was done on 2% agarose gel to obtain the RNA quality. We synthesized the cDNAs from RNAs (1 µg) to measure the expression levels of miRs molecular targets via a BioFACT kit in a Thermal cycler (BioRad). Then, the SYBR green 2x-mediated qRT-PCR analyses was used to indicate the transcription levels of Bcl-2, Bax, c-Myc, Oct-3, Beclin-1, STAT-3 (Table 1) through the ABI Biosystems instrument.
Table 1
Primers | Forward and Reverse | Sequences (5′−3′) |
β-Actin | Fa Rb | TCCCTGGAGAAGAGCTACG GTAGTTTCGTGGATGCCACA |
Bax | F R | TTTGCTTCAGGGTTTCATCCA TCTGCAGCTCCATGTTACTGTC |
Bcl-2 | F R | CTGTGGATGACTGAGTACCTG GAGACAGCCAGGAGAAATCA |
Oct-3 | F R | GGGCTGAAGGTCCTGTCTTG GCCTGACATACATGAAATCAC |
Beclin1 | F R | ATCATGTGGTGCCGAATGGTG GAAGTCTACGGCATCAACACC |
STAT3 | F R | CACCTTTGACATGGAGTTGACC AGCAGATCACCCACATTCACT |
c-Myc | F R | AGGCTCTCCTTGCAGCTGCT AAGTTCTCCTCCTCGTCGCA |
a: forward, b: reverse |
2.3. Western blot assay
We used radioimmunoprecipitation (RIPA) lysis buffer for the extraction of total proteins from the BC cells. Then, the electrophoresis of 50 µg total proteins was done on the gel. The polyvinylidene difluoride-based membranes were used to blotting the proteins through the semi-dry western blot system (BioRad). The mentioned membrane blocking was performed using 0.5% Tween-20. Then, the membranes were covered with the first monoclonal antibody (goat mA) (Santa Cruz Biotechnology) for Bcl-2, c-Myc, Bax, Oct-3, Beclin-1, STAT-3, and β-actin. The membranes were washed with PBS, and then they were incubated with the combination of secondary mA (rabbit anti-goat) and peroxidase for 1h at room temperature. To the end, the protein bands were observed and analyzed using the western blot imaging system and Image J program, respectively.
2.4. Cell viability assay
The viability of four cellular groups including miR-424-5p transfected, miR-142-3p transfected, miR-424 + miR-142 combination, and NC was assessed using the MTT test. After transfection of 12×103 BC cells with mimics, they were cultured in the 96-well plates. Then, incubation of the cells was done at 37°C incubator for 48 h. The wells were covered with 100 µl of MTT with 2 mg/ml concentration. Then, the 100 µl DNSO was added to the cells to dissolve the formed crystals. The incubation at 37°C for 30 min was occurred, and then the absorbance values were measured using the Eliza reader system (Sunrise) at 570 nm wavelength. Each test was repeated three times.
2.5. Apoptosis assay using Annexin V/PI
The BC cells were transfected with the mimics and 5×105 of them were cultured in the plates (6-well). 48 h after the transfection with miR-142-3p and miR-424-5p, in a combined status or separately, the cells were covered with annexin V/PI (exBio) at 25°C for 15 min. the apoptotic and necrotic rates of BC cells were examined and analyzed via MACSQuant flow cytometry and FlowJo program, respectively.
2.6. Apoptosis assay by DAPI
The apoptosis rate of the cells was assessed via DAPI staining. After transfecting the mimics into the cells, 5×105 of them were seeded in the 96-well plates. The cells were washed with PBS in a triplicate manner, following 48 h incubation at 37°C. The cells were fixed using paraformaldehyde. Permeabilization of the cells was performed using Triton X-100. Then, the cells were covered with DAPI and visualized using citation 5 cell imaging system (Biotk).
2.7. Cell cycle
To assess the miR-424-5p and miR-142-3p impacts on cell-cycle, the restoration of the cells with mimics was occured and 5×105 of them were cultured into 6-well plates. The cells were maintained at 37°C for 48 h, and then they were detached and covered with 70% ethanol. After incubation with ethanol, the cells were stained with 0.1% DAPI and visualized through flowcytometry (MACSQuant).
2.8. Colony formation
We transfected miR mimics into the BC cells and cultured 6×103 of them in each well of a 6-well plate. The cells were incubated in an incubator contained 5% CO2 and 37°C temperature for 14 days, and the media of the cells was renewed every 4 days. Following 14 days, the cells were covered with crystal violet. To the end, the OPTICA inverted microscope was used to imaging the MCF-7 colonies.
2.9. Autophagy
The mimics were entered into the MCF-7 cell line and 5×105 of them were cultured into the 6-well plates. Then, following 48 h, the wells were washed with PBS and the medium of the wells was eliminated. Then, the cells were covered with 1 ml of monodansylcadaverine (MDC) and incubated at 37°C. After 15 min, the cells were detached and analyzed using flow cytometry and the FlowJo program.
2.10. Statistical analyses
Each experiment was repeated in a triplicate manner. The evaluation of data was done by GraphPad software (SanDiego, version 7) and represented as means ± standard deviation. The differences of two cell groups as well as differences among three or more groups were evaluated using Student’s t-test and ANOVA test, respectively. P < 0.05 was a significant result.