Animals
This study was approved by Institutional Animal Care and Use Committee of Jinan University. All procedures involving animals were performed in accordance with the animal research committee of Jinan University and the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals. Wild type 4-month old C57BL/6J male mice, weighed between 15–20 g, were purchased from The Experimental Animal Center of Guangdong (Guangzhou, China). The cortex, hippocampus, hypothalamus and amygdala were dissected on ice from fresh brain tissues for subsequent western blot and/or imaging using fluorescent microscope and electronic microscope.
Reagents
DMEM and fetal bovine serum (FBS) used in cell culture were purchased from Invitrogen. 3,3-diaminobenzidine tetrachloride (DAB), 1,4-dithiothreitol (DTT), Dimethyl Sulfoxide (DMSO), Triton X-100, Paraformaldehyde, Bovine Serum Albumin, Ethanol, and KCl hematoxylin protease inhibitor cocktail, Penicillin and streptomycin were from Sigma. Blue RangeTM Prestained protein Molecular Marker was from Pierce. BCA Protein Assay Kit was from Thermo Fisher Scientific. Anti-AFF4 antibody (cat. no. sc-390310; 1:1000) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA), anti-14-3-3θ antibody (cat. no. ab14749; 1:500) and anti-β-catenin rabbit polyclonal antibody (cat. no. ab16051,1:1,000) was purchased from Abcam. HRP-conjugated Affinipure Goat Anti-Mouse IgG(H+L) (cat.no.SA00001-1;1:3000), HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H+L) (cat.no.SA00001-2;1:3000) were purchased from Proteintech (Chicago, Ill., USA). PrimeSTAR DNA Polymerase, EasyTaq DNA Polymerase, SacI, XabI and T4 DNA ligase were purchased from Takara Bio, Inc. (Otsu, Japan).
Cell culture and transfection
The HEK293T cells were maintained in Dulbecco's modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin (Biochrom KG, Berlin, Germany) at 37˚C in a humidified 5% CO2 incubator. Transfection of cells with the indicated constructs or microRNA mimics or scrambled miRNA was conducted using Lipofectamine™ 2000 transfection reagent (Invitrogen) were conducted according to the manufacturer's instructions.
RNA extraction
Total RNA was extracted from cells using the TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). RNA quantity and quality was determined using NanoDrop 1000 Spectrophotometer (Thermo Scientific).
Reverse transcription and Quantitative Real Time-PCR (qRT-PCR)
1.5 μg extracted RNA was reverse transcribed to cDNA using All-in-One™ miRNA First-Strand cDNA Synthesis Kit (GeneCopoeia, Rockville, MD) according to the manufacturer’s instructions., All the cDNA products were diluted with 5 volumes of nuclease-free water and immediately used for qPCR analysis or stored at −20 °C. Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) was performed using All-in-OneTM miRNA qPCR Kit (GeneCopoeia, Rockville, MD). The reactions were performed in a 96-well plate (ABI) using the Applied Biosystems Quanstudio3 (Applied Biosystems, CA, USA). The U6 small nuclear RNA was used as internal and the relative expression of miR-203 was calculated using the ΔΔCt method.
Dual-Luciferase Reporter Gene Assay
The target gene of miRNA-203 was predicted using the algorithms of TargetScan, miRDB,Tarbase, MicroT-CTD. AFF4 was recognized as the potential target of miR-203 by all four algorithms with two conserved miRNA:mRNA interaction sites. Gene-specific primers were synthesized by Sangon Biotech (Shanghai, China) and were used to amplify the 331 bp of the 3’UTR of human AFF4 mRNA containing the two miR-203 target sites from the cDNA library of 293T cells (forward primer: 5’-CGAGCTCTACTGTTAGTGACTGATAAGGATGC-3’; reverse primer, 5’-GCTCTAGAACAAAGCATCTTAATGACACAGTA-3’). Mut-AFF4-3’UTR with sense mutations at the seed sequences of both miRNA:mRNA interaction sites was synthesized by Sangon Biotech (Shanghai, China). Both WT-AFF4-3’UTR and Mut-AFF4-3’UTR were cloned into the SacI/XbaI sites of pmirGLO Dual-Luciferse miRNA target expression vector (Promega, Madison, WI). Luciferase assays were performed in 293T cells co-transfected with miR-203 mimics or scrambled RNA and pmirGLO-WT-AFF4 3’UTR or pmirGLO-MUT-AFF4 3’UTR at 48 hours post transfection using the Dual-Luciferase Reporter 1000 Assay System (Promega, Cat. # E2920). Luciferase activity was measured using the luminometer ((CLARIOstarplus, BMG Labtech, Orthenberg, Germany)) and the normalized values were used for analysis.
Western Blot
Total cell and tissue proteins were obtained using RIPA lysis buffer. The equal amount of proteins were loaded into each lane of sodium dodecyl sulfate-polyacrylamidegel (10%) and electrophoresed. The resolved proteins were transferred to PVDF membranes. Following blocking with 5% non-fat milk at room temperature for 1h, the membranes were incubated with primary antibodies at 4ºC overnight, and then with HRP-conjugated secondary antibodies for 1h at room temperature. The membrane was again washed three times with TBST before monitoring by chemiluminescence (Immobilon horseradish peroxidase; Millipore, Billerica, MA) using Amersham Imager 680 (GE Healthcare Bio-Sciences Corp, Piscataway, NJ). Immunoblotting experiments were performed three times. Densitometry analysis was quantified using ImageJ v1.4.3.67 and the relative expression of the target protein was normalized to internal β-actin.
Construction of miR-203 Lentiviral expression vector
The 76bp mmu-pre-miR-203 (MI0000246) with 100bp flanking sequences at both 5’ and 3’ end was amplified with primer pairs (forward primer: 5’- GGAAAGGACGAAACACCGGCCGCACAGAGTGCAGCCCGGCC -3’; reverse primer, 5’- TGTCTCGAGGTCGAAATTCAAAAAATCTCGGCGATCCGGGTGCCC -3’) and cloned subsequently by homologous recombination into GV309-eGFP-Scr, a lentiviral vector containing a GFP expressing cassette (Genechem, Shanghai, China). The constructed GV309-pre-miR203-eGFP and the package vector was transfected into 293T cells for viral packaging using Lipofectamine 2000 (ThermoFisher Scientific, USA). The supernatants were collected 48h post transfection, followed by filtration with 0.45 μm filters. The lentiviral solution was concentrated by ultracentrifugation at 25000 rpm for 2 hrs at 4 °C and the final titer of viral solution was 4×108 infectious units/ml.
Stereotactic injection of Lentiviral vector into the hippocampus of mouse brain
In brief, mice were anesthetized using isoflurane and head-fixed over a heating pad set to 37°C. Place the animal inside the stereotact (Harvard Apparatus, Holliston, MA, USA) by adjusting the rods into the crevices just anterior to the animal's ears. Eyes were covered with artificial tear drops. The scalp was sterilized and was bisected to exposed between bregma and the lambda. Fix a syringe on the stereotact with the tip point to the bregma point, the coordinates of which would be considered as the zero point in all three axes. Lift the syringe in the vertical axis so that a planar movement would not scratch the skull and move the syringe head to the correct location (-2 at the anterior/posterior axis, ±2.0 at the lateral/medial axis and -2.0 at the dorsal/ventral axis relative to the bregma in mm for CA1 injections). A shallow hole was drilled with a fine driller and 2μl of GV309-pre-miR-203-eGFP or control vector GV309-eGFP-Scr was injected bilaterally into the CA1 region of hippocampus at a rate of 100nl/min rate using Hamilton 5ul syringe (87930 Hamilton, Reno, USA). Before each injection the pipette was lowered 0.1mm beyond intended target depth and held in place for 2 minutes to create space for injected solution, while after each injection the pipette was held in place for 5 min before retraction to prevent leakage. The incision was sterilized, glued and post-operative antibiotics (Amoxil, 50mg/ml) were administered for 7 days following surgery.
Tissue collection and imaging
Mice were euthanized using CO2 asphyxiation with a flow rate of 10%. Brains were removed and the hippocampus were dissected. The expressions of GFP in the target location were verified using a stereo microscope (Nikon, SMZ18, Japan). The images were taken with a cold CCD camera (Nikon, DSFi3, Japan) and processed with Nikon NIS Elements software (version D5.10). Tissue samples were flash frozen in liquid nitrogen and then stored at − 80 °C for future use.
Hippocampus protein extraction
Fresh hippocampus were cut at 100 µm thick sections and homogenized in glass dounce homogenizers with ice cold lysis buffer (1 ml/100 mg tissue, cat. no. ab156034, Abcam, Cambridge, UK) containing 1:100 protease inhibitor cocktail (Sigma-Aldrich, P2714, St. Louis, MO, USA). Samples were centrifuged at 12,000 g for 20 min and supernatants collected, aliquoted and frozen at − 80 °C. Protein concentration of each sample was determined using the Micro BCA assay (Thermo-Fisher Scientific, 23235, Waltham, MA, USA). 20 µg of protein per sample were loaded on 10% SDS-PAGE for electrophoresis and western blot subsequently.
Behavioral assessment
Mice were transferred to the testing room and acclimated for 30 min before starting all the following behavioral test. Spontaneous motor activity and anxiety were measured in an open field arena (50 × 50 × 50 centimeters) under dim light and were allowed to move freely for 15 minutes. The apparatus was cleaned with 70% ethanol before and between runs. The total distance moved (meters) and average velocity in the open field were recorded and quantified. The heatmaps for each mouse was plotted and averaged to create representative heatmaps for each group using mouse tracking software. Raw data were extracted and analyzed using Microsoft Excel.
The Y maze test was performed in a Y maze consisted of three arms (5 × 35 × 15 centimeters, width × length × height), with an angle of 120 degrees between each arm. The floor of the open field and the inside of Y maze was cleaned with 70% ethanol between trials and allowed to dry. The mouse was individually positioned at the end of one arm and released to navigate freely through the arms for eight min. Arm entry was defined as entry of the whole body into an arm. Alternation is successive triplets, each one with non-repetitive arms (i.e. B, C, A, A, B, C, etc.). The percentage of spontaneous alternation was calculated by dividing the number of alternations by the number of possible alternations [number of alternation/ (number of total arm entries-2)]. Additionally, total number of entrances was regarded as an estimate of locomotion.
The Morris Water Maze (MWM) tests were performed in a 120 cm diameter and 60 cm height water-filled circular pool, which was divided into four quadrants with a 10cm diameter escape platform hidden 0.5 cm below the opaque water in the center of one quadrant. Mice were allowed to explore the platform for two times every day from the four quadrants respectively, for four consecutive daily training trials. The time that the mice spent to reach the hidden platform during training trails was recorded as escape latency. The platform was removed for the probe trial performed on the fifth day. The mice entered the pool from the opposite quadrant of the platform and the time spent to cross the former platform location indicated the degree of memory consolidation. The total distance, average velocity, times of crossing the platform, time and distance moved in the target quadrant, time and distance moved in the position of platform were all recorded. Video tracking and behavior analysis of all the behavioral assessment were carried out using the Any-Maze animal tracking system software (Stoelting Co. Wood Dale, IL).
Electron microscopy
Mice were anesthetized and perfused transcardially with PBS followed by 2% PFA and 2.5% glutaraldehyde in phosphate buffer. The Brains were then collected. The CA1 sub region of the hippocampus were removed and stored overnight in the same fixative used for perfusion at 4°C. Coronal vibratome sections (300um) containing the rostral hippocampus were obtained with the help of mouse atlas and postfixed in 1% osmium tetroxide with 1.25% potassium ferrocyanide in phosphate buffer for 45 min, dehydrated in series of ethanol, and embedded in PolyBed 812 epoxy resin. Semithin sections (1 um) were cut and stained with toluidine blue to identify cortical layers. Ultrathin (70 nm) sections of cortex were cut using a Leica Ultracut UCT microtome (Leica, UC7, Japan) and mounted on 200 mesh copper grids. Ultrathin sections were contrasted with uranyl acetate and lead citrate and imaged on transmission electron microscope (HITACHI, HT7800, Japan). The same magnification and size of electron micrograph were used to compare synaptic profiles in the GV309-eGFP-Scr and GV309-pre-miR203-eGFP transfected mice.
Nissl staining
The brains of the sacrificed mice was collected on the completion of the behavioral assessment and fixed in 4% paraformaldehyde for 12 h and subsequently cut into 6-µm coronal sections using HistoCore Biocut (Leica, Buffalo Grove, USA). Slides were immersed for 3×5 min in xylene for paraplast and were then gradually hydrated by immersion in a series of decreasing concentrations of ethanol (100%, 95%, 90%, and 85%) and in distilled water for 2 min. The slides were sequentially transferred to a solution of toluidine blue (Sigma-Aldrich, MFCD00011934, St. Louis, MO, USA) for approximately 15 min in 60℃, in distilled water for 2 min, in 70% ethanol for1 min, and in a solution of 95% ethanol for approximately 90 s. Followed by dehydration in 100% ethanol and xylene for 2min, the slides were cover-slipped with DPX mountant (Electron Microscopy Sciences, 13512) and visualized under and optical microscope (Motic Easy Scan Motic, Canada).
Statistical Analysis
Data were presented as mean +- SD and the statistical analysis was carried out using Student's t-test with GraphPad Prism 6.0 for Windows (GraphPad Software, Inc., La Jolla, CA, USA). For all analyses, p values <0.05 were considered significant.