Widespread pfhrp2/3 deletions and HRP2-based false-negative results in southern Ethiopia

doi:10.21203/rs.3.rs-3404831/v1

Download PDF

Research Article

Widespread pfhrp2/3 deletions and HRP2-based false-negative results in southern Ethiopia

https://doi.org/10.21203/rs.3.rs-3404831/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Rapid diagnostic tests (RDTs) have played a significant role in expanding case management in peripheral healthcare systems. Histidine-rich protein-2 (HRP2) antigen detection (RDT) is predominantly used to diagnose P. falciparum. However, the evolution and spread of P. falciparum parasite strains that have deleted HRP2/3 genes, causing false-negative results, have been reported. This study assessed the diagnostic performance of HRP2-detecting RDTs for P. falciparum cases and the prevalence of pfhrp2/3 deletions among symptomatic patients seeking malaria diagnosis in selected health facilities in southern Ethiopia.

Methodology:

A multi-health facilities-based cross-sectional study was conducted on self-presented febrile patients seeking treatment in southern Ethiopia from September to July 2021. A purposive sampling strategy was used to enroll patients with microscopically confirmed P. falciparum. Dried blood spot samples were collected from microscopy-positive P. falciparum patients for further molecular analysis. DNA was extracted using gene aid kits and a nested PCR assay. Exon 2 of the hrp2 and hrp3 genes, which is the main protein coding region, was used to confirm its deletion.

Results

Of the 3,510 participants enrolled in this study, 50.3% were male and their mean age was 22.45 years. Of the total febrile patients screened for malaria infections, 33.4% (1174/3510) had malaria, as determined by smear microscopy. Of these, P. falciparum, P. vivax, and mixed infections accounted for 53.6%, 39.8%, and 6.5%, respectively. Of all malaria-positive cases as determined by microscopy, 21.1% (77/363) were tested negative by HRP2-based RDTs and hence regarded as false-negative cases. The sensitivity of PfHRP2 RDT compared with microscopy and PCR was 79% (95% CI: 74.22% − 82.88%) and 76.5% (95% CI: 72.0% − 81.0%), respectively. Parasite DNA was extracted from 363 dried blood spots, of which the presence of P. falciparum DNA was confirmed in two hundred seventy-nine (279/363. 76.8%) of the samples. Of the 279 P. falciparum confirmed samples, single-copy gene msp-2 amplifications were successful in 249 (89.2%) and were subjected to genotyping of hrp2/3 genes deletions. Deletions spanning exon 2 of hrp2, exon 2 of hrp3, and double deletions (hrp2/3) accounted for 68 (27.3%), 76 (30.5%), and 33 (13.2%), respectively. While the HRP2 RDT false-negative due to the pfhrp2 exon-2 deletion is 27.3% (68/249), the population-level prevalence estimates of pfhrp-2 exon-2 deletion leading to HRP2 RDT false negative was 18.7% (68/363). The overall prevalence of any pfhrp2/3 gene deletions in symptomatic P. falciparum patients across health facilities was estimated to be 144 (57.8%), leading to false negative PfHRP2 RDT results.

Conclusion

Because the magnitude of pfhrp2/3 gene deletions exceeds the threshold recommended by the WHO (> 5%), the findings of this study promote the initiation of non-HRP2-based RDTs as an alternative measure to curb the grave consequences associated with the continued use of HRP-2-based RDTs in the study area in particular and in Ethiopia in general.

P. falciparum

pfhrp2/3gene deletions

Health Centers

PfHRP2-RDT

southern Ethiopia

Malaria is a life-threatening vector-borne disease caused by a parasite called Plasmodium species. Malaria is endemic in 88 countries which affects around half of the world’s population, with the highest burden in sub-Saharan Africa. An estimated 95% of all malaria cases and deaths occurred in Africa [1]. Ethiopia is one of the most malaria-endemic countries in the world, with an estimated 68% of the population and 75% of the country’s geographic area at risk of malaria. The economic burden of infections in the country is disproportionately high due to the overlap of peak transmission seasons with major agricultural activities in rural areas. In Ethiopia, the magnitude of malaria distribution varies in time and space characterized by its locality, seasonality and unstable transmission forms. The country is home to both Plasmodium falciparum and Plasmodium vivax, and Anopheles arabiensis is the principal vector [3, 4].

Despite collective efforts that have resulted in malaria reduction, it continues to be a pressing global health issue, particularly in tropical and subtropical regions Among other human malaria-causing parasites, Plasmodium falciparum (P. falciparum) causes the most severe infections and is responsible for the majority of mortality and morbidity [2].

Accurate early diagnosis and prompt treatment are key strategies to control and prevent malaria in Ethiopia. Indeed, microscopy and rapid diagnostic tests (RDTs) are widely used malaria diagnostic tools in clinical settings. Although microscopy is the gold standard diagnostic method, it is not always feasible in all settings as it requires expertise, is time-consuming, infrastructure [5]. The development of malaria RDTs has contributed to case management, detection, and surveillance and has become one of the most effective diagnostic products in global health [6, 7]. Globally, 3.1 billion RDTs were sold in 10 consecutive years (2010-20), with 81% of these in sub-Saharan Africa (sSA) countries. Currently, RDTs are becoming an increasingly preferred method for malaria diagnosis throughout the world, especially in peripheral health facilities [8]. In Ethiopia RDT was introduced in late 2004 and continues to improve case management, especially at lower health facilities/health posts where most case diagnoses (> 70%) are dependent on it [9].

There are antibodies in malaria RDTs that are specific for antigens found in Plasmodium species, including lactose dehydrogenase (pldh), aldolase and histidine-rich protein 2 (HRP2). Of these, HRP2-based RDTs are the most effective for detecting P. falciparum, the most common malaria parasite. Compared with other commercially available RDTs, they are also more sensitive and heat-stable. Thus, globally, it is the most manufactured, procured and deployed RDT. It is not only the HRP2 antigen that has been detected using HRP2-based RDTs but also its isoform, HRP3, which has high sequence similarity to HRP2 [10].

Despite its advantages, this RDT is under serious threat because of the emergence of parasites not or little expressing the targeted proteins due to mutations in the genes that encode it [11–16]. This case has been reported in both laboratory and field isolates [17–18]. In recent years, studies have shown that a large number of P. falciparum cases have been reported to be negative by HRP2 detection RDTs, which raises concerns about its sensitivity. Pfhrp2/3 gene deletions have resulted in false negative results of HRP2-based RDTs [19]. In particular, the Horn of Africa has predominantly reported P. falciparum parasites that lack histidine-rich protein (HRP-2/3) antigens [20].

P. falciparum parasites lacking histidine-rich protein 2/3 (HRP2/3) antigens have been reported in Ethiopia with different frequencies of gene deletions from different parts of the country. For instance, studies conducted in 2021–2022 [14–16] reported a significant number of P. falciparum cases that could be missed by HRP2-RDTs due to pfhrp2/3 gene deletions. As per the WHO guidelines, the hrp2/3 deletion prevalence exceeding 5% calls for a switch off of HRP2-based RDTs [24]. However, non-HRP2-based RDTs not only less common but also less sensitive and are frequently more susceptible to heat and humidity [25]. Adequate evidence on the presence and magnitude of P. falciparum parasites with pfhrp2/3 gene deletions that cause false-negative PfHRP2-RDTs is important for policy decisions [26]. Therefore, this study was initiated to assess the diagnostic performance of HRP2-detecting RDTs for P. falciparum infections and the prevalence of pfhrp2/3 gene deletions among symptomatic patients seeking malaria diagnosis in selected health facilities in southern Ethiopia.

Study area

The study area is located in the southern and southwestern parts of Ethiopia, with an estimated 20.5 million people of diverse ethnic groups. The main sources of local livelihood are agriculture and livestock herding. Kolla and Woinadega are the major ecological features that cover most region. Approximately, 91.1% of the overall population lives in rural areas [27]. Diverse geographic areas in regions favor malaria vector breeding sites. The relative frequency varies in time and space within a given geographical range. The region is endemic to malaria with different transmission intensities. P. falciparum is the most dominant species in the region, representing more than 60% of cases [28].

The study area for this research comprises several districts with diverse ecological and epidemiological areas located in the regions. The study covered seven zonal areas of the regions; Kaffa (Bonga Hospital and Shishonde Health Center), Bench Sheko (Biftu and Debrewerk Health Center), Gedio (Chichu Health Center), South Omo (Keyafer Health Center), Gamo (Kolashelle Health Center), Gofa (Morka and Daramallo Heath Center), and Wolaita (Gesuba Primary Hospital) Zones are the study locations and areas. The study area map was created using ArcMap version 10.7.1 software (Fig. 1).

Study design and period

A multi-health facility-based cross-sectional study was conducted among 10 public health facilities in southern Ethiopia (Fig. 1). Study areas were selected on the basis of simple random sampling in consideration of the geographical representation and distribution of malaria transmission across the regions. The study was conducted between July and September 2022, during the rainy seasons.

Sample size determination

Sample size determination was determined using the formula;

Sample size\(: \varvec{n}\ge \varvec{d}\varvec{e}\varvec{f}\varvec{t}2\left[\right(\varvec{P}\left)\right(1-\varvec{P}\left)\right)/\varvec{d}^2 ]\)

where n = sample size, z = 95% statistic for the level of confidence (1.96), P = previous prevalence, d = margin of error, deft = sampling design effect = 2 (to account for observations correlated within the health center for hrp2/3 gene deletion), and a probability of committing a type-1 error = 95% [24]. Considering the estimated previous prevalence, p = 9.7% (d = 0.05) and 95% level of confidence (z = 1.96).

The sample sizes were estimated to be ≥ 270, with a minimum sample size of enrollments in the study.

This was adjusted on the basis of WHO master protocol of gene deletion procedures [29]. Thus, at a minimum, 370 P. falciparum-infected individuals were recruited from ten health facilities across SNNP regions. On average, 37–40 P. falciparum confirmed via microscopy samples were collected from the ten selected health facilities in southern and southwestern Ethiopia.

Study procedures and patient enrollments

The study was conducted in a clinical setting. Febrile patients seeking treatment presented themselves at the nearest public health centers and were screened for malaria infections using microscopy. A purposive sampling strategy was used to enroll study participants with confirmed P. falciparum results using microscopy. For each patient, a specific identification barcode was provided. All consent and assent were obtained in written form. Patients with complicated malaria were excluded from the study. Confirmed cases were treated according to national treatment guidelines. Structured questionnaires were used to collect sociodemographic information, clinical features, and laboratory results from each participant.

A tally was used to enroll study participants from each study site. Those microscopically confirmed as P. falciparum were tested on PfHRP-2 RDTs (SD Bioline Malaria Ag P.f./P. v. -RDT (Product code 05FK80; Standard Diagnostics, Inc., Republic of Korea), and the results were recorded carefully. Discordant results when test results are P. falciparum on microscopy and negative by RDTs or RDT P. vivax only and microscopically mixed infection are considered discordant profiles.

An SOP for study procedures was prepared for each study site in both the Amharic and English versions for reference. On-the-job training was provided to laboratory technicians at each study site. Strict follow-up and supervision were carried out.

Laboratory procedures

Microscopy

For microscopic procedures, thin and thick blood film preparation was conducted from finger-prick blood collections. Giemsa stain (10X) was used for slide preparation. Microscopically confirmed P. falciparum or mixed infections were subjected to subsequent data collection. Standard procedures for blood sample collection techniques were maintained. For thick smears, as per WHO recommendations, parasite density was measured against 200 white blood cells (WBCs), assuming a mean WBC count of 8000/µl [30]. The sensitivity of RDT was evaluated using smear microscopy and PCR.

Rapid diagnostic tests (RDTs)

One step, SD Bioline ^TM malaria HRP2 (P. F) and PLDH (P. V) with REF (Product code − 05FK80, LOT 05DDG005B, Standard Diagnostics, Inc., Republic of Korea) rapid diagnostic tests were used as a qualitative test for the differential detection of HRP-2 of P. falciparum and pLDH specific to P. vivax. The results with apparent HRP2 RDT negativity but P. falciparum positivity by microscopy indicated suspected pfhrp2/3- gene deletions.

Then, 5 µl of a fresh blood sample from a finger prick was added onto the test device window using the sample loop provided with the kit, followed by the addition of four drops of reagent buffer, and the result was recorded as per the indicated on the insert kit.

Dried blood spot (DBS) collections

Three to five dried blood spots by finger prick were collected on protein saver cards (Whatman 903TM LOT 7224921 W201 Global Life Science Solutions Operations UK Ltd, Amersham) from eligible study participants. The collected DBSs were dried, labeled with particular barcodes, and packed with desiccants in zip lock bags according to standard procedures and laboratory guidelines.

Molecular analysis

DNA extraction procedures

In briefly, DBS samples were arranged in the laboratory with a new laboratory identification number (Lab. ID). A 6-mm punch of DBS was punched out and placed into a 1.5-mL Eppendorf tube. Between each sample punch, the puncher was disinfected on clean plain paper. Genomic DNA extraction was conducted using an extraction kit known as the Geneius -TM Micro GDNA kit quick protocol (www.geneaid.com). To avoid cross-contamination, the working and stock samples were separated into different centrifuge tubes. Extracted DNA was kept at -20°C until it was used for amplification.

Genus (18 ribosomal RNA) and P. falciparum species-specific genotyping

A nested PCR-based approach was used in two-round amplification steps. The first round of PCR (N1) was to confirm the presence of the genus Plasmodium parasites, and the second (N2) was to differentiate the P. falciparum species. NB. The working laboratory is registered with the UK National External Quality Assessment Service (NEQAS).

In N1, one pair of primers was used to generate DNA amplicons, which serve as template for the N2 of PCR. The first PCR employed the genus-specific oligonucleotide primer pairs, rPLU5 and rPLU6, and the N2 species-specific oligonucleotide primer pairs, rFAL1, and rFAL2 (Table 1) as previously described [31].

Briefly, the N1 programs and cycling conditions were as follows: initial denaturing was conducted at 95°C for 10 min; 35 cycles of 95°C denaturing for 60 s, 58°C for 60 s, and 72°C for 90 s; and the final extension at 72°C for 10 min.

The second round of PCR was conducted at 95°C for 10 min of initial denaturing, followed by 60 sec at 95°C denaturing, annealing at 58°C for 60 sec, extension at 72°C for 90 sec, and a final extension at 70°C for 10 min. A total of 30x PCR cycles were conducted (Table 1).

Amplicons were determined by gel electrophoresis on 1.5% agarose stained with ethidium bromide, which was run for about one hour at 120V. The migration of PCR products in the gel was visualized under a Benchtop 2UVtrans-illuminator machine and photographed. 100 (BioChain 100-bp DNA Ladder) DNA ladder was used to estimate the movement base pairs. To monitor the quality of the protocol, specific positive 3D7 and nuclease-free water-negative controls were used.

Table 1

Primer assays used for genus- and *P. falciparum* species-specific amplification
	Name of Primer	Sequences 5' − 3'	Expected band size
N1- Genus- specific	rPLU6	TTAAAATTGTTGCAGTTAAAACG	1200 bp
N1- Genus- specific	rPLU5	CCT GTT GTT GCC TTA AAC TTC	1200 bp
N2 (species-specific)	rFAL1	TTA AAC TGG TTT GGG AAA ACC AAA TAT ATT	205 bp
N2 (species-specific)	rFAL2	ACA CAA TAG ACT CAA TCA TGA CTA CCC GTC	205 bp

Merozoite surface protein genotyping

This genotyping was conducted to limit the quality of confirmed PCR-P. falciparum (to confirm the presence of the qualified parasite’s DNA) species. Both N1 and N2 rounds of PCR for msp-2 genotyping were performed in 20 PCR strip volumes using 0.5 µl (www.cosmogenetech.com, Korea) of each forward and reverse primer. The N1 PCR amplification was conducted with an initial denaturation at 95°C for 3 min followed by 38 cycles at 95°C for 60 sec, 58°C for 60 sec, 72°C for 90 sec, and 72°C for 60 sec for final extensions, adopted from [31]. Amplified N2 PCR products were separated by gel electrophoresis with a 1.5% agarose gel at 120 V for 1h. Msp-2 Primer assay sequences - forward (F1) − 5’GAA GGT AAT TAA AAC ATT GTC 3’, Reverse (R1) -5’- GAT GTT GCT GCT CCA CAG- 3’ and Forward (F2) − 5’- GAG TAT AAG GAG AAG TAT G- 3’ Reverse (R2)-5’-CTA GAA CCA TGA ATA TGT CC- 3’.

Genotyping of pfhrp2 and pfhrp3

Molecular analysis of the pfhrp2 and pfhrp3 genes was conducted by amplifying one main coding region segment, exon-2, as described [32].

Briefly, PCR amplification of both hrp2/3 genes was conducted in 25 µl total -volume master mix and 3 µl of extracted DNA templates. Both forward and reverse primers of 1µl were added. We considered samples confirmed to be P. falciparum and amplified a single copy gene but could not amplify the main coding region of the target genes, exon 2, using specific primers; these samples were considered pfhrp-2 and pfhrp-3 negatives or gene deleted [21, 33, 34].

Primer assay sequences used for amplification of target genes- hrp2-exon-2 forward (F) 5′-AAG GAC TTA ATT TAA ATA AGA 3’, Reverse (R) 5’ AAT AAA TTT AAT GGC GTA GGC A 3’ and hrp3-exon-2 forward (F) 5’AAA GCA AAA GGA CTT AAT TC 3’, hrp3-exon-2 reverse (R) 5’ TGG TGT AAG TGA TGC GTA GT 3’. For quality assurance of laboratory procedures, known positive and negative controls were used in each PCR run. Reference genes for controls − 3D7 (P.F. positive), NTC (extracted with samples), Dd2 (pfhrp2-negative), and HB3 (pfhrp3-negative) controls were used for PCR assays [32]. Gel electrophoresis was performed using 2% agarose.

Data processing and statistical analysis

All field and laboratory procedures were performed according to standard operating procedures. The collected field data were double-checked for consistency and completeness. The data were entered into Epi Info version 7.2.5.0 software, exported to an Excel sheet, and rigorously checked for completeness. Data were analyzed using SPSS version 20.0 (SPSS, Chicago, IL, USA). The results were organized in terms of frequencies and percentages and presented with descriptive measures. Findings with a p-value of less than 0.05 were considered statistically significant.

The sensitivity (= True positive/ (True positive + False negative) of RDT against microscopy as well as PCR as a reference test was evaluated. The level of agreement between the diagnostic tools was determined by using Cohen’s kappa coefficient.

Sociodemographic and clinical features of study participants

Sociodemographic and clinical features of the study participants

The study enrolled 3,510 self-reported febrile individuals screened for malaria in ten health centers, of which 50.3% were male. Of the total, 1,174 (33.4%) were positive for malaria as determined by microscopy. Among the positives, P. falciparum accounted for 53.6%, followed by 39.8% P. vivax and 6.5% mixed infections. Across the health centers, the distribution of malaria varied, with the highest prevalence in Gesuba Primary Hospital, 150 (4.4%), and the lowest prevalence in Chichu Health Center, 27 (0.8%).

From the 370 P. falciparum malaria positives, 363 study participants had complete sociodemographic and clinical data and were selected for downward analysis. Of the 363 participants, 54.8% (199) were male. In terms of age, the largest group was 16 to 30 years old (43.8%), followed by 6 to 15 years old (25.3%). The majority of the participants (63%) lived in rural areas (Table 2- A).

Of the 363 participants, 56.4% (205) have reported malaria exposure history over the past month and the majority of participants (77.2%) had a parasite density of less than 5000 per microliter of blood. The majority of participants had a reported fever in the past 24 h (92.28%), and 75.2% had a current fever. Joint pain was reported in 80.5% of participants, followed by headache (89.25%). Feeling cold was reported by almost half of the participants (49.3%), whereas the frequency of nausea and vomiting was almost equal (51%) (Table 2-B).

Table 2

Sociodemographic and clinical characteristics of study participants selected for molecular analysis, Southern Ethiopian in 2021
2- A: - Sociodemographic characteristics of study participants, n = 363 (100%)
Study variables Category		n	(%)		P-value
Sex	Male	199	54.8		0.0658
Sex	Female	164	45.1		0.0658
Age strata in years	≤ 5	34	9.3		0.000
	6 to 15	92	25.3
	16 to 30	164	43.8
	31 to 50	73	20.1
	≥ 51	5	1.3
House locations	Urban	134	37		0.000
House locations	Rural	229	63		0.000
2- B: - Clinical characteristics of study participants, n = 363 (100%)
Prior malaria exposures	No	158	43.5	0.000
	Yes	205	56.4	0.000
Parasite Destiny p/µl blood	< 5000	178	77.2	0.001
Parasite Destiny p/µl blood	> 5000	185	57.3	0.001
Fever passed within 24h	No	28	7.7	0.0082
Fever passed within 24h	Yes	335	92.28	0.0082
Current fever	No	90	24.8	0.000
Current fever	Yes	273	75.2	0.000
Headache	No	39	10.7	0.000
Headache	Yes	324	89.25	0.000
Joint pain	No	71	19.5	0.000
Joint pain	Yes	292	80.5	0.000
Nausea and vomiting	No	178	49	0.703
Nausea and vomiting	Yes	185	51	0.703
Feeling cold	No	183	50.7	0.78
Feeling cold	Yes	180	49.3	0.78

Molecular analysis

I. Genus- and species-specific amplification and detection

Of the 363 samples, 279 (76.8%) were positive for P. falciparum in nested PCR amplification (Fig. 2).

II. pfmsp-2 genotyping results

Of the 279 positive samples for P. falciparum, 249 (89.2%) were also positive for a single -copy gene called pfmsp-2, indicating quality DNA for the next confirmatory analysis of pfhrp2/3 gene deletions. Thirty of the 279 samples were not amplified for msp-2 and from rejected pfhrp2/3 analysis (Fig. 3).

III. Molecular confirmation of pfhrp-2 and pfhrp-3 gene deletions

Of the 249 samples, 68 (27.3%, CI: 21.9% − 33.3%) were negative for pfhrp2, 76 (30.5%, CI % 24.9% − 36.7%) pfhrp3 negatives, and 33 (13.2%, CI % 9.3% − 18.1%) were both hrp2 and hrp3 negative.

Of the 249 samples genotyped for pfhrp2 and pfhrp3 gene deletion, 144 (57.8%, CI% 51.4%- 64.03%) samples were negative for either of the two targeted genes. On the other hand, 33 (13.3%, CI% 9.3% − 18.1%) samples had both hrp2 and hrp3 gene deletions.

Proportions of HRP2-based RDTs false negative due to hrp2/3 deletions

The proportions of HRP2 RDT false-negative P. falciparum cases was 77/363 (21.2% CI 95%: 17.1% − 25.7%) compared with microscopy. These are so-called putative gene-deleted parasites subjected to molecular confirmation.

Sensitivity of PfHRP-2 RDT to field microscopy and polymerase chain reactions (PCR)

Overall, the sensitivity (TP / (TP + FN) of PfHRP2 RDT compared to thick blood-smear microscopy was 79% (95% CI 74.22–82.88%). The Kappa coefficient value, the agreement between the PfHRP-2 RDT and microscopy, is 0.5158, indicating a moderate level of agreement. The sensitivity of the PfHRP-2 SD Bioline RDT test compared to PCR is 76.5% (95% CI: 72.0% − 81.0%) with a kappa coefficient value of 0.381 which indicates fair agreement between them (Table 3).

Table 3

Sensitivity of SD Bioline PfHRP2-RDT compared to microscopy and PCR.
Test results		Microscopic results				PCR results
Test results		+	-	N	Kappa	+	-		Kappa
PfHRP-2 RDT SD Bioline	Positive	286	0	286	0.5158	238	73	311	0.381
	Negative	77	0	77		41	11	52
	Total	363	0	363		279	84	363

+ Positive, - Negative, N-total, PCR-polymerase chain reactions, PfHRP-2 RDT SD Bioline Antigen HRP-II (P.f) / pLDH (P.v).

Contribution of hrp2/3 gene deletions to false-negative HRP2-based RDTs

From the 249 total PCR P. falciparum and qualified DNA through msp-2 positive samples, 18.8% (47/249) showed inconsistent results between smeared microscopy and PFHRP-2 RDT testing tools. These factors contributed to false negative PfHRP2-based RDTs. However, 81.1% (202/249) showed testing agreement between the testing tools.

Table 4

Proportions of gene deletions among discordant and concordant profiles of testing tool results in South Ethiopia.
Agreements Profiles	pfmsp2+ (n, %)	pfhrp2- (n, %)	pfhrp3- (n, %)	pfhrp2/3- (n, %)
Discordant	47 (18.8)	11 (23.4) CI% 12.3–38	15 (32) CI% 19- 47.1	33(70.2) CI% 55.1% 82.6
Concordant	202 (81.1)	64 (31.6) CI% 25.3–38.5	67 (33.1%) CI% 26.7-40.12	0 (0.0) CI% 0% − 1.8

The study found that none of the concordant samples had double pfhrp2 and pfhrp3 deletions. However, 31.6% (64/202) had pfhrp2 deletions and 33.1% (67/202) had pfhrp3 deletions. Among the 47 discordant samples, 70.2% (33/47) had dual gene deletions, whereas 23.4% (11/47) and 32% (15/47) showed single pfhrp2- and pfhrp3- gene deletions, respectively.

While the HRP2 RDT false-negative results due to the pfhrp2 exon-2 deletions are 27.3% (68/249), the population level prevalence estimates of pfhrp2 exon-2 deletion owing to HRP2 RDT false negative is 18.7% (68/363).

Geographical distribution of gene deletions across the study areas

The study findings revealed that the prevalence of P. falciparum parasites lacking a single pfhrp-2/pfhrp-3 gene and both genes varied across the study sites. The health center with the highest proportion of single deletions was Bonga Hospital, with 55.5% and 38.8% for pfhrp-3 and pfhrp-2, respectively. The highest proportion of double deletions was observed at the Debrewerk Health Center (75%). No double deletions were detected at the Keyafer Health Center. Wacha Health Center had the highest proportion of samples with a single gene deletion in both pfhrp-2 and pfhrp-3, with 11.4% of the samples containing double deletions (Fig. 7).

Proportions of suspected pfhrp2/3 deletions among microscopically confirmed P. falciparum infections

We estimated the prevalence of gene deletions from a total P. falciparum population confirmed by field microscopy as a denominator according to the WHO study protocol recommendation [25]. From 363 P. falciparum positive cases determined by routine microscopy, 18.7% had pfhrp2- deletions, 21% had pfhrp3- deletions, and 9% had both pfhrp2- and pfhrp3- gene deletions.

Table 5

Sociodemographic and clinical characteristics of study participants’ associations with *pfhrp2/3* gene deletions, n = 249, southern Ethiopia.
Study variables Category		N (%)	Any deletions (single or double Pfhrp2/3)	P value
Age strata in years	≤ 5	34 (9.3)	12 (6.8)	0.0693
	6 to 15	92 (25.3)	33 (18.7)
	16 to 30	164 (43.8)	85 (48.2)
	31 to 50	73 (20.1)	40 (22.7)
	≥ 51	5 (1.3)	6 (3.4)
Prior malaria exposures	No	93 (37.3)	75 (80.6%)	0.0148
Prior malaria exposures	Yes	156 (43.5)	101 (64.7%)	0.0148
Parasite Destiny p/µl blood	< 5000	117 (47%)	87 (74.3%)	0.314
Parasite Destiny p/µl blood	> 5000	132 (53%)	89 (67.4%)	0.314

Out of 249 study subjects genotyped for pfhrp2/3- molecular analysis, 43.5% (156) had a history of previous malaria exposure, and 101 (64.7%) had at least one pfhrp2/3- deletion. Specifically, 23.7% (37/156), 28.2% (44/156), and 12.8% (20/156) showed pfhrp2-, pfhrp3-, and double deletions, respectively. However, 37.3% (93/249) of study subjects had no previous malaria exposure history. Nevertheless, 80.6% (75/93) had no infection exposure history and showed at least one single or double gene deletion. From a total of gene-deleted parasites among patients without a previous malaria exposure history, 32.2% (30/93), 34.4% (32/93), and 14% (13/93) had pfhrp2-, pfhrp3- and double deletions, respectively. Analysis indicated that a previous history of malaria infection showed a significant association with gene deletions (P = 0.0148, < 0.05).

This study determined the molecular epidemiology of pfhrp2/3- deletions causing false-negative PfHRP2-based rapid diagnosis among symptomatic P. falciparum patients in southern Ethiopia. This study is anticipated to be the initial report to look into whether these gene deletions exist and how common they are in the diverse ecology of southern Ethiopia, and a systematic study that follows the WHO gene deletion guidelines [24].

In this study, the overall prevalence of malaria was 33.4%, with the majority of infections caused by P. falciparum (53.6%,), followed by P. vivax (39.8%) and coinfections (6.5%), respectively. The findings were consistent with the national species distribution report [35].

Based on field PfHRP2-RDTs and microscopy results, 21.2% (77/363) had discordant profile that were P. falciparum negative by RDT and positive by microscopy. They owed false negative PfHRP2-based RDT results. These are the proportions of suspected gene deletions due to deletions of RDT-targeted genes, exon-2 pfhrp2- or pfhrp3- (Table 3). This finding was lower than the study conducted in the Mount Cameroon region, estimated at 47.8% (7/16) [36]. However, higher than in Central Vietnam, 4.6% is responsible for false negative PfHRP-2 RDT [37], and they identified that P. falciparum parasites without these genes are emerging and recognized as a source of false negative PfHRP-2-based RDTs. This highlights the potential impact of gene deletions on the accuracy of malaria diagnosis using PfHRP2 RDTs and associated factors.

In the absence of alternative confirmatory diagnostic tests, such as microscopy or PCR, these false-negative RDT results can lead to serious consequences. False-negative results can delay anti-malarial treatment, potentially endanger lives, and become a source of continuous malaria transmission by escaping diagnostics [33, 38, 23]. In Ethiopia’s situation, the majority of case diagnoses were offered by HRP2-based RDTs for treatment decisions, and the consequence of false negative RDTs could be significant [9].

In comparison to blood smear microscopy, the sensitivity of the PfHRP2- RDT was 79% (95% CI 74.22–82.88%). Which is lower than those of studies conducted in China-Myanmar [39] but comparable to those of a systematic review study conducted in Ethiopia [40]. However, in comparison to PCR as a diagnostic reference, it was 76.5% (95% CI 72.0–81.0%) and higher than that in a study conducted in Ethiopia [40]. However, lower than that in studies conducted in Ethiopia [41], and French Guiana [42, 43].

In Ethiopia, diagnosing malaria mainly takes place at hospitals and health centers level using microscopy, and at community health posts using rapid diagnostic tests (RDTs) [44]. The diagnosis offered by microscopy is limited in Ethiopia [3]. Approximately 54% of malaria diagnoses in clinical settings are offered by RDTs [45], especially in lower health facilities. Because it's so sensitive and P. falciparum parasites are so common, the national malaria program tends to use PfHRP-2 RDT a lot in different health facilities. That means any false-negative RDTs due to mutations in the diagnostic could have serious consequences.

Our molecular analyses confirm that a considerable magnitude of single, pfhrp2- (27.3%), pfhrp3- (30.5%), and double pfhrp2/3- (13.2%) gene deletions have been confirmed among P. falciparum parasites isolated from clinical settings of Southern Ethiopia (Fig. 1). The current study findings were higher than those of recent studies conducted in Ethiopia by [23] and [46], which estimated 9.7% and 17.9% among symptomatic P. falciparum patients in clinical settings of different regional states, respectively. However, lower than the study conducted by [21] estimated that the local prevalence was 100% of pfhrp2 and pfhrp3 gene deletions. Our findings are comparable with a recent study conducted on the global prevalence of gene deletions, which were estimated at 21.29%, 34.49%, and 18.65% for single pfhrp2, pfhrp3, and dual pfhrp2/3, respectively [38]. These substantial amounts of false negatives remain undetected and untreated correctly because genetic mutation of parasites could likely serve as reservoirs and become a source of ongoing transmissions of the infections [47]. Genetic mutant parasite populations would likely be forced to escape diagnostic tools as a result of a massive testing and treatment strategy.

The overall prevalence of any pfhrp2/3 exon-2 deletions in symptomatic P. falciparum cases across health facilities was estimated at 144 (57.8%, CI at 95%, 51.4% − 64.03%), causing false negative PfHRP2- RDT results. The finding was higher than studies conducted in Nigeria [48], Rwanda [49], Ghana [50], and Zambia [51], (17%), (23%), (36.2%) (37.5%), respectively. However, the prevalence of deletions was lower than that in studies conducted in Sudan [52] and Eritrea [53], which estimated prevalence of 60% and 62%, respectively.

In a previous modeling study, it was shown that the prevalence and transmission of mutant P.falciparum parasites were generally reduced after switching to an RDT, whereas the reverse holds for continuing to use PfHRP-2 RDTs in areas where mutant falciparum parasites are responsible for false negative results [54]. Nevertheless, failure to consider changing PfHRP-2-based RDTs leads to an increase in the prevalence and transmission of parasites and could pose selective advantages for such parasites [55]. This can compromise malaria diagnosis accuracy, delay treatment, and impede surveillance and elimination efforts.

PfHRP2-based RDT antibodies are designed to recognize histidine-rich-protein − 2 of P. falciparum parasites. Due to structural uniformity between HRP2 and HRP3 proteins, they can recognize each other, allowing parasites lacking the pfhrp-2 gene to show P. falciparum positivity on PfHRP-2 RDT. Even though PfHRP2-based RDT antibodies were designed to detect HRP2 antigens in patients' blood, they can also recognize HRP3 proteins since the amino acid sequences between the two are very similar. Thus, parasites that lack the pfhrp-2 gene may show P. falciparum positivity on RDTs [57]. Thus, considering the potential cross-reactivity between antigens and providing the true prevalence of gene deletion [58 − 29], we estimated the magnitude of gene deletions from both pfhrp2 and pfhrp3 exon-2 analysis. The results indicated that the prevalence of pfhrp3 gene deletions was more distributed than that of pfhrp2 genes (Fig. 4). This finding is supported by studies conducted earlier [23, 49, 53]. In contrast, studies conducted in Guyana [60], Ghana [61], Rwanda [50], and Peru [62] have revealed that the prevalence of pfhrp2 is higher than that of pfhrp3 gene deletions.

Comparing the distribution of gene-deleted parasites across study areas indicated that the proportion of pfhrp-2 gene deletions varied across the health centers, ranging from 2.9% in the Keyafer health center to 35.2% in the Wacha health center. The same is true for the proportion of pfhrp-3 gene deletions, which also varied, ranging from 5.2% in Keyafer to 15.7% in Kola Shelle health centers. Double gene deletions (pfhrp-2 and pfhrp-3) were less frequent and ranged from 0% in Keyafer to 18.1% in Biftu and Debrework health centers. The variation in gene deletion proportions across the study areas may be due to differences in the genetic makeup of the local P. falciparum populations or differences in the intensity of malaria transmission in the different study sites, as an earlier study indicated that transmission intensity variation could affect the prevalence of gene deletions [26].

Taking into account malaria transmission features variation with respect to settings and intensity in Ethiopia [7], sampling from diverse ecology and transmission settings was rational to make a good estimation. Moreover, it also recommended that the sampling for the study of pfhrp2/3- gene deletions need to be true representations of geographical and epidemiological settings [16, 63]. The current study revealed the widespread spread of P. falciparum parasites carrying pfhrp2/3- gene deletions across different clinical settings of southern and southwestern Ethiopia. The widespread use of test-and-treat approaches in Ethiopia may have contributed to the evolution of diagnostic-resistant populations of P. falciparum parasites. This study highlights the importance of monitoring gene deletions in local and national P. falciparum populations to inform malaria case management.

Overall, the results suggest that gene deletions could be a potential contributing factor in cases of discordant results in malaria testing, and using confirmatory testing tools can help to reduce the risk of false-negative results.

The findings of this study highlight the importance of considering the sensitivity of diagnostic tools for detecting specific antigens in malaria diagnosis. Moreover, the study outcomes suggest that the absence of pfhrp2- may be a more reliable indicator of false-negative results than the absence of pfhrp3, as it is the most dominant antigen produced by parasites [18, 64].

The findings indicated that previous exposures to malaria infections showed a significant association with genetic mutant falciparum parasites (P = 0.0148, < 0.05) (Table 5). Gene-deleted P. falciparum parasites are more prevalent in newly infected patients. This could be related to antimalarial drug exposure. This will highlight further research on the fitness of gene mutant parasites and their association with drug susceptibility.

Deletions of the pfhrp2/3 genes have been shown to reduce the sensitivity and increase the false-negative rates of HRP2-based RDTs, as these deletions lead to the absence or reduced production of the HRP2- antigen [64, 65]. The absence of this gene could therefore compromise the accuracy of malaria diagnosis and impede effective treatment.

Misdiagnosis can result in significant disease and even death in all different settings if we fail to provide a high-quality malaria diagnosis. It can compromise the accuracy of malaria diagnosis, delay treatment, and compromise surveillance and elimination efforts.

Limitations of the study

The study was conducted during peak malaria transmission seasons in the country (July to September), and the status of gene deletions among the parasite population circulating during the minor transmission season was not analyzed. The study presented PCR-based molecular confirmation of pfhrp2/3 deletions via amplification of exon-2 genes only and did not look at the upstream and downstream flanking regions of both hrp2 and hrp3 genes. The molecular detection method used in this study could not show gene-deleted parasites with polyclonal infections and this may underestimate the true prevalence.

Overall, the current study indicated the widespread pfhrp2/3- gene deletions causing false negative PfHRP2-based RDTs which is WHO’s recommendation necessary to look for an alternative non-HRP2-based RDT. Based on the current findings, hrp2/3 gene deletions accounted for a significant number of false negative test results associated with these gene deletions leaving patients undetected and untreated. Therefore, the findings of this study promote the initiation of non-HRP2-based RDTs as an alternative measure to curb the grave consequences associated with the continued use of HRP-2-based RDTs in the study area in particular and in Ethiopia in general.

AAU, ALIPB

Addis Ababa University, Institute of Pathobiology

base pairs

EPHI

Ethiopian Public Health Institute:FN:False negative

SNNPR

South nations and nationalities region

WHO

World Health Organizations

msp-2

merozoite surface protein-2

DBS

Dried Blood Spot

FMOH

Federal Ministry of Health Ethiopia

HRP-2- Histidine-rich protein

pfhrp-2/3

Plasmodium falciparum histidine-rich protein 2/3

PCR

Polymerase chain reaction

True positive

SPSS

Statistical Packages for Social Sciences.

Ethical considerations

The study was conducted after the ethical approval was sought from Akililu Lemma Institute of Pathobiology, Addis Ababa University, and Ethiopian Public Health Institute. Written informed consent/assent was obtained from eligible study participants.

Conflict of interest

The authors declare that there are no conflicts of interest.

Availability of data and materials

All data generated in this study are included in this published article.

Funding

No funding

Acknowledgment

We would like to acknowledge all the study participants, health professionals who supported the fieldwork, Addis Ababa University for supporting the molecular biology analyses of this work and Human Heredity and Health in Africa (H3A-18-002) for partially funding this work.

Consent for publication

All authors have read and approved its submission for publication.

Competing interests

The authors declare that they have no competing interests.

Authors' Contributions

BM, SM, AA, GT, SD, and LG conceived the research idea and participated in the design and implementation of the study; BM, BD, AA & BG participated in the collection of samples; BM, AM, and LG participated in laboratory diagnosis, analysis of the data and interpretation and revised the manuscript. All the authors have read and approved the final manuscript.

Author’s details

¹Malaria, Neglected Tropical Diseases Research Team Bacterial, Parasitic, Zoonotic Diseases Research Directorate, Ethiopian Public Health Institute, Addis Ababa, Ethiopia,

²Akililu Lemma Institute of Pathobiology, Addis Ababa University, Addis Ababa, Ethiopia,

³Armeur Hansen Research Institute, Addis Ababa Ethiopia.

⁴Wollo University College of Medicine and Health Science, Department of Medical Laboratory Science

World Health Organizations. World malaria report 2020: 20 years of global progress and challenges. World malaria report 2020: 20 years of global progress and challenges. 2020:299.
World Health Organization. World Malaria Report 2022. World Health Organization; 2022. Dec 8.
Federal Ministry of Health Ethiopia. Ethiopia malaria elimination strategic plan: 2021–5.
US President's Malaria Initiative. Ethiopia Malaria Operational Plan FY 2018.
Wongsrichanalai C, Barcus MJ, Muth S, Sutamihardja A, Wernsdorfer WH. A review of malaria diagnostic tools: microscopy and rapid diagnostic test (RDT). Defining and Defeating the Intolerable Burden of Malaria III: Progress and Perspectives: Supplement to Volume 77 (6) of the American Journal of Tropical Medicine and Hygiene. 2007 Dec.
Wilson ML, Tests MRD. Clinical Infectious Diseases, Volume 54, Issue 11, 1 June 2012, Pages 1637–1641, https://doi.org/10.1093/cid/cis228.
FMOH., “National Malaria Elimination Roadmap of Ethiopia.,” vol. 6, no. 1, 2017.
World Health Organization. Scaling up Diagnostic Testing, Treatment and Surveillance for Malaria. Geneva: 2012.
2018 Final Ethiopian Public Health Institute. Ethiopia Services Availability and Readiness Assessment (SARA), Report. http://www.ephi.gov.et., no. May 2018, 2018, 10.13140/RG.2.2.16460.64649.
Kumar Bharti P, Singh Chandel H, Krishna S, Nema S, Ahmad A, Udhayakumar V, Singh N. Sequence variation in Plasmodium falciparum histidine-rich proteins 2 and 3 in Indian isolates: implications for malaria rapid diagnostic test performance. Sci Rep. 2017;7(1):1308.
Kumari MS, Sharma S, Bhardwaj N, Kumar S, Ahmed MZ, Pande V, Anvikar AR. Pfhrp2/3 gene deletion and genetic variation in PfHRP2-based RDTs with P. falciparum positive samples from India and its implication on malaria control. Infection, Genetics and Evolution. 2022;99:105232.
Sharma S, Ahmed N, Faizi N, Bharti PK, Sharma A, Srivastava B. A case report of late treatment failure in Plasmodium falciparum malaria in a traveler from the Democratic Republic of the Congo to India. IDCases. 2023;31:e01653.
Kumari S, Ahmed MZ, Sharma S, Pande V, Anvikar AR. Prevalence of Pfhrp2/3 gene deletions among false negative rapid antigen test results in central India. J. Vector Borne Dis., vol. 58, no. 3, pp. 273–280, Sep. 2021, 10.4103/0972-9062.328815.
Grignard L, Nolder D, Sepúlveda N, Berhane A, Mihreteab S, Kaaya R, Phelan J, Moser K, van Schalkwyk DA, Campino S, Parr JB. A novel multiplex qPCR assay for detection of Plasmodium falciparum with histidine-rich protein 2 and 3 (pfhrp2 and pfhrp3) deletions in polyclonal infections.J. EBioMedicine, vol. 55, May 2020, 10.1016/j.ebiom.2020.102757.
Kobayashi T. Uncovering hidden pfhrp2/3 deletion Plasmodium falciparum. EBioMedicine. 2020;56.
Parr JB, Verity R, Doctor SM, Janko M, Carey-Ewend K, Turman BJ, Keeler C, Slater HC, Whitesell AN, Mwandagalirwa K, Ghani AC. Pfhrp2-deleted Plasmodium falciparum parasites in the Democratic Republic of the Congo: a national cross-sectional survey. J Infect Dis. 2017;216(1):36–44. 10.1093/INFDIS/JIW538.
Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, Incardona S, Perkins M, Bell D, McCarthy J, Cheng Q. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010;5(1):e8091. 10.1371/JOURNAL.PONE.0008091.
Kemp DJ, Thompson JK, Walliker D, Corcoran LM. Molecular karyotype of Plasmodium falciparum: conserved linkage groups and expendable histidine-rich protein genes. Proceedings of the National Academy of Sciences. 1987;84(21):7672-6, 10.1073/PNAS.84.21.7672.
World Health Organization. Response plan to pfhrp2 gene deletions. World Health Organization; 2019.
Molina-de la Fuente I, Pastor A, Herrador Z, Benito A, Berzosa P. Impact of Plasmodium falciparum pfhrp2 and pfhrp3 gene deletions on malaria control worldwide: a systematic review and meta-analysis. Malar J. Dec. 2021;20(1). 10.1186/S12936-021-03812-0.
Golassa L, Messele A, Amambua-Ngwa A, Swedberg G. High prevalence and extended deletions in Plasmodium falciparum hrp2/3 genomic loci in Ethiopia. PLoS ONE. Nov. 2020;15(11). 10.1371/journal.pone.0241807.
Alemayehu GS, Blackburn K, Lopez K, Cambel Dieng C, Lo E, Janies D, Golassa L. Detection of the high prevalence of Plasmodium falciparum histidine-rich protein 2/3 gene deletions in Assosa zone, Ethiopia: implication for malaria diagnosis. Malar. J., vol. 20, no. 1, Dec. 2021.
Feleke SM, Reichert EN, Mohammed H, Brhane BG, Mekete K, Mamo H, Petros B, Solomon H, Abate E, Hennelly C, Denton M. Plasmodium falciparum is evolving to escape malaria rapid diagnostic tests in Ethiopia. Nat Microbiol. 2021;6(10):1289–99.
World Health Organization., Response plan to pfhrp2 gene deletions Global Malaria Programme. 2019.
World Health Organization. Master protocol for surveillance of pfhrp2/3 deletions and biobanking to support future research. Geneva: WHO, 2020. License: CC BY-NC-SA 3.0 IGO.
Watson OJ, Sumner KM, Janko M, Goel V, Winskill P, Slater HC, Ghani A, Meshnick SR, Parr JB. False-negative malaria rapid diagnostic test results and their impact on community-based malaria surveys in sub-Saharan Africa. BMJ global health. 2019;4(4):e001582.
Assemie A. The Occurrence and Distribution of Plasmodium Species in Woyn Wuha Health Center, Ethiopia. BioMed Research International. 2022;2022.,” Biomed Res. Int., vol. 2022, 2022, 10.1155/2022/2881879.
Kendie FA, Hailegebriel W, Nibret Semegn T, Ferede E. Prevalence of malaria among adults in Ethiopia: a systematic review and meta-analysis. J Trop Med. 2021;2021:1–9.
Master protocol for surveillance of pfhrp2/3 deletions and biobanking to support future research. Geneva: World Health Organization. ; 2020. License: CC BY-NC-SA 3.0 IGO.
World Health Organization. Malaria microscopy quality assurance manual-version 2. Volume 5. World Health Organization; 2016 Apr.
Snounou G, Singh B, Nested. PCR analysis of Plasmodium parasites. Malaria Methods and Protocols: Methods and Protocols. 2002:189–203.
Parr JB, Anderson O, Juliano JJ, Meshnick SR, Streamlined. PCR-based testing for pfhrp2-and pfhrp3-negative Plasmodium falciparum. Malar J. 2018;17:1–8.
Cheng Q, Gatton ML, Barnwell J, Chiodini P, McCarthy J, Bell D, Cunningham J. Plasmodium falciparum parasites lacking histidine-rich protein 2 and 3: a review and recommendations for accurate reporting. Malar J. 2014;13:283. https://doi.org/10.1186/1475-2875-13-283.
Parr JB, Kieto E, Phanzu F, Mansiangi P, Mwandagalirwa K, Mvuama N, Landela A, Atibu J, Efundu SU, Olenga JW, Thwai KL. Analysis of false-negative rapid diagnostic tests for symptomatic malaria in the Democratic Republic of the Congo. Sci Rep. 2021;11(1):6495.
Dillu D, Tesfaye G, Control M. “Federal Democratic Republic of Ethiopia Ministry of Health National Malaria Elimination Roadmap,” no. July 2020.
Eyong EM, Etutu SJ, Jerome FC, Nyasa RB, Kwenti TE, Moyeh MN. Plasmodium falciparum histidine-rich protein 2 and 3 gene deletion in the Mount Cameroon region. IJID Regions. 2022;3:300-7.
Thang ND, Rovira-Vallbona E, Binh NT, Dung DV, Ngoc NT, Long TK, Duong TT, Martin NJ, Edgel KA. Surveillance of pfhrp2 and pfhrp3 gene deletions among symptomatic Plasmodium falciparum malaria patients in Central Vietnam. Malar J. 2022;21(1):371.
Jejaw Zeleke A, Hailu A, Bayih AG, Kefale M, Amare AT, Tegegne Y, Aemero M. Plasmodium falciparum histidine-rich protein 2 and 3 genes deletion in global settings (2010–2021): a systematic review and meta-analysis. Malaria Journal. 2022;21(1):1–3.
Xiaodong S, Tambo E, Chun W, Zhibin C, Yan D, Jian W, Jiazhi W, Xiaonong Z. Diagnostic performance of CareStart™ malaria HRP2/pLDH (Pf/pan) combo test versus standard microscopy on falciparum and vivax malaria between China-Myanmar endemic borders. Malar J. 2013;12:1–8.
Feleke SM, Gidey B, Mohammed H, Nega D, Dillu D, Haile M, Solomon H, Parr JB, Tollera G, Tasew G, Mamo H. Field performance of Plasmodium falciparum lactate dehydrogenase rapid diagnostic tests during a large histidine-rich protein 2 deletion survey in Ethiopia. Malar J. 2022;21(1):236.
Bekele S, Mengistu L, Abebe A, Daddi J, Girmay M, Berhanu E. Evaluation of the performance of CareStartTM Malaria Pf/Pv Combo and Paracheck Pf® tests for the diagnosis of malaria in Wondo Genet, southern Ethiopia. Acta Trop. 2009;111(3):321–4.
Trouvay M, Palazon G, Berger F, Volney B, Blanchet D, Faway E, Donato D, Legrand E, Carme B, Musset L. High performance of histidine-rich protein 2 based rapid diagnostic tests in French Guiana are explained by the absence of pfhrp2 gene deletion in P. falciparum. PLoS ONE. 2013;8(9):e74269.
Alemayehu GS, Lopez K, Dieng CC, Lo E, Janies D, Golassa L. Evaluation of PfHRP2 and PfLDH Malaria Rapid Diagnostic Test Performance in Assosa Zone, Ethiopia. Am J Trop Med Hyg. 2020;103(5):1902.
Nega D, Abebe A, Abera A, Gidey B, G/Tsadik A, Tasew G. Comprehensive competency assessment of malaria microscopists and laboratory diagnostic service capacity in districts stratified for malaria elimination in Ethiopia. PLoS ONE. 2020;15(6):e0235151.
Yalew AW. Achievements, gaps, and emerging challenges in controlling malaria in Ethiopia. Front Trop Dis. 2022;2:771030.
Alemayehu GS, Blackburn K, Lopez K, Cambel Dieng C, Lo E, Janies D, Golassa L. Detection of high prevalence of Plasmodium falciparum histidine-rich protein 2/3 gene deletions in Assosa zone, Ethiopia: implication for malaria diagnosis. Malar J. 2021;20(1):1–1.
Wu L, van den Hoogen LL, Slater H, Walker PG, Ghani AC, Drakeley CJ, Okell LC. Comparison of diagnostics for the detection of asymptomatic Plasmodium falciparum infections to inform control and elimination strategies. Nature. 2015;528(7580):86–93.
Funwei R, Nderu D, Nguetse CN, Thomas BN, Falade CO, Velavan TP, Ojurongbe O. Molecular surveillance of pfhrp2 and pfhrp3 genes deletion in Plasmodium falciparum isolates and the implications for rapid diagnostic tests in Nigeria. Acta Trop. 2019;196:121–5.
Kozycki CT, Umulisa N, Rulisa S, Mwikarago EI, Musabyimana JP, Habimana JP, Karema C, Krogstad DJ. False-negative malaria rapid diagnostic tests in Rwanda: impact of Plasmodium falciparum isolates lacking hrp2 and declining malaria transmission. Malar J. 2017;16:1–1.
Amoah LE, Abankwa J, Oppong A. Plasmodium falciparum histidine rich protein-2 diversity and the implications for PfHRP 2: based malaria rapid diagnostic tests in Ghana. Malar J. 2016;15(1):1–8.
Kobayashi T, Sikalima J, Parr JB, Chaponda M, Stevenson JC, Thuma PE, Mulenga M, Meshnick SR, Moss WJ. The Search for Plasmodium falciparum histidine–rich protein 2/3 Deletions in Zambia and Implications for Plasmodium falciparum histidine-rich protein 2-Based Rapid Diagnostic Tests. Am J Trop Med Hyg. 2019;100(4):842.
Hamid MA, Awad-Elgeid M, Nasr A. Gene variation and suspected Plasmodium falciparum histidine-rich protein 2 gene deletion and its impact on sensitivity of malaria rapid diagnostic tests in Sudan. BMJ Global Health. 2017;2(Suppl 2).
Berhane A, Anderson K, Mihreteab S, Gresty K, Rogier E, Mohamed S, Hagos F, Embaye G, Chinorumba A, Zehaie A, Dowd S. Major threat to malaria control programs by Plasmodium falciparum lacking histidine-rich protein 2. Eritrea Emerg Infect Dis. 2018;24(3):462.
Mihreteab S, Anderson K, Pasay C, Smith D, Gatton ML, Cunningham J, Berhane A, Cheng Q. Epidemiology of mutant Plasmodium falciparum parasites lacking histidine-rich protein 2/3 genes in Eritrea 2 years after switching from HRP2-based RDTs. Sci Rep. 2021;11(1):21082.
Watson OJ, Slater HC, Verity R, Parr JB, Mwandagalirwa MK, Tshefu A, Meshnick SR, Ghani AC. Modelling the drivers of the spread of Plasmodium falciparum hrp2 gene deletions in sub-Saharan Africa. Elife. 2017;6:e25008.
Chaudhry A, Cunningham J, Cheng Q, Gatton ML. Modelling the epidemiology of malaria and spread of HRP2-negative Plasmodium falciparum following the replacement of HRP2-detecting rapid diagnostic tests. PLOS Global Public Health. 2022;2(1):e0000106.
Kong A, Wilson SA, Ah Y, Nace D, Rogier E, Aidoo M. HRP2 and HRP3 cross-reactivity and implications for HRP2-based RDT use in regions with Plasmodium falciparum hrp2 gene deletions. Malar J. 2021;20(1):1–7.
Agaba BB, Yeka A, Nsobya S, Arinaitwe E, Nankabirwa J, Opigo J, Mbaka P, Lim CS, Kalyango JN, Karamagi C, Kamya MR. Systematic review of the status of pfhrp2 and pfhrp3 gene deletion, approaches and methods used for its estimation and reporting in Plasmodium falciparum populations in Africa: review of published studies 2010–2019. Malar J. 2019;18(1):1–0.
Beshir KB, Parr JB, Cunningham J, Cheng Q, Rogier E. Screening strategies and laboratory assays to support Plasmodium falciparum histidine-rich protein deletion surveillance: where we are and what is needed. Malar J. 2022;21(1):201.
Bharti PK, Chandel HS, Ahmad A, Krishna S, Udhayakumar V, Singh N. Prevalence of pfhrp2 and/or pfhrp3 gene deletion in Plasmodium falciparum population in eight highly endemic states in India. PLoS ONE. 2016;11(8):e0157949.
Gendrot M, Fawaz R, Dormoi J, Madamet M, Pradines B. Genetic diversity and deletion of Plasmodium falciparum histidine-rich protein 2 and 3: a threat to a diagnosis of P. falciparum malaria. Clin Microbiol Infect. 2019;25(5):580–5.
Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, Incardona S, Perkins M, Bell D, McCarthy J, Cheng Q. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010;5(1):e8091.
Bharti PK, Chandel HS, Ahmad A, Krishna S, Udhayakumar V, Singh N. Prevalence of pfhrp2 and/or pfhrp3 gene deletion in Plasmodium falciparum population in eight highly endemic states in India. PLoS ONE. 2016;11(8):e0157949.
Iwasaki T, Shimoda M, Kanayama H, Kawano T. Histidine-rich protein 2: a new pathogenic factor of Plasmodium falciparum malaria. bioRxiv. 2021 Nov 19:2021–11.
Martiáñez-Vendrell X, Skjefte M, Sikka R, Gupta H. Factors affecting the performance of HRP2-based malaria rapid diagnostic tests. Trop Med Infect Disease. 2022;7(10):265.
Kojom LP, Singh V. Prevalence of Plasmodium falciparum field isolates with deletions in histidine-rich protein 2 and 3 genes in context with sub-Saharan Africa and India: a systematic review and meta-analysis. Malar J. 2020;19(1):1–4.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
05 Dec, 2023
Reviews received at journal
07 Nov, 2023
Reviewers agreed at journal
26 Oct, 2023
Reviewers invited by journal
08 Oct, 2023
Submission checks completed at journal
03 Oct, 2023
Editor assigned by journal
03 Oct, 2023
First submitted to journal
02 Oct, 2023

You are reading this latest preprint version

Widespread pfhrp2/3 deletions and HRP2-based false-negative results in southern Ethiopia

Status:

Version 1

Abstract

Background

Methodology:

Results

Conclusion

Figures

Introduction

Methods

Study area

Study design and period

Sample size determination

Study procedures and patient enrollments

Laboratory procedures

Microscopy

Rapid diagnostic tests (RDTs)

Dried blood spot (DBS) collections

Molecular analysis

DNA extraction procedures

Genus (18 ribosomal RNA) and P. falciparum species-specific genotyping

Merozoite surface protein genotyping

Data processing and statistical analysis

Results

Sociodemographic and clinical features of study participants

Sociodemographic and clinical features of the study participants

I. Genus- and species-specific amplification and detection

III. Molecular confirmation of pfhrp-2 and pfhrp-3 gene deletions

Sensitivity of PfHRP-2 RDT to field microscopy and polymerase chain reactions (PCR)

Geographical distribution of gene deletions across the study areas

Discussion

Limitations of the study

Conclusions

Abbreviations

Declarations

Ethical considerations

Acknowledgment

References

Additional Declarations

Status:

Version 1