Wide-type and TLR9 knockout C57BL/6J mice were randomly divided into a control and a DM group. The DM rat model was produced by intraperitoneal injection of STZ. And their bilateral hippocampi were injected into adeno-associated virus to inhabit Sirt1. At 12 weeks after injection, the rats were tested in water maze experiment and sacrificed. Hippocampi was for immunohistochemistry, Western blot, and RT-PCR. In vitro HT22 cells were incubated with or without high glucose medium, and further intervented with TLR9 antagonist ODN2088 and p53 over-expressed lentiviral infection. The detective method was almost the same as in vivo, except for flow cytometry.
Animals:
Three-week-old TLR9 KO transgenic mice (C57BL/6J-Tlr9M7Btlr/Mmjax, 014534) were purchased from the Jackson Laboratory (JAX, USA). Other age-matched experimental mice(C57BL/6J) were purchased from the Animal Centre of Chongqing Medical University, China. All mice were propagated and housed in the Animal Centre of Chongqing Medical University. Breeding mice were housed at 3 per cage (2 females and 1 male), and experimental mice were housed at 5 mice (all males) per cage in the IVC system. During the housing period, the environmental temperature was 22 ± 2 °C, and a 12 h day/night cycle was ensured (lights on 8 a.m.-8 p.m.). Sufficient food and water were supplied.
Experimental protocols
Eight-week-old wild-type (n = 16) and TLR9−/− mice (n = 32) with a mean body weight of approximately 24 g were randomly divided into the following 6 groups: (1) Control group, (2) TLR9−/− group, (3) DM group, (4) TLR9−/−DM group, (5) TLR9−/−DM + Vector group, and (6) TLR9−/−DM + Sirt1 group. STZ was purchased from Sigma-Aldrich Co. (St. Louis, MO, USA), and the m-Sirt1 AAV (HBAAV2/9-U6-sirt1 gRNA8-cas9, gRNA8: CCGTCTCTTGATCTGAAGTC) and vector (HBAAV2/9-GFP), were purchased from HANBIO Technology Co. Ltd. (Shanghai, China). After 1 week of adaptation, the mice in the DM, TLR9−/−DM, TLR9−/−DM + Vector, and TLR9−/−DM + Sirt1 groups were injected with STZ (TLR9 KO mice, 130 mg/kg; normal mice, 180 mg/kg) dissolved in 0.1 M sodium citrate buffer (pH 4.4) using an i.p. injection to establish the type 1 DM model. Three days after the STZ injection, the fasting blood glucose was monitored; when the level was above 16.67 mmol/L, the DM model was considered to be established successfully. Next, non-fasted blood glucose levels were monitored randomly at weeks 4, 8, and 12 through the mouse tail vein. At 4 weeks after STZ injection, the bilateral hippocampi of the mice in the TLR9−/−DM + Vector and TLR9−/−DM + Sirt1 groups were injected with the vector (3 µL per side; viral titre 1012 v.g./mL) and the Sirt1 AAV (3 µL per side; viral titre 1012 v.g./mL), respectively, using a stereotaxic frame (Stoelting Co., Ltd., USA), to selectively inhibit hippocampal Sirt1 expression.
Water maze experiment:
To measure the differences in the learning and cognitive abilities of the mice, a 6-d Morris water maze (MWM) test was performed at 12th week after STZ injection. The water maze instrument (130-cm diameter and 50-cm height) was divided into 4 quadrants. The depth of the water was 30 cm, and the water temperature was maintained at 22 ± 1 °C. The platform (10-cm diameter) was placed in the target quadrant and was lower than the water level by approximately 1–2 cm; the location was not changed. The experimental mice received 4 training sessions every day for 5 days. At the beginning of each training session, the mice were randomly placed in one of the 4 quadrants (head facing the pool wall). The training was stopped when the mice found the platform or the exploration time reached the time limit of 90 s, after which the technician led the mice to the platform within 15 s. After 5-day training was finished, the differences in escape latency were analysed to evaluate the spatial learning ability of the experimental mice. The exploratory experiment was performed within 24 h of the completion of the training. The platform was removed, and the mice were allowed to swim for 90 s. The time period required by each mouse to find the target quadrant in which the platform was originally placed and the number of times they entered this quadrant were recorded as the indicators for evaluating the spatial memory ability.
After the exploratory experiment, the visible platform test was performed to exclude the influences of differences in vision and muscle strength on the accuracy of the water maze experiment. This procedure raised the platform such that it was higher than the water level by 1 cm. The mice could see the platform during the swimming process. The parameters recorded were the time required for the mice to climb on the platform and the swimming speed of the mice.
Tissue preparation:
Following behavioural testing, all mice were deeply anaesthetised using 1% pentobarbital sodium (40 mg/kg) at 21 weeks of age. The bilateral hippocampi were removed and immediately placed in liquid nitrogen for future western blotting (WB). For immunohistochemistry (IHC), mice were perfused with 0.9% saline transcardially followed by 4% paraformaldehyde (PFA). Brains were removed and fixed in 4% PFA at 4 °C.
Cell culture and intervention:
The neuronal cell line HT22 was obtained from the ATGG cell bank. All procedures for the cell experiments were performed using sterile technique in order to avoid microbial contamination. The cell culture environment was a cell culture incubator (under 5% CO2 at 37 °C). The HT22 cells were cultured in high-glucose Dulbecco’s modified Eagle’s medium (H-DMEM, Gibco BRL Co, Ltd., USA) containing 10% foetal bovine serum (FBS, Gibco BRL Co, Ltd., USA). Cells were passaged (at ratios of 1:3–4) when the cell confluence reached approximately 80%. Adherent cells were digested using 0.25% trypsin without EDTA (Gibco BRL Co, Ltd., USA) for approximately 3–5 minutes, collected, and centrifuged. After the supernatant was discarded, the cells were placed in new cell culture flasks. Some cells were collected in dimethyl sulfoxide (DMSO, Thermo Scientific, Waltham, MA, USA) cryopreservation solution and stored in liquid nitrogen. The cells were treated for 3 days with 25 mM glucose (yielding a total glucose concentration of 50 mM) or 25 mM mannitol(33), which was used as an osmotic control. To regulate the expression of TLR9 and wild-type p53, the cells were pre-treated with the TLR9 antagonist ODN2088 (ODN; 5 µM, InvivoGen, Thermo Fisher Scientific Inc., Waltham, USA) and sh-p53 [rLV-mP53-ZsGreen-Puro, mouse wild-type P53 (NM_011640), viral titre 108 TU/mL, Labcell Inc., Chongqing, China].
Western blotting:
Hippocampal tissues from the mice were homogenised in radioimmunoprecipitation assay buffer (RIPA buffer, Beyotime Inc. Shanghai, China) containing a protease and phosphatase inhibitor cocktail (Roche, Switzerland). The protein concentration was measured using the bicinchoninic acid assay (BCA assay kit, Beyotime Inc. Shanghai, China). All protein samples were adjusted to the same concentration. After thorough mixing, the samples were loaded for protein separation. A 10–12% SDS-polyacrylamide gel was used as the separating gel. The voltage was 100 V, and the electrophoresis time was 120 min. After the electrophoresis was finished, the separated proteins were transferred to a polyvinylidene difluoride (PVDF, Millipore, Dundee, Scotland, UK) membrane. The membrane was immediately blocked in a 5% bovine serum albumin (BSA) solution at room temperature for 1 h. Primary antibodies targeting the following proteins were used: TLR9 (1:500, Imgenex, Novus, USA, IMG-305A), Sirt1 (1:500, Imgenex, Novus, USA, 51641), Phospho-P38MAPK (1:1000, Cell Signaling Technology Co. Ltd., Massachusetts, US, 8690), total P38MAPK (1:1000, Cell Signaling Technology Co. Ltd., Massachusetts, US, 8690), p53 (1:500, Abcam Co. Ltd., Cambridge, UK, ab26), ADAM10 (1:1000, Abcam Co. Ltd., Cambridge, UK, 124695), BACE1 (1:500, Abcam Co. Ltd., Cambridge, UK, 108394), LC3B (1:1000, Abcam Co. Ltd., Cambridge, UK, 192890), Atg5 (Cell Signaling Technology Co. Ltd., Massachusetts, US, 12994), P62 (Cell Signaling Technology Co. Ltd., Massachusetts, US, 23214), Beclin1 (Cell Signaling Technology Co. Ltd., Massachusetts, US, 3495), Aβ (1:500, Abcam Co. Ltd., Cambridge, UK, 11132), Aβ40 (1:500, Synaptic Systems Co. Ltd, Germany, 218221), Aβ42 (1:500, Synaptic Systems Co. Ltd, Germany, 218721), Caspase 3 (1:1000, Gene Tex, Inc., California, USA, GTX110543), Pro-caspase 3 (1:500, Abcam Co. Ltd., Cambridge, UK, ab32150) and β-actin (1:1000, Zhongshan Inc. Beijing, China). Primary antibodies were incubated with the membrane at 4 °C overnight. On the following day, the membrane was rinsed 3 times in Tris-buffered saline-Tween 20 solution. Then, the membrane was incubated with the corresponding horseradish peroxidase-labelled secondary antibody(1: 100,Zhongshan Inc. Beijing, China) at 37 °C for 1 h. The membrane was rinsed 3 times in TBST, and an enhanced chemiluminescence reagent (Thermo Scientific, Waltham, MA, USA) was added to develop the target proteins. The greyscale density of the protein band was analysed using substrateBio-1D software (Vilber Lourmat, Marne-la-Vallée, France).
Immunohistochemistry:
Brains were fixed in 4% PFA for 24 h after having been dissected out. Then they were embedded in paraffin, and tissue sections (4–6 µm) were obtained for IHC analysis. For heat-induced epitope retrieval, deparaffinized and hydrated sections were incubated in 1 mM citrate buffer (pH 6.0) at 95 °C for 30 min in a microwave oven. Then sections were incubated with 3% H2O2 for 20 min. Nonspecific binding was blocked via incubation with 10% goat serum for 30 min at 37 °C. After that sections were treated with the primary antibody of Aβ (1:200, Abcam Co. Ltd., Cambridge, UK, ab11132) overnight at 4 °C. After washing with PBS, sections were incubated with biotinylated secondary antibody (Zhongshan Inc. Beijing, China) for 30 min at 37 °C. Finally immunoreactivity were detected by diaminobenzidine. Sections were dehydrated and mounted on slides. All sections were blindly examined with the microscope at × 40,×100, × 400 magnification.
Flow cytometric analysis:
After interventions with high glucose, TLR9 inhibitors or lentiviral infection, the apoptotic rates in all groups of HT22 cells were evaluated following the protocol of Annexin V-FITC Apoptosis Detection Kit (Vazyme Biotech Co., Ltd, A211). The adherent cells were digested for 3 minutes and then were centrifuged twice. After incubation with Annexin V-FITC and PI staining solution for 10 minutes at room temperature, all groups were analysed via flow cytometry (BD Co. Ltd, USA).
Statistical analysis:
All data were analysed using SPSS 22.0 statistical software. After the MWM experimental data were confirmed to meet the requirements of the Shapiro-Wilk test and the distribution of equal variance, the differences in the escape latency of mice on the same day among different groups were compared using two-way repeated-measures ANOVA, and the differences in the escape latency of mice in the same group at different time points were compared using multivariate ANOVA. The other data obtained in this study were analysed via one-way ANOVA followed by Tukey’s post hoc test (equal variance assumed) or Dennett’s T3 post hoc test (equal variance not assumed). All data are presented as the mean ± SEM. P < 0.05 was considered to be statistically significant.