Prognostic biomarker DARS2 correlated with immune infiltrates in bladder tumor

doi:10.21203/rs.3.rs-3440059/v1

Download PDF

Research Article

Prognostic biomarker DARS2 correlated with immune infiltrates in bladder tumor

https://doi.org/10.21203/rs.3.rs-3440059/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose

The biological role of DARS2 in bladder cancer remains elusive. To study the effect of DARS2 on bladder cancer and to investigate its impact on overall survival.

Methods

We analyzed the correlation between DARS2 expression and prognosis, tumor stage, and immune infiltration in bladder cancer using The Cancer Genome Atlas(TCGA) database. We validated findings in clinical samples from The First Affiliated Hospital of Nanchang University and explored the biological functions of DARS2 using cell and animal models.

Results

We found DARS2 to be upregulated in bladder cancer, associated with tumor progression and poor prognosis. Immune infiltration analysis suggested that DARS2 may facilitate immune evasion by modulating PD-L1. Cell and animal experiments validated that DARS2 knockdown inhibited cancer cell proliferation, metastasis, tumorigenesis, and downgraded PD-L1 levels.

Conclusions

Our study reveals DARS2 as a potential prognostic biomarker and immunotherapy target in BLCA.

DARS2

bladder cancer

Prognosis

Immune infiltration

PD-L1

Bladder cancer(BLCA) is the second most common malignancy in the genitourinary system, ranking just behind prostate cancer. Globally, it is the ninth most prevalent cancer, and among males, it ranks sixth most common. According to the latest data, it is estimated that by the year 2023, there will be 82,290 newly diagnosed cases of BLCA in the United States, with 16,710 associated deaths (Bibliography Bray, et al. 2018). Approximately 70–80% of patients are diagnosed with non-muscle-invasive BLCA at the initial diagnosis. However, up to 20% of patients progress to advanced, high-grade muscle-invasive BLCA, with a 5-year survival rate of less than 50% (Bibliography Kohada, et al. 2021). Despite significant advancements in the treatment of BLCA, including targeted therapies and immunotherapy, the survival rates for BLCA have not shown significant improvement over the past three decades (Bibliography Berdik 2017). Therefore, investigating the underlying mechanisms of BLCA development and identifying novel therapeutic targets is of paramount importance for improving patient prognosis.

aminoacyl-tRNA synthetases (ARS) are critical enzymes that catalyze the synthesis of proteins by transferring amino acids onto their corresponding homologous transfer RNAs (tRNAs) (Bibliography Lee, et al. 2004,(Bibliography Onuora 2023,(Bibliography Yu, et al. 2021). ARS constitutes an evolutionarily conserved and essential enzyme family responsible for catalyzing the linkage of tRNA with its cognate amino acid, facilitating translation (Bibliography Nie, et al. 2019).ARS was once considered a family of 'housekeeping' enzymes; however, it is now known that they play diverse roles, including involvement in transcription, translation, splicing, inflammation, angiogenesis, and apoptosis. ARS also serves as regulators and signaling molecules in various immune diseases, infectious diseases, and tumor immunity (Bibliography Nie, et al. 2019,(Bibliography Park, et al. 2005,(Bibliography Jafarnejad, et al. 2018).

The gene encoding mitochondrial Aspartyl-tRNA synthetase 2 (DARS2), DARS2 encodes mitochondrial ARS, which specifically catalyzes the aminoacylation of aspartyl-tRNA. Mutations in this gene are associated with leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation, a white matter brain disorder characterized by brainstem and spinal cord involvement and elevated lactate levels (Bibliography Köhler, et al. 2015,(Bibliography Martikainen, et al. 2013). DARS2 is a significant member of the ARS family and is implicated in tumorigenesis (Bibliography Lee, et al. 2018,(Bibliography Zhou, et al. 2020). Sukru’s group discovered that the deficiency of DARS2 leads to the activation of various stress responses in a tissue-specific manner. Depletion of DARS2 in the heart and skeletal muscles results in a severe disruption of mitochondrial protein synthesis (Bibliography Lee, et al. 2018,(Bibliography Zhou, et al. 2020). It has been discovered that HBV inhibits NFAT5 via the miR-30e-5p/mitogen-activated protein kinase signaling pathway upstream of NFAT5. Furthermore, HBV enhances hepatocellular carcinoma tumor development by suppressing NFAT5 through downstream target genes, including DARS2 (Bibliography Qin, et al. 2017). It reported an upregulation of DARS2 expression in lung adenocarcinoma and highlighted its role in regulating the proliferation, invasion, and apoptosis of lung adenocarcinoma cells. Moreover, DARS2 overexpression was associated with poor prognosis in lung adenocarcinoma (Bibliography Jiang, et al. 2022). However, the biological role of DARS2 in BLCA has not yet been completely researched.

In this study, we investigated the expression of DARS2 in BLCA and its corresponding adjacent non-cancerous tissues, as well as the immune infiltration patterns. We also analyzed the relationship between DARS2 expression and overall survival. Additionally, we explored the impact of DARS2 interference on tumor cell proliferation, invasion, migration, and PD-L1 expression, which was validated through animal experiments. All study findings collectively support the potential of DARS2 as a novel prognostic marker for guiding BLCA treatment.

This study was approved by the Ethics Committee of the First Affiliated Hospital of Nanchang University, Ethics license number: (2022)CDYFYYLK(11–031); CDYFY- IACUC-202308QR018.

Data Source

mRNA expression data and clinical information for BLCA were downloaded from The Cancer Genome Atlas (TCGA) (https://portal.gdc.cancer.gov), while pan-cancer data for DARS2 were obtained from TIMER2 (http://timer.cistrome.org/) (Bibliography Li, et al. 2020).To further validate the protein expression of DARS2 in BLCA, we collected surgical specimens of BLCA and normal bladder tissues from six patients during surgery. Additionally, we selected pathological specimens from 37 BLCA samples and 10 normal bladder tissue samples at the First Affiliated Hospital of Nanchang University for immunohistochemistry (IHC) and collected clinical information from these patients. All patient specimens underwent histological diagnosis by two pathologists.

Survival Analysis

Patients were stratified into high-expression and low-expression groups based on DARS2 expression levels in the TCGA dataset and IHC expression in specimens collected from the First Affiliated Hospital of Nanchang University. OS (Overall Survival) analysis was performed using the 'survival' and 'survminer' R packages to analyze and visualize survival information for both the TCGA dataset and patients collected from the First Affiliated Hospital of Nanchang University.

Immunoinfiltration and Gene Expression Correlation Analysis

TIMER2 is a comprehensive resource for studying molecular features of tumor-immune interactions across various cancer types (https://cistrome.shinyapps.io/timer/) (Bibliography Li, et al. 2020). We utilized TIMER2 to analyze the correlation between DARS2 expression and the infiltration of seven immune cell types, including CD4⁺T cells, CD8⁺T cells, B cells, NK (Natural Killer) cells, macrophages, MDSCs (Myeloid-Derived Suppressor Cells), CAFs (Cancer-Associated Fibroblasts), macrophages, and Treg (Regulatory T) cells.

We also analyzed the genes of three immune checkpoints, including PD1 (Programmed Cell Death 1, also known as PDCD1), PD-L1 (Programmed Cell Death 1 Ligand 1, also known as CD274), and CTLA4 (Cytotoxic T-Lymphocyte-Associated Protein 4), using the Genetic correlation module on TIMER2 (adjusted for tumor purity) with statistical methods based on Spearman's rank correlation coefficient. Furthermore, we conducted preliminary validation of DARS2 and PD-L1 expression using five pairs of BLCA tissues.

Gene Set Enrichment Analysis (GSEA)

Performing Gene Set Enrichment Analysis (GSEA) using gene sets from the MSigDB collection between the high and low DARS2 expression groups (Bibliography Subramanian, et al. 2005). Identifying potential signaling pathways regulated by DARS2 using the 'clusterProfiler' package.

Cell Culture and Transfection

The human urothelial carcinoma cell lines T24, J82, EJ, and the normal urothelial cell line SV-HUC were obtained from the Cell Bank of the Shanghai Institute of Cell Biology, Chinese Academy of Sciences, China. T24, J82, EJ, and SV-HUC cells were cultured in DMEM, RPMI-1640, and F12K media, respectively, supplemented with 10% fetal bovine serum (FBS, Hyclone) and 100 U/mL penicillin/streptomycin, and were grown at 37°C with 5% CO₂. T24 and EJ cells were seeded in six-well plates at a density of 2x10⁵ cells per well.

Primers and SiRNA Knockdown Fragments

DARS2:

Forward Primer: CGAGATGAAGGTTCAAGACCAGA

Reverse Primer: GCCAGGAATACTGGAGCAAACC

β-Actin:

Forward Primer: TCTTCCAGCCTTCCTTCCT

Reverse Primer: AGCACTGTGTTGGCGTACAG

DARS2 SiRNA Interference Fragments:

si-1: GCGTAGTTTCCAAATGCAGTA

si-2: GCCACCTATGGAACTGATAAA

si-3: GCCAACACTATGACTTGGTTT

Lentiviral Interference Fragment (shRNA):

shRNA: GCGTAGTTTCCAAATGCAGTA

Lentiviral Vector: pLV3-U6-MCS-shRNA-EF1a-CopGFP-Puro

Other Reagents

DARS2 antibody: Sourced from Wuhan Boster Biotechnology Co., Ltd., Catalog Number A06034-1.GAPDH antibody: Obtained from Wuhan Sanying Biotechnology Co., Ltd., Catalog Number 60004-1-Ig.Anti-mouse HRP-conjugated secondary antibody: Supplied by Wuhan Sanying Biotechnology Co., Ltd., Catalog Number KFA025.Anti-rabbit HRP-conjugated secondary antibody: Provided by Wuhan Sanying Biotechnology Co., Ltd., Catalog Number KFA005.PD-L1 antibody: Procured from Wuhan Sanying Biotechnology Co., Ltd., Catalog Number 28076-1-AP.Lipo 2000 transfection reagent: Purchased from Sigma-Aldrich, Massachusetts, USA.PEI transfection reagent: Obtained from Wuhan Sanying Biotechnology Co., Ltd. DAB staining solution: Sourced from Background Soledad Technology Co., Ltd.

Ethical approval

This study was approved by the Ethics Committee of the First Affiliated Hospital of Nanchang University, Ethics license number: (2022)CDYFYYLK(11-031); CDYFY- IACUC-202308QR018.

Upregulation of DARS2 Expression in BLCA

We analyzed TCGA data to investigate the expression of DARS2 in tumor and normal tissues. Our findings revealed that DARS2 expression was significantly higher than that in normal tissues across 28 types of tumors, including BLCA, ACC, BRCA, CESC, CHOL, COAD, DLBC, ESCA, GBM, HNSC, KICH, KIRC, LAML, LGG, LIHC, LUAD, LUSC, OV, PAAD, PRAD, READ, SKCM, STAD, TGCT, THCA, THYM, UCEC, and UCS (Fig. 1A). Furthermore, our analysis of TCGA data demonstrated a significant upregulation of DARS2 expression in BLCA (P < 0.001, Fig. 1B). Additionally, analysis of paired mRNA expression data from TCGA showed a significant increase in DARS2 expression in tumor tissues (P < 0.001, Fig. 1C).

Subsequently, qPCR was performed to validate the mRNA expression levels of DARS2 in BLCA using paired samples from five patients. The results showed an increase in DARS2 mRNA expression in four pairs of cancer tissues compared to adjacent normal tissues (Fig. 1D). Protein immunoblotting results further demonstrated elevated expression of DARS2 in both cancer cell lines and tumor tissues (Fig. 1E-F). IHC analysis of ten pairs of bladder cancer tissues revealed increased expression of DARS2 in bladder cancer compared to normal bladder mucosal epithelial tissues (P < 0.05, Fig. 1G-H).

Subsequently, patients were grouped based on clinical characteristics to determine the correlation between DARS2 expression levels and clinical features. TCGA analysis results revealed significant differences in higher DARS2 expression across histological grade (P < 0.001), pathological stage (P < 0.05), T stage (P < 0.05), and M stage (P < 0.01) (Supplement Table 1). Furthermore, to further confirm the relationship between clinical features of tumors and DARS2 protein expression, we conducted clinical baseline data analysis based on the results of IHC analysis in 37 patient samples. The patients were divided into high and low DARS2 expression groups based on the median DARS2 expression. The analysis showed significant differences in higher DARS2 expression concerning N stage (P < 0.05), M stage (P < 0.05), and histological grade (P < 0.05) (Supplement Table 2). Notably, the results for M stage and histological grade from IHC analysis were consistent with the TCGA results.

These findings suggest that DARS2 expression is upregulated in BLCA at both the transcriptional and translational levels.

DARS2 as an Independent Prognostic Factor in BLCA

To determine the prognostic value of DARS2 in BLCA, we divided patients in the TCGA dataset into DARS2 low-expression and DARS2 high-expression groups based on the median DARS2 expression for survival analysis. High DARS2 expression was associated with poorer overall survival (OS) in BLCA (HR = 1.48, P < 0.01) (Fig. 2A).

To further validate the prognostic role of DARS2, we analyzed follow-up data from collected patients. Based on IHC analysis results, patients were categorized into high-expression and low-expression groups. The analysis revealed that patients in the high-expression group had worse OS (HR = 3.02, P < 0.01) (Fig. 2B).

Next, we performed univariate and multivariate Cox regression analyses on clinical data from TCGA to determine the correlation between overall survival in BLCA and multiple factors. Univariate analysis showed that six clinical features, including T3 stage (HR = 1.970, P < 0.001), T4 stage (HR = 2.987, P < 0.001), N stage (HR = 2.250, P < 0.001), M stage (HR = 3.112, P < 0.005), age > 70 (HR = 1.424, P < 0.05), and DARS2 expression (HR = 1.480, P < 0.005), were significantly associated with patient overall survival (Table 3; Fig. 2C). Multivariate analysis data revealed that DARS2 expression (HR = 1.953, P = 0.022) is an independent prognostic factor (Supplement Table 3).

Identification and Enrichment Analysis of Differentially Expressed Genes

Through gene differential analysis, a total of 466 genes were identified as differentially expressed genes (DEGs) between the high DARS2 group and the low DARS2 group (Fig. 3A). To identify signaling pathways regulated by abnormal DARS2 expression, we compared the DARS2 high-expression and low-expression groups using a signature gene set based on the TCGA dataset.

The analysis results indicated the top five upregulated pathways as follows: Formation of the cornified envelope; WP retinoblastoma gene in cancer; G2 mDNA damage checkpoint; Processing of DNA double-strand break ends; Meiosis (Fig. 3B)

Conversely, the top five downregulated pathways were identified as Initial triggering of complement; Complement cascade; Scavenging of heme from plasma; Creation of C4 and C2 activators; and CD22 mediated by regulation (Fig. 3C)

These findings provide insights into the potential pathways and processes influenced by DARS2 dysregulation in BLCA, offering valuable information for further mechanistic investigations and therapeutic targeting.

DARS2 Expression Correlates with Immune Infiltration and PD-L1 Expression

Our analysis using TIMER2 showed that DARS2 expression was negatively correlated with immune-active cells, including CD4⁺ T cells (R= -0.251, P < 0.001) and NK cells (R= -0.067, P < 0.001). Conversely, DARS2 expression was positively correlated with immunosuppressive cells, such as MDSCs (R = 0.372, P < 0.001) and macrophages (R = 0.196, P < 0.01). Interestingly, DARS2 expression was positively correlated with CD8⁺T cells (R = 0.203, P < 0.001) (Fig. 4A).

It is known that blocking immune checkpoint receptors such as PD-1/PD-L1 and CTLA-4 can alleviate CD8⁺T cell exhaustion and reactivate immune cell cytotoxicity to eliminate antigen-expressing tumor cells (Bibliography Farhood, et al. 2019). Therefore, we analyzed the correlation between DARS2 expression and the expression of PD-1, PD-L1 (CD274), and CTLA-4 using TIMER2. We found that DARS2 expression was positively correlated with PD-L1 expression (R = 0.202, P < 0.001), but showed no significant correlation with PD-1 and CTLA-4 (Fig. 4B). Additionally, protein immunoblotting from five pairs of bladder cancer and adjacent normal tissues showed increased expression of both PD-L1 and DARS2 in cancer tissues (Fig. 1F).

Therefore, DARS2 expression plays a significant role in immune infiltration and may serve as a potential biomarker for immune therapy response in BLCA patients.

Knockdown of DARS2 Inhibits Cell Proliferation, Migration, and Invasion, and downgraded PD-L1 Expression

The above results indicate that DARS2 is upregulated in BLCA, suggesting its crucial role in BLCA tumorigenesis. Therefore, we used siRNA to knock down DARS2 expression (Fig. 5A) to observe its biological effects on T24 and EJ cells. We assessed the impact of DARS2 on cell proliferation using CCK8 and EDU assays. Our results showed that knocking down DARS2 inhibited cell proliferation (Fig. 5B-C). Furthermore, we found that migration and invasion abilities were reduced in T24 and EJ cells with reduced DARS2 expression (Fig. 5D).

In addition, since our immune infiltration analysis revealed a positive correlation between DARS2 expression and PD-L1, we examined PD-L1 expression in cells after DARS2 knockdown. Interestingly, we observed a decrease in PD-L1 expression in both bladder cancer cell lines after knocking down DARS2 (Fig. 5E). However, the exact mechanisms underlying this decrease are currently unclear.

Finally, we conducted animal experiments and found that T24 cells with DARS2 knockdown formed smaller subcutaneous tumors in nude mice compared to the NC group (Fig. 5F). IHC images of tumor tissues showed a decrease in both DARS2 and the immune marker PD-L1 after DARS2 knockdown (Fig. 5G).

In summary, these results indicate that besides affecting cell proliferation, migration, and invasion, DARS2 can also participate in the BLCA process by influencing the cellular immune microenvironment.

BLCA remains one of the most common malignancies of the urinary tract and one of the most prevalent cancers globally (Bibliography Dobruch and Oszczudłowski 2021). Approximately 70–80% of patients are diagnosed with non-muscle-invasive BLCA initially, but up to 20% progress to high-grade, high-stage muscle-invasive BLCA, with a 5-year survival rate of less than 50% (Bibliography Kohada, et al. 2021,(Bibliography Wallerand, et al. 2011). Despite the significant advances in BLCA treatment, such as targeted therapies and immunotherapies, the survival rates for BLCA have not significantly improved (Bibliography Dobruch and Oszczudłowski 2021,(Bibliography Pond, et al. 2021). Therefore, it is crucial to explore novel biomarkers for BLCA.

DARS2 is responsible for producing the enzyme that ensures the correct translation of the genetic code by attaching amino acids to their corresponding tRNA molecules in the mitochondria (Bibliography Nie, et al. 2019,(Bibliography Jafarnejad, et al. 2018,(Bibliography Sacks, et al. 2018). Liu and colleagues discovered that DARS2 can serve as a prognostic marker for non-adenocarcinomas and promote the proliferation, invasion, and migration of lung adenocarcinoma cells while inhibiting cell apoptosis (Bibliography Jiang, et al. 2022,(Bibliography Zhang, et al. 2021,(Bibliography Liu, et al. 2023). It suggests that DARS2 may be proposed as a new biomarker to distinguish between multiple myeloma and lung adenocarcinoma (Bibliography Ucer and Kocaman 2022). It has been found that DARS2 is an oncogene in hepatocellular carcinoma and can promote the progression of the hepatocellular carcinoma cell cycle while inhibiting apoptosis in HCC cells (Bibliography Qin, et al. 2017,(Bibliography Jiang, et al. 2022). Although Wu's team discovered that DARS2 can predict overall survival in BLCA and serve as a predictive model for assessing clinical outcomes (Bibliography Wu, et al. 2021). However, there have been no reported studies on the biological role of DARS2 in BLCA.

Our research findings indicate that patients with high DARS2 expression have a poorer prognosis. In terms of biological function, interfering with DARS2 expression can inhibit the proliferation, invasion, and migration of BLCA. Furthermore, our immune infiltration analysis suggests that upregulated DARS2 expression may influence the immune microenvironment of the tumor. CD8⁺ T cells play a crucial role in immunotherapy and can induce cell apoptosis, and inhibit activation and proliferation when binding to PD1 and PD-L1 (Bibliography Allegrezza and Conejo-Garcia 2017). While CD4⁺ T cells play a crucial role in the activation of CD8⁺ T cells within adaptive immunity (Bibliography Zhang, et al. 2009,(Bibliography Baxevanis, et al. 2000), it's the CD4⁺ T helper cells, especially the type 1 T helper cells that secrete IFN-γ, which have been demonstrated to play pivotal roles in establishing cancer-specific responses (Bibliography Bonehill, et al. 2005). Upon encountering tumor cells, MDSCs originating from the bone marrow tend to differentiate into highly immunosuppressive PD-L1 macrophages (Bibliography Prima, et al. 2017). The secretion of abundant inflammatory and immunosuppressive factors is a key characteristic of MDSCs, mediating the immune escape of bladder cancer cells (Bibliography Wallerand, et al. 2011,(Bibliography Crispen and Kusmartsev 2020,(Bibliography Eruslanov, et al. 2012). Macrophages can foster tumor immune escape by creating an immunosuppressive microenvironment through the elimination of CD8⁺ T cells (Bibliography Saio, et al. 2001). In addition to its association with the tumor immune microenvironment, we also found that DARS2 is related to high PD-L1 expression, which has been validated. In summary, the elevated expression of DARS2 likely reshapes the immune microenvironment in BLCA to promote tumor progression. Furthermore, given its association with PD-L1, DARS2 may serve as a predictive indicator for immunotherapy response.

This study presents several key findings. Firstly, we identified and validated the upregulation of DARS2 expression in BLCA, which is associated with poor prognosis. Secondly, we established a connection between DARS2 expression and an immunosuppressive tumor microenvironment, including its correlation with PD-L1 expression. Lastly, knocking down DARS2 inhibited cell proliferation, invasion, and migration in BLCA, and simultaneously reduced PD-L1 expression. However, our study has limitations. On one hand, the sample size is relatively small, and the correlation between DARS2 and PD-L1 expression needs further validation in larger clinical cohorts. On the other hand, the mechanisms by which DARS2 regulates BLCA development and the immune microenvironment remain unclear. Further investigations into these mechanisms may pave the way for potential therapeutic strategies, such as combining DARS2 inhibitors with immune checkpoint inhibitors, to improve the prognosis of BLCA patients.

DARS2 is a potential prognostic biomarker and immunotherapy target in BLCA. DARS2 expression is related to PD-L1.

Author Contributions

HL-Y, Jq-N, and L-M designed and carried out the research study. Jq-N contributed to the analysis tools. L-M analyzed the data for the study. HL-Y wrote the manuscript. BF, Xq-L, and WD evaluated and revised the manuscript. All authors have read and approved the final manuscript.

Funding

This study was supported by the National Natural Science Foundation of P.R. China (Grant Nos 8 1560419, 81960512)

Availability of data and materials

The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors.

Conflict of interest

The authors declare no competing interests.

Authorship

The authors have no relevant financial or non-financial interests to disclose.

Ethics approval

Approved by the Ethics Committee of the First Affiliated Hospital of Nanchang University, Ethics license number: (2022)CDYFYYLK(11-031); CDYFY- IACUC-202308QR018.

Bray F., Ferlay J., Soerjomataram I. et al (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians 68(6):394-424. https://doi.org/10.3322/caac.21492
Kohada Y., Hayashi T., Hsi R. S. et al (2021) Recurrence- and progression-free survival in intermediate-risk non-muscle-invasive bladder cancer: the impact of conditional evaluation and subclassification. BJU international 127(4):473-485. https://doi.org/10.1111/bju.15209
Berdik Chris (2017) Unlocking bladder cancer. Nature 551(7679):S34-S35. https://doi.org/10.1038/551S34a
Lee S. W., Cho B. H., Park S. G. et al (2004) Aminoacyl-tRNA synthetase complexes: beyond translation. Journal of cell science 117(Pt 17):3725-3734. https://doi.org/10.1242/jcs.01342
Onuora S. (2023) Aminoacyl-tRNA synthetases function as alarmins in RA. Nature reviews. Rheumatology 19(9):538. https://doi.org/10.1038/s41584-023-01020-5
Yu Ya Chun, Han Jung Min and Kim Sunghoon (2021) Aminoacyl-tRNA synthetases and amino acid signaling. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1868(1):118889. https://doi.org/https://doi.org/10.1016/j.bbamcr.2020.118889
Nie A., Sun B., Fu Z. et al (2019) Roles of aminoacyl-tRNA synthetases in immune regulation and immune diseases. Cell death & disease 10(12):901. https://doi.org/10.1038/s41419-019-2145-5
Park S. G., Ewalt K. L. and Kim S. (2005) Functional expansion of aminoacyl-tRNA synthetases and their interacting factors: new perspectives on housekeepers. Trends in biochemical sciences 30(10):569-574. https://doi.org/10.1016/j.tibs.2005.08.004
Jafarnejad S. M., Kim S. H. and Sonenberg N. (2018) Aminoacylation of Proteins: New Targets for the Old ARSenal. Cell metabolism 27(1):1-3. https://doi.org/10.1016/j.cmet.2017.12.012
Köhler C., Heyer C., Hoffjan S. et al (2015) Early-onset leukoencephalopathy due to a homozygous missense mutation in the DARS2 gene. Molecular and cellular probes 29(5):319-322. https://doi.org/10.1016/j.mcp.2015.06.005
Martikainen M. H., Ellfolk U. and Majamaa K. (2013) Impaired information-processing speed and working memory in leukoencephalopathy with brainstem and spinal cord involvement and elevated lactate (LBSL) and DARS2 mutations: a report of three adult patients. Journal of neurology 260(8):2078-2083. https://doi.org/10.1007/s00415-013-6940-0
Lee E. Y., Kim S. and Kim M. H. (2018) Aminoacyl-tRNA synthetases, therapeutic targets for infectious diseases. Biochemical pharmacology 154(424-434. https://doi.org/10.1016/j.bcp.2018.06.009
Zhou Z., Sun B., Nie A. et al (2020) Roles of Aminoacyl-tRNA Synthetases in Cancer. Frontiers in cell and developmental biology 8(599765. https://doi.org/10.3389/fcell.2020.599765
Qin X., Li C., Guo T. et al (2017) Upregulation of DARS2 by HBV promotes hepatocarcinogenesis through the miR-30e-5p/MAPK/NFAT5 pathway. Journal of experimental & clinical cancer research : CR 36(1):148. https://doi.org/10.1186/s13046-017-0618-x
Jiang Y., You J., Wu C. et al (2022) High expression of DARS2 indicates poor prognosis in lung adenocarcinoma. Journal of clinical laboratory analysis 36(10):e24691. https://doi.org/10.1002/jcla.24691
Li T., Fu J., Zeng Z. et al (2020) TIMER2.0 for analysis of tumor-infiltrating immune cells. Nucleic acids research 48(W1):W509-w514. https://doi.org/10.1093/nar/gkaa407
Subramanian A., Tamayo P., Mootha V. K. et al (2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of America 102(43):15545-15550. https://doi.org/10.1073/pnas.0506580102
Farhood B., Najafi M. and Mortezaee K. (2019) CD8(+) cytotoxic T lymphocytes in cancer immunotherapy: A review. Journal of cellular physiology 234(6):8509-8521. https://doi.org/10.1002/jcp.27782
Dobruch J. and Oszczudłowski M. (2021) Bladder Cancer: Current Challenges and Future Directions. Medicina (Kaunas, Lithuania) 57(8):https://doi.org/10.3390/medicina57080749
Wallerand H., Bernhard J. C., Culine S. et al (2011) Targeted therapies in non-muscle-invasive bladder cancer according to the signaling pathways. Urologic oncology 29(1):4-11. https://doi.org/10.1016/j.urolonc.2009.07.025
Pond G. R., Agarwal A., Ornstein M. et al (2021) Clinical Outcomes of Platinum-ineligible Patients with Advanced Urothelial Carcinoma Treated With First-line PD1/L1 Inhibitors. Clinical genitourinary cancer 19(5):425-433. https://doi.org/10.1016/j.clgc.2021.04.008
Sacks D., Baxter B., Campbell B. C. V. et al (2018) Multisociety Consensus Quality Improvement Revised Consensus Statement for Endovascular Therapy of Acute Ischemic Stroke. International journal of stroke : official journal of the International Stroke Society 13(6):612-632. https://doi.org/10.1177/1747493018778713
Zhang X., Dong W., Zhang J. et al (2021) A Novel Mitochondrial-Related Nuclear Gene Signature Predicts Overall Survival of Lung Adenocarcinoma Patients. Frontiers in cell and developmental biology 9(740487. https://doi.org/10.3389/fcell.2021.740487
Liu X. S., Zeng J., Zhang Y. H. et al (2023) DARS2 is a prognostic biomarker and correlated with immune infiltrates and cuproptosis in lung adenocarcinoma. American journal of cancer research 13(3):818-834.
Ucer O. and Kocaman N. (2022) New candidates in the differential diagnosis of malignant mesothelioma from benign mesothelial hyperplasia and adenocarcinoma; DARS2 and suprabasin. Tissue & cell 79(101920. https://doi.org/10.1016/j.tice.2022.101920
Wu Y., Liu Z., Wei X. et al (2021) Identification of the Functions and Prognostic Values of RNA Binding Proteins in Bladder Cancer. Frontiers in genetics 12(574196. https://doi.org/10.3389/fgene.2021.574196
Allegrezza M. J. and Conejo-Garcia J. R. (2017) Targeted Therapy and Immunosuppression in the Tumor Microenvironment. Trends in cancer 3(1):19-27. https://doi.org/10.1016/j.trecan.2016.11.009
Zhang S., Zhang H. and Zhao J. (2009) The role of CD4 T cell help for CD8 CTL activation. Biochemical and biophysical research communications 384(4):405-408. https://doi.org/10.1016/j.bbrc.2009.04.134
Baxevanis C. N., Voutsas I. F., Tsitsilonis O. E. et al (2000) Tumor-specific CD4+ T lymphocytes from cancer patients are required for optimal induction of cytotoxic T cells against the autologous tumor. Journal of immunology (Baltimore, Md. : 1950) 164(7):3902-3912. https://doi.org/10.4049/jimmunol.164.7.3902
Bonehill A., Heirman C. and Thielemans K. (2005) Genetic approaches for the induction of a CD4+ T cell response in cancer immunotherapy. The journal of gene medicine 7(6):686-695. https://doi.org/10.1002/jgm.713
Prima V., Kaliberova L. N., Kaliberov S. et al (2017) COX2/mPGES1/PGE2 pathway regulates PD-L1 expression in tumor-associated macrophages and myeloid-derived suppressor cells. Proceedings of the National Academy of Sciences of the United States of America 114(5):1117-1122. https://doi.org/10.1073/pnas.1612920114
Crispen P. L. and Kusmartsev S. (2020) Mechanisms of immune evasion in bladder cancer. Cancer immunology, immunotherapy : CII 69(1):3-14. https://doi.org/10.1007/s00262-019-02443-4
Eruslanov E., Neuberger M., Daurkin I. et al (2012) Circulating and tumor-infiltrating myeloid cell subsets in patients with bladder cancer. International journal of cancer 130(5):1109-1119. https://doi.org/10.1002/ijc.26123
Saio M., Radoja S., Marino M. et al (2001) Tumor-infiltrating macrophages induce apoptosis in activated CD8(+) T cells by a mechanism requiring cell contact and mediated by both the cell-associated form of TNF and nitric oxide. Journal of immunology (Baltimore, Md. : 1950) 167(10):5583-5593. https://doi.org/10.4049/jimmunol.167.10.5583

No competing interests reported.

Supplement.docx
Supplementary Table 1. Baseline clinical data from TCGA. Supplementary Table 2. Baseline clinical data for 37 cases from immunohistochemistry. Supplementary Table 3. Correlation between overall survival and multivariable characteristics in TCGA BLCA patients.

Download PDF

Version 1

posted

You are reading this latest preprint version

Prognostic biomarker DARS2 correlated with immune infiltrates in bladder tumor

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusions

Figures

Introduction

Methods

Data Source

Survival Analysis

Immunoinfiltration and Gene Expression Correlation Analysis

Gene Set Enrichment Analysis (GSEA)

Cell Culture and Transfection

Primers and SiRNA Knockdown Fragments

Other Reagents

Ethical approval

Results

Upregulation of DARS2 Expression in BLCA

DARS2 as an Independent Prognostic Factor in BLCA

Identification and Enrichment Analysis of Differentially Expressed Genes

DARS2 Expression Correlates with Immune Infiltration and PD-L1 Expression

Knockdown of DARS2 Inhibits Cell Proliferation, Migration, and Invasion, and downgraded PD-L1 Expression

Discussion

Conclusions

Declarations

Author Contributions

Funding

Availability of data and materials

Conflict of interest

Authorship

Ethics approval

References

Additional Declarations

Supplementary Files

Status:

Version 1