Exploring the Therapeutic Mechanism of Jiangtang Sanhao Formula in Alleviating Insulin Resistance in Skeletal Muscle Cells: Involvement of AMPK/SIRT1/PGC-1α pathway？

doi:10.21203/rs.3.rs-3445076/v1

Download PDF

Research Article

Exploring the Therapeutic Mechanism of Jiangtang Sanhao Formula in Alleviating Insulin Resistance in Skeletal Muscle Cells: Involvement of AMPK/SIRT1/PGC-1α pathway？

https://doi.org/10.21203/rs.3.rs-3445076/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Insulin resistance (IR) in skeletal muscle is a well-documented pathologic characteristic in the development of type 2 diabetes mellitus (T2DM), with GLUT4 being a key protein involved in this process. Jiangtang Sanhao formula, (JTSHF), a proven effective prescription for treating T2DM in clinic, has been shown to have a beneficial effect on alleviation of skeletal muscle IR. However, the underlying mechanism still need to be explored. Herein, we investigated the potential benefits and mechanism of JTSHF-containing serum in combating IR induced by palmitate in C2C12 skeletal muscle cells. The results demonstrated that JTSHF-containing serum significantly enhanced glucose consumption and uptake in IR-C2C12 cells at noncytotoxic concentration. Moreover, the JTSHF-containing serum reduced the malondialdehyde level and increase superoxide dismutase activity. Further investigations showed the function of JTSHF-containing serum in up-regulating the expression of key factors involved in glucose transport and metabolism, including GLUT4, phosphorylated AMPKα, SIRT1, PGC-1α, PPARα, PPARγ, and UCP3, as well as GLUT4 translocation. Notably, these positive effects were substantially diminished when we used an AMPK inhibitor, named Compound C, suggesting that AMPK/SIRT1/PGC-1α signaling pathway may be involved in JTSHF’s ability to rescue palmitate-induced reductions in GLUT4 expression and translocation in IR-C2C12 cells. In summary, our study provides evidence that JTSHF may effectively regulate GLUT4 and counteracte IR in skeletal muscle cells, and it highlights the potential involvement of the AMPK/SIRT1/PGC-1α signaling pathway in mediating these beneficial effects.

Herbal medicine

Insulin resistance

Palmitate

Skeletal muscle cells

AMPK/SIRT1/PGC-1α signaling pathway

Type 2 diabetes mellitus (T2DM), accounting for approximately 95% of all diabetes cases, is a chronic metabolic disease influenced by both genetic and environmental factors (Zheng et al. 2018). Over the past few decades, research on pathogenesis of T2DM has yielded numerous promising findings. Insulin resistance (IR), a key factor in the development of T2DM, is widely acknowledged as a major pathological characteristic of T2DM (Lee et al. 2022). A common definition of IR refers to the weakened responsiveness of peripheral target tissues, including skeletal muscle, liver, and adipose tissue, to physiologic levels of insulin. This condition can lead to impaired uptake and utilization of glucose, potentially resulting in disorders of glycolipid metabolism (Lee et al. 2022). Among these tissues, skeletal muscle, constituting approximately 40% of human body weight, plays a critical role for maintaining systemic glucose homeostasis. It undertakes an estimated 85% of insulin-stimulated glucose uptake under normal conditions (Carnagarin et al. 2015; Merz and Thurmond 2020). Consequently, reversing skeletal muscle IR has attracted widespread spotlight in exploring approaches to slow down the progression of T2DM. One of the pivotal proteins involved in glucose transport in mammals is glucose transporter 4 (GLUT4), which is widely distributed in skeletal muscle, cardiac muscle, and adipose tissue. Increased expression and translocation of GLUT4 can facilitate clearance of glucose from the bloodstream circulation (Klip et al. 2019). A mounting body of evidence has reported on the essential role of GLUT4 in enhancing glucose metabolism and combating insulin resistance (Atkinson et al. 2013; Chang et al. 2023; Treadway et al. 1994). Hence, research on regulation of GLUT4 is deemed as a promising avenue for alleviating skeletal muscle IR and identifying potential anti-diabetic drugs.

When it comes to regulating the expression and translocation of GLUT4 in skeletal muscle, two primary mechanisms stand out: phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) and adenosine 5'-monophosphate-activated protein kinase (AMPK). The former keeps the typical insulin signaling pathway, which begins with the secreted insulin binding to insulin receptors (Farese et al. 2005). Then the activated PI3K triggers a series of signaling cascades, which ultimately facilitates the integration of GLUT4 onto the plasma membrane from intracellular vesicles (Zhou et al. 2017). On the other hand, AMPK, a vital serine (Ser)/threonine (Thr) kinase, validated by numerous studies to have a prominent impact on GLUT4 expression and translocation (Meng et al. 2020; Xiong et al. 2018). Unlike the insulin-dependent mechanism, AMPK operates independently of insulin and can circumvent defects in insulin signal transduction associated with IR (Dziewulska et al. 2010).

There is a well-documented correlation between the dysfunction of GLUT4 and energy homeostasis imbalance, which may be implicated in the development of IR and diverse metabolic diseases (Chen et al. 2013; Kalra et al. 2021; Wang et al. 2020). AMPK, as the main regulator of energy homeostasis in skeletal muscle, forms an energy sensing network with downstream targets, including silence information regulator T1 (SIRT1) and peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α). This network consequentially affects the expression of peroxisome proliferator-activated receptors (PPARα and PPARγ), which act as ligand-inducible nuclear transcription factors, as well as uncoupling protein 3 (UCP3). Through these proteins, AMPK coordinately regulates a wide range of metabolic processes, such as mediating mitochondrial biogenesis, increasing fatty acid oxidation, alleviating oxidative stress, enhancing glucose uptake and utilization, improving insulin sensitivity, and so on (Carling 2017; Herzig and Shaw 2018; Mutlur Krishnamoorthy and Carani Venkatraman 2017). Therefore, AMPK signaling pathway has gained significant attention as a pivotal therapeutic signal for activating GLUT4-mediated glucose uptake in skeletal muscle.

Undoubtedly, there exists a significant research challenge for formulating effective control strategies for combating IR in clinical medicine, biomedicine, and social healthcare, not only in China but also worldwide. Chinese herbal medicine, a major branch of alternative medicine, holds distinct advantages, such as notable effectiveness with lower side effects in the management of IR-related diseases (Leng et al. 2020; Yee et al. 2019). Jiangtang Sanhao formula (JTSHF), a traditional herbal formula comprised of Panax ginseng C. A. Meyer. (Araliaceae; Ginseng Radix et Rhizoma), Dioscorea oppositifolia L. (Dioscoreaceae; Dioscoreae Rhizoma), Coptis chinensis Franch. (Ranunculaceae; Coptidis Rhizoma), and others, has been shown to exhibit great hypoglycemic effects in patients with T2DM (Bai et al. 2020). Subsequently, our research team initially investigated the anti-diabetic properties and correlative mechanisms of JTSHF in mice with T2DM induced by high-fat diet and streptozotocin. The available results demonstrated that JTSHF had beneficial effects on relieving skeletal muscle IR and appeared to be an activator of AMPK, playing a pivotal role in regulating GLUT4 expression and translocation (Ye et al. 2022). As yet, it remains uncertain whether JTSHF has similar effects in vitro, and further exploration is required to uncover the underlying mechanism. Here, we aim to investigate the effect of JTSHF on IR in palmitate-treated C2C12 cells and delve deeper into its regulation of GLUT4 in an insulin-independent manner via AMPK/SIRT1/PGC-1α signal axis.

Reagents

Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS), horse serum (HS), and penicillin/streptomycin (antibiotics) were obtained from Gibco (Grand Island, NY, USA). Insulin, 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (2-NBDG), metformin, and AMPK inhibitor compound C were purchased from APExBIO (Houston, TX, USA). Palmitic acid and dimethyl sulfoxide (DMSO) were obtained from Sigma-Aldrich (Saint Louis, MO, USA).

The Cell Counting Kit-8 (CCK-8) assay kit were bought from Aoqing Biotechnology Ltd. (Beijing, China). Malondialdehyde (MDA), superoxide dismutase (SOD), and glucose assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

The RNA extraction kit, reverse transcription kit, and SYBR Green qPCR mix were sourced from Accurate Biology Co., Ltd. (Changsha, China). Polymerase chain reaction primers for AMPKα, SIRT1, PGC-1α, PPARα, PPARγ, GLUT4, and UCP3 were bought from Sangon Biotech Co., Ltd. (Shanghai, China).

Bovine serum albumin (BSA, fatty acid-free) and protein extraction kit were purchased from Beyotime Institute of Biotechnology (Shanghai, China). The BCA protein assay kit was bought from KeyGen Biotech Co., Ltd. (Nanjing, China). Primary antibodies to AMPKα (#66536-1-Ig), PGC-1α (#66369-1-Ig), PPARα (#15540-1-AP), PPARγ (#16643-1-AP), GLUT4 (#66846-1-Ig), UCP3 (#10750-1-AP), GAPDH (#60004-1-Ig), Lamin B1 (#66095-1-Ig), and Na, K-ATPase (#14418-1-AP), as well as second antibodies to CoraLite488-conjugated donkey anti-mouse (#SA00013-5), HRP-conjugated anti-mouse (#SA00001-1) and anti-rabbit (#SA00001-2) were sourced from Proteintech Group (Chicago, IL, USA). The antibody to Phospho-AMPKα (Thr172, #50081S) was provided by the Cell Signaling Technology (Boston, MA, USA).

Mounting medium with DAPI containing the anti-fluorescence quencher (#ab104139) and SIRT1 (#ab189494) primary antibody were purchased from Abcam (Cambridge, UK). The donkey serum was acquired from Jackson ImmunoResearch Laborotaries, INC. (West Grove, PA, USA).

Drugs

JTSHF granules, consisting of 10 herbals in the ration of 6:3:2:2:2:3:2:6:6:2: Panax ginseng C. A. Meyer. (Araliaceae; Ginseng Radix et Rhizoma), Atractylodes macrocephala Koidz. (Asteraceae; Atractylodis macrocephalae Rhizoma), Dioscorea oppositifolia L. (Dioscoreaceae; Dioscoreae Rhizoma), Bupleurum falcatum L. (Apiaceae; Bupleuri Radix), Smilax glabra Roxb. (Smilacaceae; Poria), Citrus aurantium L. (Rutaceae; Aurantii Immaturus Fructus), Rehmannia glutinosa (Gaertn.) DC. (Orobanchaceae; Rehmanniae Radix), Coptis chinensis Franch. (Ranunculaceae; Coptidis Rhizoma), Salvia miltiorrhiza Bunge (Lamiaceae; Salviae Miltiorrhizae Radix et Rhizoma), Epimedium sagittatum (Siebold & Zucc.) Maxim. (Berberidaceae; Epimedii Herba), was purchased from Yifang Pharmaceutical Co., Ltd. (Beijing, China). The suspension of this formula was prepared as described previously (Ye et al. 2022).

Preparation of JTSHF-containing serum

Twenty male Sprague-Dawley (SD) rats, weighted 280 ± 20 g, license SCXK (Beijing) 2019-0010, were purchased from Beijing Sibeifu Animal Technology Co., Ltd. (Beijing, China). The whole experimental procedures were approved by the Animal Care Committee of Beijing University of Chinese medicine (No. BUCM-4-2021032502-1076). The Rats were housed in a barrier environment. After one week of acclimation, all rats were randomly divided into two groups (n = 10 per group): the blank control group (rats received an equal volume of distilled water) and the JTSHF group (rats were administrated JTSHF granules 17.04 g/kg/d). Gavage was performed on rats in each group twice a day for 2.5 consecutive days. The dose of JTSHF was determined in compliance with the previous reports on drug-containing serum pharmacology (Wu et al. 2018; Zhang et al. 2015). 2 h after the last gavage administration, rats were anesthetized with ether and blood samples were collected from abdominal aorta in aseptic condition. The blood was centrifuged (3000 g at 4 ℃ for 15 min) to obtain serum, which was subsequently inactivated by heating at 56℃ for 30 min, followed by filtration sterilization using 0.2 µm filter membrane. The sterilized serum was stored at -80 ℃ for further experiments.

Cell culture and differentiation

Murine C2C12 skeletal muscle cells (#101MOU-PUMC000099; Peking Union Medical College Cell Resource Center, Beijing, China) were cultured in high-glucose DMEM complete media containing 10% (v/v) FBS and 1% (v/v) antibiotics in a humidified incubator at 37°C with 5% CO₂. When the cells reached 60–70% confluency, they were incubated in high-glucose DMEM supplemented with 2% (v/v) HS and 1% (v/v) antibiotics to induce differentiation. The cells were then allowed to fully differentiate into myotubules before proceeding with post-experiments.

Construction of IR-C2C12 cells model

The IR model in C2C12 cells was induced using palmitate. In brief, palmitate solution was prepared by dissolving palmitic acid powder in 0.1 M NaOH and complexing with 10% BSA. C2C12 cells were seeded and cultivated in 96-well plates at a density of 2 × 10⁶ cells/mL. After differentiation, the cells were subjected to an 8 h period of starvation in low-glucose 1% BSA-DMEM basal media, followed by an additional 16 h incubation without or with various concentrations of palmitate (0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, and 0.5 mM) that were diluted in high-glucose 1% BSA-DMEM basal media.

CCK-8 assay

The cell viability of C2C12 cells with or without palmitate treated was evaluated using CCK-8 kits according to the operating manuals, and the absorbance of each well was measured at 450 nm using a multimode microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). Cell viability (%) = (OD _Sample-OD _Blank) / (OD _Control-OD _Blank) × 100%.

Glucose uptake and consumption assay

Glucose concentration in the culture media of C2C12 cells was measured using a glucose assay kit, and the absorbance of each well was recorded at 505 nm. Glucose concentration (mmol/L) = (OD _Sample-OD _Blank) / (OD _Standard-OD _Blank) × standard concentration, and the glucose consumption was calculated by subtracting the glucose concentration in wells containing cells from that in blank wells (containing media only).

The glucose uptake in C2C12 cells was performed using 2-NBDG, a fluorescent indicator to directly trace the glucose uptake. Cells were first synchronized in glucose-free DMEM basal media for 2 h, and then incubated with 100 nM insulin and 100 µM 2-NBDG for 30 min in succession. After washing out free 2-NBDG from the wells, the fluorescent intensity was detected at excitation 465 nm and emission 540 nm. Cell glucose uptake = (FI _Sample-FI _Blank) / (FI _Control-FI _Blank).

Measurement of oxidative stress parameters

The cells were seeded into 6-well plates and homogenized in pre-cooled PBS, then the intracellular levels of MDA and SOD were assessed using commercial assay kits per the manufacturer’s instructions.

Immunofluorescence staining

C2C12 cells were inoculated into 6-well plates with prepared cell slides, then rinsed in PBS, fixed with 4% paraformaldehyde for 20 min, and blocked with 5% donkey serum for 1 h. After overnight incubation with the primary antibody of GLUT4 (1:500) at 4 ℃, the cell slides were exposed to fluorescent-labeled secondary antibody, then sealed in a mounting medium containing DAPI and the anti-fluorescence quencher. Finally, fluorescence images were captured using a confocal microscope (Olympus Corporation, Tokyo, Japan), and the fluorescence intensity was analyzed using Image J software.

Real-Time PCR (RT-PCR) analysis

Total RNA was extracted from C2C12 cells with Trizol reagent, thereafter the RNA concentration was quantified using an Implen nanophotometer® (IMPLEN, Munich, German). cDNA was synthesized using a reverse transcription kit, followed by amplification on RT-PCR instrument (Bio-Rad, Hercules, CA, USA) according to the subsequent reaction protocols: pre-denaturation at 95℃ for 10 min, then followed with 40 amplification cycles at 95℃ for 15s and 60℃ for 45s. The mRNA levels of target genes, including AMPKα, SIRT1, PGC-1α, PPARα, PPARγ, UCP3, and GLUT4 were normalized against β-actin, and the relative expression was calculated by the 2^−ΔΔCt method. The sequences of primers used for RT-PCR were available in Table 1.

Table 1

Sequences of the target gene primers
Objective gene	Forward primer sequence (5’-3’)	Reversed primer sequences (5’-3’)
AMPKα	GTCCTGCTTGATGCACACAT	GACTTCTGGTGCGGCATAAT
SIRT1	AGTTCCAGCCGTCTCTGTGT	GAACGGCTTCCTCAGGTTCTT
PGC-1α	CCCTGCCATTGTTAAGACC	TGCTGCTGTTCCTGTTTTC
PPARα	GCGTACGGCAATGGCTTTAT	GAACGGCTTCCTCAGGTTCTT
PPARγ	GCCAAGGTGCTCCAGAAGATGAC	GTGAAGGCTCATGTCTGTCTCTGTC
UCP3	GAGTCTCACCTGTTTACTGACA	CGTTCATGTATCGGGTCTTTAC
GLUT4	CTTAGGGCCAGATGAGAATGAC	ACAGGGAAGAGAGGGCTAAA
β-actin	GTGCTATGTTGCTCTAGACTTCG	ATGCCACAGGATTCCATACC

Western Blot Analysis

Protein samples were extracted from C2C12 cells using a protein extraction kit. Subsequently, the protein concentration was determined by a BCA protein assay kit. Then the established protocols were followed (Oh et al. 2021): electrophoresis, membrane transfer, blocking, and overnight incubation with primary antibodies (AMPKα, PPARα at 1:500; p-AMPKα, SIRT1, PGC-1α, PPARγ, GLUT4 at 1:1000; and UCP3 at 1:2000) at 4 ℃. Afterward, the membranes were incubated with appropriate secondary antibodies such as GAPDH (1:40000, serving as an internal control for total protein), Lamin B1 (1:20000, serving as an internal control for nucleoprotein), and Na, K-ATPase (1:5000, serving as an internal control for membrane protein). The objective bands were exposed to chemiluminescent reagent and photographed using a gel imager (Clinx, Shanghai, China). The grayscale value of the bands was quantified and analyzed using Image J software.

Statistical Analysis

All data in this study were expressed as mean ± standard error of mean (SEM). Significance among groups was performed using one-way analysis of variance (ANOVA) with Dunnett’s test for multiple comparisons via GraphPad Prism 8 software. A p-value less than 0.05 was considered statistically significant.

JTSHF-containing serum rescued glucose consumption and uptake in palmitate-induced IR-C2C12 cells

To clarify the potential impact of JTSHF-containing serum on glucose consumption and uptake under IR conditions, we employed a well-established cellular model of IR induced by palmitate. As shown in Fig. 1a, cells viability treated with palmitate higher than 0.35 mM were obviously decreased as compared with untreated cells (p < 0.05). Conversely, palmitate concentrations below 0.3 mM showed no discernible cytotoxic effect on C2C12 cells (p > 0.05). Furthermore, it revealed that palmitate concentrations ranging from 0.1 to 0.5 mM induced a significant decrease in the glucose consumption and uptake in C2C12 cells (Fig. 1b, c, p < 0.05). Notably, a concentration of 0.3 mM palmitate exhibited optimal inhibitory effect without causing cytotoxicity, rendering it the chosen modeling concentration for follow-up experiments.

To identify the optimal concentration of JTSHF-containing serum, cells pre-treated with 0.3 mM palmitate were incubated for an additional 24 h with either blank serum or series concentration gradients of JTSHF-containing serum (1%, 3%, 5%, and 10%) which were diluted in high-glucose DMEM basal media. As shown in Fig. 1d, treatment of cells with various concentrations of JTSHF-containing serum did not remarkably impact viability (p > 0.05). Nevertheless, the glucose consumption exhibited a gradual increase of 6.20%, 8.81%, 10.93%, and 24.03%, respectively, in comparison with the untreated IR-C2C12 cells, indicating a dose-dependent manner rescue effect of JTSHF-containing serum on palmitate-induced reduction in glucose consumption. Notably, 10% JTSHF-containing serum demonstrated the most significant enhancement of glucose consumption (Fig. 1e, p < 0.05). Consistent with the results of glucose consumption, a substantial increase in glucose uptake was observed in the presence of 10% JTSHF-containing serum compared with the untreated IR-C2C12 cells (Fig. 1f, p < 0.05). Additionally, metformin, a long-standing first-line drug for managing IR and T2DM, served as a positive control in this study and displayed similar effect to 10% JTSHF-containing serum in terms of glucose consumption and uptake (p < 0.05). Accordingly, these results underscored the notable potential of 10% JTSHF-containing serum to increase glucose consumption and uptake in IR-C2C12 cells.

JTSHF-containing serum attenuated palmitate-induced oxidative stress in IR-C2C12 cells

Oxidative stress, characterized by an imbalance between the production of free radicals and the scavenging capacity of antioxidants, has long been regarded as a pivotal factor involved in the onset and progression of IR (Yaribeygi et al. 2019; Ziolkowska et al. 2021). To this end, the levels of MDA and SOD, representative biomarkers of oxidative stress, were used to evaluate the antioxidant properties of JTSHF-containing serum. MDA is an end-product of lipid peroxidation typically used to appraise the degree of lipid peroxidation within tissues and cells (Ozbay et al. 2021). As illustrated in Fig. 2a, exposure of C2C12 cells to palmitate for 16 h resulted in a prominent increase of the MDA level with respect to unexposed normal cells (p < 0.05), but treatment with metformin or JTSHF-containing serum attenuated this increase (p < 0.05). Conversely, the activity of SOD, an antioxidant enzyme that counteracts to oxidative stress by converting superoxide free radicals into hydrogen peroxide(Sakamoto and Imai 2017), was obviously higher in the presence of metformin or JTSHF-containing serum than that of the untreated IR-C2C12 cells (Fig. 2b, p < 0.05). These data demonstrated the capacity of JTSHF-containing serum to alleviate the palmitate-induced oxidative stress.

Compound C (CC) abolished the enhanced effect of JTSHF-containing serum on glucose consumption and uptake

Accumulating studies have confirmed AMPK’s pivotal role in promoting glucose metabolism, making it a key therapeutics target for preventing and treating T2DM along with other metabolic disorders (Choi et al. 2016; Meng et al. 2020). In this study, the AMPK-specific inhibitor CC at 10 µM was employed to investigate the impact of AMPK on glucose consumption and uptake in C2C12 cells exposed to JTSHF-containing serum. As anticipated, CC inhibited the cells’ capacity to uptake and utilize glucose. Additionally, the data revealed that the addition of CC markedly reversed the previously observed increase in glucose consumption and uptake facilitated by JTSHF-containing serum (Fig. 3b, c, p < 0.05) without influenced the viability of IR-C2C12 cells (Fig. 3a, p > 0.05).

JTSHF-containing serum activated AMPK/SIRT1/PGC-1α signaling pathway in IR-C2C12 cells

To delve into the underlying molecular mechanism by which JTSHF-containing serum attenuated palmitate-induced IR, we conducted separate analyses using RT-PCR and western blotting to detect the mRNAs and proteins levels involved in AMPK/SIRT1/PGC-1α signaling pathway. This pathway plays an indispensable role in maintaining energy homeostasis and improving insulin sensibility. Compared with the normal cells, C2C12 cells after being exposed to palmitate displayed decreased transcription levels of genes including AMPKα, SIRT1, PGC-1α, PPARα, PPARγ, and UCP3. However, these reductions were revered upon the intervention with either metformin or JTSHF-containing serum (Fig. 4a-f, p < 0.05).

The western blotting results (Fig. 4g-p) exhibited that palmitate significantly inhibited the phosphorylation of AMPKα at Thr172 in C2C12 cells, whereas treatment with metformin or JTSHF-containing serum provoked an increase in the phosphorylation at this site. This increase was observed along with corresponding activation of AMPK downstream-related proteins, including SIRT1, PGC-1α, PPARα, PPARγ, and UCP3, which were down-regulated by palmitate (p < 0.05). Moreover, we also examined the levels of PPARγ and PPARα nuclear protein samples of cells since these two proteins act as ligand-activated nuclear transcription factors which regulate diverse biological activities through nuclear translocation. As anticipated, the decreased expression of nuclear proteins PPARα and PPARγ caused by palmitate was restored by the intervention of either metformin or JTSHF-containing serum (p < 0.05).

To confirm whether the beneficial effects JTSHF-containing serum on IR were attributed to AMPK activation, we introduced the AMPK inhibitor CC to the IR-C2C12 cells. The results revealed that co-incubation with CC abolished the up-regulation of factors within AMPK/SIRT1/PGC-1α signaling pathway triggered by JTSHF-containing serum both at the gene and protein levels (p < 0.05).

JTSHF-containing serum facilitated the expression and translocation of GLUT4 in IR-C2C12 cells

GLUT4 is the main carrier protein for glucose uptake and utilization in skeletal muscle tissues, and plays an important pathophysiological role in the development IR due to its impaired expression and translocation. This defect makes GLUT4 a potential therapeutic target to counter against T2DM (Herman et al. 2022; Klip et al. 2019). To probe the modulatory impact of JTSHF-containing serum on GLUT4 challenged by palmitate, we assessed the expression and translocation of GLUT4 in IR-C2C12 cells.

The results from RT-PCR analysis indicated that, in comparison with the normal C2C12 cells, a decreased mRNA expression of GLUT4 was detected in the palmitate-induced IR-C2C12 cells (Fig. 5a, p < 0.05), while treatment with metformin or JTSHF-containing serum caused a remarkable elevation (p < 0.05). This increase in mRNA expression was paralleled by a robust up-regulation of GLUT4 protein level (Fig. 5b, p < 0.05). Similarly, the immunofluorescence assay revealed a consistent outcome. The fluorescence intensity of GLUT4 after intervening with metformin or JTSHF-containing serum was upregulated by 69.68% and 72.85%, respectively, in comparison with C2C12 cells exposed to palmitate alone. This collectively indicated a potential effect of JTSHF-containing serum on eliminating the inhibitory action of palmitate on GLUT4 expression (Fig. 5d, e, p < 0.05).

Furthermore, JTSHF-containing serum effectively counteracted the decline in GLUT4 translocation. This was validated by the restoration of GLUT4 expression on the plasma membrane of C2C12 cells exposed to palmitate (Fig. 5c, p < 0.05). Given AMPK’s role as a pivotal upstream stimulatory factor in regulating GLUT4 expression and translocation (Chen et al. 2021; Xiong et al. 2018), the specific inhibitor of AMPK, CC, was used to explore the influence of JTSHF-containing serum on AMPK-GLUT4 signal axis. The results showed that introducing CC to IR-C2C12 cells blocked the upregulation of GLUT4 expression and translocation induced by JTSHF-containing serum, approaching to the level seen in the untreated IR-C2C12 cells. These results, along with the stimulatory effect of JTSHF-containing serum on glucose utilization, indicated that the promoting effect of JTSHF-containing serum on GLUT4 expression and translocation may be closely mediated by activation of AMPK/SIRT1/PGC-1α pathway.

JTSHF has demonstrated the encouraging results in ameliorating the clinical symptoms of patients with T2DM through multicenter clinical trials (Gao et al.). In animal studies, JTSHF has shown the ability to efficiently improve glucose tolerance, lower serum lipid levels, and relieve hyperinsulinemia in obese mice. These effects appear to be closely concerned with the up-regulation of GLUT4 proteins (Bai et al. 2019). Given that skeletal muscle plays a dominant role in glucose disposal, accounting for over 85% of insulin stimulated glucose uptake, any impairment in this tissue significantly contributes to the pathogenesis of T2DM. Building upon the encouraging findings from animal studies (Ye et al. 2022), this research was projected to further delve deeper into the effect and mechanisms of JTSHF on IR reversal through in vitro experiments. The C2C12 murine skeletal muscle cell line, offers a useful model, especially for researching into glycolipid metabolism, oxidative stress, and IR. Therefore, this cell line is frequently utilized for exploiting anti-diabetic drugs and insulin sensitizers.

It's widely believed that the chronically elevated plasma free fatty acids (FFAs) pose a significant risk to skeletal muscle IR. Under physiological conditions, FFAs are distributed in non-adipose tissues including skeletal muscle, liver, and heart for energy generation via β-oxidation. However, in excess, FFAs induce free radical generation, mitochondrial dysfunction, and abnormal accumulation of lipid metabolites, ultimately leading to IR (A et al. 2019; Eckardt et al. 2011). Palmitate, a component of FFAs closely related to metabolic disorders, has been found to interfere with insulin signal transduction, diminish insulin sensitivity, and hinder glucose uptake. Thus, palmitate usually serves as a means to establish IR model in vitro (Den Hartogh et al. 2022). In this study, exposing C2C12 skeletal muscle cells to palmitate induced a reduction in cell viability, glucose consumption and uptake in a dose-dependent manner. This essentially complies with the Randle cycle theory, which posits a competition between glucose and FFAs as energy substrates, and this competition results in decreased glucose utilization in skeletal muscle due to elevated levels of FFAs (Hue and Taegtmeyer 2009). Among the concentrations tested, 0.3 mM palmitate was selected for modeling due to its optimal hypoglycemic effects without cytotoxicity in the current study. Further, after incubated with 10% JTSHF-containing serum, IR-C2C12 cells exhibited a prominent enhancement of glucose consumption and uptake coupled with negligible cytotoxicity. This outcome was consistent with JTSHF’s hypoglycemic effect in vivo (Ye et al. 2022).

Previous studies have illuminated that palmitate could induce cellular oxidative stress (Yang et al. 2019), and elevated FFAs are linked to an over-production of free radicals, which causes mitochondrial dysfunction, further intensifying oxidative stress (Ly et al. 2017). SOD and MDA are identified oxidative stress biomarkers of antioxidant defense system and lipid peroxidation, respectively. Our findings indicated that JTSHF-containing serum mitigated oxidative stress in palmitate-induced IR-C2C12 cells. Specifically, theincrease in SOD activity in the JTSHF-containing serum-treated cells might be a defense response against the amplified lipid peroxidation represented by MDA. Another study showed that oxidative stress could impair normal glucose homeostasis and raise the risk of IR and T2DM (Yaribeygi et al. 2020). Accordingly, alteration of JTSHF-containing serum’s impact on the glucose utilization may probably relate to its ability to alleviate oxidative stress.

Considering previous findings, a question arises about how JTSHF-containing serum ameliorates the palmitate-induced IR. GLUT4-mediated glucose transport is the rate-limiting step in glucose uptake, glycogen synthesis, glycolysis and other metabolic processes in skeletal muscle (Klip et al. 2019). Our data showed that JTSHF-containing serum enhanced the expression and translocation of GLUT4 in palmitate-exposed cells, which aligned with the beneficial effect of this formula on glucose consumption and uptake. Next, the signaling pathways underlying these effects were pinpointed, and the results revealed that JTSHF-containing serum appeared to rescue the phosphorylated levels of AMPKα at Thr172, along with the up-regulating signaling molecules associated with glucose utilization and metabolism in skeletal muscle, including SIRT1, PGC-1α, PPARα, PPARγ, and UCP3.

AMPK serves as an energy sensor that is activated by phosphorylation of Thr172 in response to various metabolic stresses such as exercise, aging, obesity, and calorie restriction, thereby controlling energy homeostasis through coordinating anabolism and catabolism (Herzig and Shaw 2018; Yan et al. 2018). In skeletal muscle, AMPK boosts glucose utilization and insulin sensitivity via promoting expression and translocation of GLUT4 (Meng et al. 2020). Moreover, AMPK directly phosphorylates PGC-1α at Thr177 and Ser538, or indirectly activates PGC-1α through SIRT1-mediated deacetylation to positively modulate energy metabolism balance in skeletal muscle (Hsu et al. 2022). Convincing evidence indicates that PGC-1α can promote the GLUT4 expression to increase glucose uptake and regulate mitochondrial biosynthesis and oxidative metabolism coordinating with a set of nuclear transcription factors involved such as PPARα, PPARγ, and so on, to keep a balance between energy supply and demand in skeletal muscle (Leick et al. 2010; Miller et al. 2019). Notably, mitochondrial dysfunction, both contributions and results from oxidative stress, is closely involved in the development of skeletal muscle IR (Banik and Ghosh 2021). As a core regulatory factor in mitochondrial function, PGC-1α has been pointed out to restore oxidative stress damage through free radical clearance, antioxidant enzymes, and mitochondrial function maintenance (Rius-Pérez et al. 2020). Thus, the antioxidant effect of JTSHF-containing serum in palmitate-induced IR-C2C12 cells may relate to PGC-1α activation.

In our study, it is plausible that JTSHF-containing serum’s protective effect on GLUT4 expression and translocation in palmitate-induced IR-C2C12 cells is likely modulated via AMPK/SIRT1/PGC-1α pathway. To test this hypothesis, we employed the AMPK inhibitor CC. As an inhibitor of AMPK, CC effectively halts AMPK-induced biological functions, and is widely used in vitro to testify the action of AMPK in various physiological processes and to screen relevant activators (Dasgupta and Seibel 2018). As we expected, using the AMPK inhibitor CC could abolish JTSHF-containing serum mediated the increase of GLUT4 expression and translocation, as well as glucose consumption and uptake, in palmitate-induced IR-C2C12 cells. Therefore, we confirmed that JTSHF-containing serum alleviated palmitate-induced reduction in GLUT4 expression and translocation through AMPK/SIRT1/PGC-1α pathway.

In conclusion, our study not only offers insights into the effect and mechanism of JTSHF in alleviating IR in vitro, but also further supports JTSHF’s potential as a Chinese herbal medicine to improve IR in T2DM. As predicted, our results demonstrated that JTSHF could promote glucose consumption and uptake, reduce oxidative stress, and activate GLUT4 expression and translocation in IR-C2C12 cells, and its efficacy appears to link with the activation of the AMPK/SIRT1/PGC-1α pathway, reinforcing our earlier in vivo observations (Fig. 6).

AKT: Protein kinase B; AMPK: Adenosine 5'-monophosphate-activated protein kinase; BSA: Bovine serum albumin; CC: Compound C; CCK-8: Cell Counting Kit-8; DMEM: Dulbecco’s Modified Eagle Medium; DMSO: Dimethyl sulfoxide; FBS: Fetal bovine serum; FFAs: Free fatty acids; GLUT4：Glucose transporter 4; HS: Horse serum; IR: Insulin resistance; JTSHF: Jiangtang Sanhao formula; MDA: Malondialdehyde; 2-NBDG: 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose; PGC-1α: Peroxisome proliferator-activated receptor γ coactivator-1α; PI3K: Phosphatidylinositol 3-kinase; PPARα: Peroxisome proliferator-activated receptors α; PPARγ: Peroxisome proliferator activated receptor γ; RT-PCR: Real-Time PCR; Ser: Serine; SIRT1: Silence information regulator T1; SOD: Superoxide dismutase;T2DM: Type 2 diabetes mellitus; Thr: Threonine; UCP3: Uncoupling protein 3.

Acknowledgments Not applicable.

Author Contributions Zimengwei Ye was mainly responsible for indexes test and original draft writing. Yi Zhao, Bingrui Xu, and Hanfen Shi analyzed and organized the data. Runqi Li was in charge of literature summary. Xin Fang, Fangfang Mo, and Dongwei Zhang supervised the project administration. Dandan Zhao and Sihua Gao majored in the project design, reviewing, and editing. All authors listed have made a substantial contribution to the work and approved the final manuscript.

Funding This work was supported by the National Natural Science Foundation of China (NSFC, 82174329); Jiebang Guashuai Project of Beijing University of Chinese Medicine (2023-JYB-JBZD-0100); School-sponsored Development Fund for Scientific Research at Beijing University of Chinese Medicine (2021-ZXFZJJ-045, 2020-ZXFZJJ-061).

Data Availability The original data presented in the study will be available either in the article or in the supplementary materials, further inquiries can be directed to the corresponding authors.

Code availability Not applicable.

Ethics approval The animal study was reviewed and approved by the Animal Care Committee of Beijing University of Chinese medicine (No. BUCM-4-2021032502-1076).

Consent to participate Not applicable.

Consent for publication All authors agree to publish the manuscript.

Competing interests The authors declare that there are no conflicts of interest regarding the conduction of this research.

A ISS, C AB, A JS. Changes in Plasma Free Fatty Acids Associated with Type-2 Diabetes. Nutrients. 2019;11(9). https://doi.org/10.3390/nu11092022.
Atkinson BJ, Griesel BA, King CD, Josey MA, Olson AL. Moderate GLUT4 overexpression improves insulin sensitivity and fasting triglyceridemia in high-fat diet-fed transgenic mice. Diabetes. 2013;62(7):2249–2258. https://doi.org/10.2337/db12-1146.
Bai Y, Bao X, Zhao D, Zhu R, Li R, Tian Y, Mo F, Gao S. Mechanism study of Jiang Tang San Hao Formula improving glucolipid metabolism in diet-induced obese mice. China Journal of Traditional Chinese Medicine and Pharmacy. 2020;35(5):2253–2258.
Bai Y, Zhao D, Zhu R, Liu C, Liu H, Qin Y, Gao S. Effects of jiangtangsanhao formula on glucolipid metabolism and PI3K/AKT signaling pathway in obese mice. Prog. Mod. Biomed. 2019;19(16):3039–3043. https://doi.org/10.13241/j.cnki.pmb.2019.16.007
Banik S, Ghosh A. The association of oxidative stress biomarkers with type 2 diabetes mellitus: A systematic review and meta-analysis. Health Sci Rep. 2021;4(4):e389. https://doi.org/10.1002/hsr2.389.
Carling D. AMPK signalling in health and disease. Curr Opin Cell Biol. 2017;4531-37. https://doi.org/10.1016/j.ceb.2017.01.005.
Carnagarin R, Dharmarajan AM, Dass CR. Molecular aspects of glucose homeostasis in skeletal muscle–A focus on the molecular mechanisms of insulin resistance. Mol Cell Endocrinol. 2015;41752–62. https://doi.org/10.1016/j.mce.2015.09.004.
Chang YC, Chan MH, Yang YF, Li CH, Hsiao M. Glucose transporter 4: Insulin response mastermind, glycolysis catalyst and treatment direction for cancer progression. Cancer Lett. 2023;563216179. https://doi.org/10.1016/j.canlet.2023.216179.
Chen LN, Lyu J, Yang XF, Ji WJ, Yuan BX, Chen MX, Ma X, Wang B. Liraglutide ameliorates glycometabolism and insulin resistance through the upregulation of GLUT4 in diabetic KKAy mice. Int J Mol Med. 2013;32(4):892–900. https://doi.org/10.3892/ijmm.2013.1453.
Chen M, Huang N, Liu J, Huang J, Shi J, Jin F. AMPK: A bridge between diabetes mellitus and Alzheimer's disease. Behav Brain Res. 2021;400113043. https://doi.org/10.1016/j.bbr.2020.113043.
Choi KH, Lee HA, Park MH, Han JS. Mulberry (Morus alba L.) Fruit Extract Containing Anthocyanins Improves Glycemic Control and Insulin Sensitivity via Activation of AMP-Activated Protein Kinase in Diabetic C57BL/Ksj-db/db Mice. J Med Food. 2016;19(8):737–745. https://doi.org/10.1089/jmf.2016.3665.
Dasgupta B, Seibel W. Compound C/Dorsomorphin: Its Use and Misuse as an AMPK Inhibitor. Methods Mol Biol. 2018;1732195-202. https://doi.org/10.1007/978-1-4939-7598-3_12.
Den Hartogh DJ, Vlavcheski F, Giacca A, MacPherson REK, Tsiani E. Carnosic Acid Attenuates the Free Fatty Acid-Induced Insulin Resistance in Muscle Cells and Adipocytes. Cells. 2022;11(1). https://doi.org/10.3390/cells11010167.
Dziewulska A, Dobrzyń P, Dobrzyń A. [The role of AMP-activated protein kinase in regulation of skeletal muscle metabolism]. Postepy Hig Med Dosw (Online). 2010;64513–521.
Eckardt K, Taube A, Eckel J. Obesity-associated insulin resistance in skeletal muscle: role of lipid accumulation and physical inactivity. Rev Endocr Metab Disord. 2011;12(3):163–172. https://doi.org/10.1007/s11154-011-9168-2.
Farese RV, Sajan MP, Standaert ML. Insulin-sensitive protein kinases (atypical protein kinase C and protein kinase B/Akt): actions and defects in obesity and type II diabetes. Exp Biol Med (Maywood). 2005;230(9):593–605. https://doi.org/10.1177/153537020523000901.
Gao S, Gong Y, Ni Q, Luo Z, Zhao J, Gao Y, Yang X, Feng X. Clinical study on treatment of type 2 diabetes from aspects of liver, spleen and kidney. China J. Traditional Chin. Med. Pharm. 24(8):18–21.
Herman R, Kravos NA, Jensterle M, Janež A, Dolžan V. Metformin and Insulin Resistance: A Review of the Underlying Mechanisms behind Changes in GLUT4-Mediated Glucose Transport. Int J Mol Sci. 2022;23(3). https://doi.org/10.3390/ijms23031264.
Herzig S, Shaw RJ. AMPK: guardian of metabolism and mitochondrial homeostasis. Nat Rev Mol Cell Biol. 2018;19(2):121–135. https://doi.org/10.1038/nrm.2017.95.
Hsu CC, Peng D, Cai Z, Lin HK. AMPK signaling and its targeting in cancer progression and treatment. Semin Cancer Biol. 2022;8552-68. https://doi.org/10.1016/j.semcancer.2021.04.006.
Hue L, Taegtmeyer H. The Randle cycle revisited: a new head for an old hat. Am J Physiol Endocrinol Metab. 2009;297(3):E578-591. https://doi.org/10.1152/ajpendo.00093.2009.
Kalra S, Unnikrishnan AG, Baruah MP, Sahay R, Bantwal G. Metabolic and Energy Imbalance in Dysglycemia-Based Chronic Disease. Diabetes Metab Syndr Obes. 2021;14165–184. https://doi.org/10.2147/dmso.S286888.
Klip A, McGraw TE, James DE. Thirty sweet years of GLUT4. J Biol Chem. 2019;294(30):11369–11381. https://doi.org/10.1074/jbc.REV119.008351.
Lee SH, Park SY, Choi CS. Insulin Resistance: From Mechanisms to Therapeutic Strategies. Diabetes Metab J. 2022;46(1):15–37. https://doi.org/10.4093/dmj.2021.0280.
Leick L, Fentz J, Biensø RS, Knudsen JG, Jeppesen J, Kiens B, Wojtaszewski JF, Pilegaard H. PGC-1{alpha} is required for AICAR-induced expression of GLUT4 and mitochondrial proteins in mouse skeletal muscle. Am J Physiol Endocrinol Metab. 2010;299(3):E456-465. https://doi.org/10.1152/ajpendo.00648.2009.
Leng Y, Zhou X, Xie Z, Hu Z, Gao H, Liu X, Xie H, Fu X, Xie C. Efficacy and safety of Chinese herbal medicine on blood glucose fluctuations in patients with type 2 diabetes mellitus: A protocol of systematic review and meta-analysis. Medicine (Baltimore). 2020;99(34):e21904. https://doi.org/10.1097/md.0000000000021904.
Ly LD, Xu S, Choi SK, Ha CM, Thoudam T, Cha SK, Wiederkehr A, Wollheim CB, Lee IK, Park KS. Oxidative stress and calcium dysregulation by palmitate in type 2 diabetes. Exp Mol Med. 2017;49(2):e291. https://doi.org/10.1038/emm.2016.157.
Meng Q, Qi X, Fu Y, Chen Q, Cheng P, Yu X, Sun X, Wu J, Li W, Zhang Q, Li Y, Wang A, Bian H. Flavonoids extracted from mulberry (Morus alba L.) leaf improve skeletal muscle mitochondrial function by activating AMPK in type 2 diabetes. J Ethnopharmacol. 2020;248112326. https://doi.org/10.1016/j.jep.2019.112326.
Merz KE, Thurmond DC. Role of Skeletal Muscle in Insulin Resistance and Glucose Uptake. Compr Physiol. 2020;10(3):785–809. https://doi.org/10.1002/cphy.c190029.
Miller KN, Clark JP, Anderson RM. Mitochondrial regulator PGC-1a-Modulating the modulator. Curr Opin Endocr Metab Res. 2019;537 – 44. https://doi.org/10.1016/j.coemr.2019.02.002.
Mutlur Krishnamoorthy R, Carani Venkatraman A. Polyphenols activate energy sensing network in insulin resistant models. Chem Biol Interact. 2017;27595-107. https://doi.org/10.1016/j.cbi.2017.07.016.
Oh M, Kim SY, Park S, Kim KN, Kim SH. Phytochemicals in Chinese Chive (Allium tuberosum) Induce the Skeletal Muscle Cell Proliferation via PI3K/Akt/mTOR and Smad Pathways in C2C12 Cells. Int J Mol Sci. 2021;22(5). https://doi.org/10.3390/ijms22052296.
Ozbay I, Topuz MF, Oghan F, Kocak H, Kucur C. Serum prolidase, malondialdehyde and catalase levels for the evaluation of oxidative stress in patients with peripheral vertigo. Eur Arch Otorhinolaryngol. 2021;278(10):3773–3776. https://doi.org/10.1007/s00405-020-06466-x.
Rius-Pérez S, Torres-Cuevas I, Millán I, Ortega Á L, Pérez S. PGC-1α, Inflammation, and Oxidative Stress: An Integrative View in Metabolism. Oxid Med Cell Longev. 2020;20201452696. https://doi.org/10.1155/2020/1452696.
Sakamoto T, Imai H. Hydrogen peroxide produced by superoxide dismutase SOD-2 activates sperm in Caenorhabditis elegans. J Biol Chem. 2017;292(36):14804–14813. https://doi.org/10.1074/jbc.M117.788901.
Treadway JL, Hargrove DM, Nardone NA, McPherson RK, Russo JF, Milici AJ, Stukenbrok HA, Gibbs EM, Stevenson RW, Pessin JE. Enhanced peripheral glucose utilization in transgenic mice expressing the human GLUT4 gene. J Biol Chem. 1994;269(47):29956–29961.
Wang T, Wang J, Hu X, Huang XJ, Chen GX. Current understanding of glucose transporter 4 expression and functional mechanisms. World J Biol Chem. 2020;11(3):76–98. https://doi.org/10.4331/wjbc.v11.i3.76.
Wu Y, Liu W, Zhao W. Contributions of serum pharmacology to pharmacology, pharmacodynamics and new drug discovery. Chinese Journal of Tissue Engineering Research. 2018;223914-3920. https://doi.org/10.3969/j.issn.2095-4344.0811.
Xiong H, Zhang S, Zhao Z, Zhao P, Chen L, Mei Z. Antidiabetic activities of entagenic acid in type 2 diabetic db/db mice and L6 myotubes via AMPK/GLUT4 pathway. J Ethnopharmacol. 2018;211366-374. https://doi.org/10.1016/j.jep.2017.10.004.
Yan Y, Zhou XE, Xu HE, Melcher K. Structure and Physiological Regulation of AMPK. Int J Mol Sci. 2018;19(11). https://doi.org/10.3390/ijms19113534.
Yang SS, Yu CB, Luo Z, Luo WL, Zhang J, Xu JX, Xu WN. Berberine attenuates sodium palmitate-induced lipid accumulation, oxidative stress and apoptosis in grass carp(Ctenopharyngodon idella)hepatocyte in vitro. Fish Shellfish Immunol. 2019;88518–527. https://doi.org/10.1016/j.fsi.2019.02.055.
Yaribeygi H, Farrokhi FR, Butler AE, Sahebkar A. Insulin resistance: Review of the underlying molecular mechanisms. J Cell Physiol. 2019;234(6):8152–8161. https://doi.org/10.1002/jcp.27603.
Yaribeygi H, Sathyapalan T, Atkin SL, Sahebkar A. Molecular Mechanisms Linking Oxidative Stress and Diabetes Mellitus. Oxid Med Cell Longev. 2020;20208609213. https://doi.org/10.1155/2020/8609213.
Ye Z, Ma J, Liu Y, Xu B, Dai X, Fu M, Tian T, Sui X, Mo F, Gao S, Zhao D, Zhang D. Jiangtang Sanhao formula ameliorates skeletal muscle insulin resistance via regulating GLUT4 translocation in diabetic mice. Front Pharmacol. 2022;13950535. https://doi.org/10.3389/fphar.2022.950535.
Yee HY, Yang JJ, Wan YG, Chong FL, Wu W, Long Y, Han WB, Liu YL, Tu Y, Yao J. [Molecular mechanisms of insulin resistance and interventional effects of Chinese herbal medicine]. Zhongguo Zhong Yao Za Zhi. 2019;44(7):1289–1294. https://doi.org/10.19540/j.cnki.cjcmm.20181105.003.
Zhang H, Wang X, Liu M, Qin L, Sun W, Liu T. Analysis of traditional Chinese medicated serum intragastric dose. Jilin Journal of Traditional Chinese Medicine. 2015;35(06):623–625. https://doi.org/10.13463/j.cnki.jlzyy.2015.06.029.
Zheng Y, Ley SH, Hu FB. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat Rev Endocrinol. 2018;14(2):88–98. https://doi.org/10.1038/nrendo.2017.151.
Zhou X, Shentu P, Xu Y. Spatiotemporal Regulators for Insulin-Stimulated GLUT4 Vesicle Exocytosis. J Diabetes Res. 2017;20171683678. https://doi.org/10.1155/2017/1683678.
Ziolkowska S, Binienda A, Jabłkowski M, Szemraj J, Czarny P. The Interplay between Insulin Resistance, Inflammation, Oxidative Stress, Base Excision Repair and Metabolic Syndrome in Nonalcoholic Fatty Liver Disease. Int J Mol Sci. 2021;22(20). https://doi.org/10.3390/ijms222011128.

No competing interests reported.

Supplementarymaterials.zip

Download PDF

Version 1

posted

You are reading this latest preprint version

Exploring the Therapeutic Mechanism of Jiangtang Sanhao Formula in Alleviating Insulin Resistance in Skeletal Muscle Cells: Involvement of AMPK/SIRT1/PGC-1α pathway？

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Statistical Analysis

Results

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1