Isolation and culture of rat BMSCs
Male SD rats at 4–6 weeks of age were purchased from Vital River Laboratories (Shanghai, China) and sacrificed by an overdose of pentobarbital sodium. After removal all of the soft tissue from the femurs, the marrows were collected from both ends of the femurs and seeded on cell plates to obtain BMSCs. BMSCs at passages 2–4 were used for the present study.
All animal treatments were strictly in accordance with NIH guidelines and were approved by the Animal Research Committee of the Shanghai Stomatological Hospital and Shanghai Research Center of Model Animal Organization (IACUC No. 2020-0010-06).
Treatment with SrR and chondrogenic differentiation medium
51.35 mg SrR (Sigma-Aldrich, USA) was dissolved in 50 mL of liquid to obtain the highest concentration of 2.0 mmol/L and diluted to various concentrations as previously described[17].
The chondrogenic differentiation medium was prepared as described by Solchaga[18]. DMEM basic medium (Gibco, 11965175) contained 10 ng/mL TGF-β3 (Prospec, CYT-886), 100 U penicillin/streptomycin (Gibco, 15140163), 1% foetal bovine serum (Gibco, 10099), 10-7 mol/L dexamethasone (Sigma, 50-02-2), 50 mg/L L-ascorbic acid (Sigma, A4403), and 1× ITS-A (Gibco, 51300-044) were used.
Cell proliferation assay of BMSCs
CCK-8 assay was used to assess cell proliferation of BMSCs treated with different concentrations of SrR. Briefly, BMSCs were seeded in 96-well plates (starting cell density of 3×103 cells/well) and treated with different concentrations of SrR (0.125, 0.25, 0.5, 1.0, and 2.0 mmol/L) for 1, 3, 5, and 7 days. Then, 10 µL of CCK-8 solution was added to each plate and incubated in the dark in a 5% CO2 and 37°C environment for 1 h. Cell viability was measured by a microplate reader (ELX 800; Bio-tek Instruments, USA) at a wavelength of 450 nm.
Analysis of the Wnt/β-catenin signalling pathway
To determine the effect of SrR on the Wnt/β-catenin signalling pathway, we used XAV-939 (Selleck, China), an inhibitor of β-catenin, at a concentration of 2.0 µmmol/L and LiCl (Sigma, USA), an agonist of β-catenin, at a concentration of 2.0 mmol/L. Grouping was performed as follows: control, 0.25 mmol/L SrR, 0.50 mmol/L SrR, XAV-939, XAV-939 + 0.25 mmol/L SrR, LiCl, and LiCl+ 0.25 mmol/L SrR. After 14 days of induction, alcian blue and toluidine blue staining, immunofluorescence staining, hydroxyproline (Hyp) assays, PCR and Western blot assays were performed.
Alcian blue staining and toluidine blue staining
BMSCs were seeded on 28-well plates at an initial density of 1×105 cells/well and changed to chondrogenic differentiation medium with or without SrR, XAV-939, or LiCl. After 14 days of induction, the cells were fixed with 4% paraformaldehyde and stained with Alcian blue dye solution (Solarbio, China) and toluidine blue dye solution (Solarbio, China). Then, the cells were photographed by inverted light microscopy at 200× magnification (Leica DMI 3000B, Germany).
Immunofluorescence staining assay
BMSCs were cultured in chondrogenic differentiation medium with or without SrR, XAV-939 and LiCl for 14 days and fixed with 4% paraformaldehyde for staining. First, the cells were permeabilized with PBST and rinsed with PBS several times. Nonspecific interactions were blocked with goat serum, and the cells were incubated with primary antibodies. Col-II (Novus Biologicals, NB600-844, USA) and MMP-9 (Proteintech, 10375-2, USA) antibodies were used as primary antibodies, Alexa Fluor 488 IgG (Invitrogen, A11001, USA) was used as the secondary antibody, and DAPI (Sigma, D9642) was used for core staining. Cells were photographed by microscopy at 200× magnification.
Hydroxyproline (Hyp) assay
Hyp assay kit (Abcam, ab222941, USA) was used according to the manufacturer’s instructions. The cell culture supernatants, ddH2O and the standard protein sample were prepared, added to an equal volume of NaOH, evaporated, cooled, and neutralized with an equal amount of HCl. Then, the cells were centrifuged, and the supernatants were collected in a new tube. Oxidation reagent was added and incubated at room temperature for 20 minutes, and developer was added and incubated at 37°C for 5 minutes. Then, DMAB concentrate was added and incubated at 65°C for 45 minutes. The OD values of each group were measured at a wavelength of 560 nm. Hyp concentrations were calculated by the standard curve.
Quantitative real-time PCR assay
BMSCs were cultured in 6-well plates and treated with or without SrR, XAV-939, or LiCl for 1, 7, or 14 days. Total RNA was extracted from BMSCs using TRIzol reagent (Ambion, USA), followed by reverse transcription to generate cDNA with Tiangen FastKing cDNA Dispelling RT SuperMix (Applied Biosystems, USA) according to the manufacturer’s instructions. For RNA expression analysis, cDNA (100 ng) was amplified in a 20 μL reaction system containing 10 μL of 2× SuperReal PreMix Plus, 1.2 μL of primer and 6.8 μL of ddH2O. The primer sequences are listed in Table 1. Triplicate reactions were performed, and the relative fold change in gene expression was calculated (LightCycler 96 PCR system, Roche, Germany).
Table 1. Primer sequences used for the BMSCs
Gene target
|
Primer sequence forward(5'-3')
|
Primer sequence reverse(5'-3')
|
Sox-9
|
TCCCCGCAACAGATCTCCTA
|
AGCTGTGTGTAGACGGGTTG
|
Col-II
|
ATCGCCACGGTCCTACAATG
|
GGCCCTAATTTTCGGGCATC
|
MMP-9
|
GATCCCCAGAGCGTTACTCG
|
GTTGTGGAAACTCACACGCC
|
β-catenin
|
ACTCCAGGAATGAAGGCGTG
|
GAACTGGTCAGCTCAACCGA
|
Aggrecan
|
CAAGTCCCTGACAGACACCC
|
GTCCACCCCTCCTCACATTG
|
GAPDH
|
AGTGCCAGCCTCGTCTCATA
|
GATGGTGATGGGTTTCCCGT
|
WB assay
BMSCs were cultured in 6-well plates with chondrogenic differentiation medium with or without SrR, XAV-939, and LiCl for 14 days. Total protein was extracted by RIPA buffer and measured by a BCA protein assay kit. Equal amounts of proteins were subjected to 12% SDS-PAGE and transferred to PCDF membranes. After the membranes were blocked with 5% skim milk, they were exposed to primary antibody, including Sox-9 (Santa Cruz, sc-166505), β-catenin (CST, 9562, USA), MMP-9 (Proteintech, 10375-2), aggrecan (Proteintech, 13880-1), and β-actin antibodies (CST, 4970), at 4°C overnight. Then, the cells were washed with PBST and incubated with HRP-conjugated goat anti-rabbit or rabbit anti-mouse IgG (Beyotime, China) for 2 h at room temperature. The membranes were thoroughly washed, and ECL reagent (Pierce, Rockford, IL, USA) was used for visualization. Bands were photographed and measured by the Quantity One analysis system (Bio-Rad).
Synthesis of SrR-loaded silica nanospheres and GelMA gel
Silica nanospheres were synthesized according to the sol-gel approach as described by a previous study[19]. Briefly, 3.0 g ammonium fluoride (NH4F) and 1.82 g cetyltrimethylammonium bromide (CTAB) were dissolved in ddH2O, heated to 80°C and stirred for 1 h. Nine milliliters of tetraethoxysilane (TEOS) was added in a dropwise manner, centrifuged (8000 rpm, 25 minutes) in the suspension solution, and maintained overnight at room temperature. Then, the sample was freeze dried for 12 h, heated to 600°C and calcined for 6 h. For SrR drug loading, the nanospheres were immersed and stirred in PBS containing 2.0 mmol/L SrR for 48 h. The morphology of the silica nanospheres was observed by scanning electron microscopy (SEM) and characterized by energy dispersive spectrum analysis (EDS). Then, the drug releasing speed was tested. We added 80 μL of SrR at a concentration of 2.0 mmol/L to 0.1 g silica nanospheres, and after it was completely absorbed and dried, these nanospheres were immersed in 2 mL of PBS at 37°C. In addition, the supernatant was collected and refreshed at 1 h, 2 h, 4 h, 8 h, 12 h, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, and 9 days. The SrR content was quantified by ultraviolet spectrophotometry.
Product of gelatine methacryloyl, GelMA (ELF, EFL-GM-30, Suzhou, China) were used as scaffold carriers of SrR-loaded nanospheres to obtain desirable mechanical properties. In short, gelatine directly reacts with MA in phosphate buffer, and lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP) is used as a photoinitiator[20]. The SrR-loaded nanospheres were mixed with GelMA jelly at a concentration of 0.1 g/mL and incubated in the dark at 4°C for storage.
Animal surgery
Thirty healthy male SD rats at 8–9 weeks of age were purchased from Vital River Laboratories (Shanghai, China) and fed in SPF conditions for 1 week before the surgery. The femoral condyle defect model was established following the procedure of a previous study[21]. Briefly, medial parapatellar arthrotomy was performed on both sides of the knees under general anesthesia, and the femoral trochlea was fully exposed. A round defect with 2.5 mm diameter and 1.0 mm depth was made on the center trochlea by a trephine under cooling with saline. Cartilage defects were left empty for the empty group (n=10) and were filled with GelMA + nanospheres in the control group (n=10). The defects in the test group (n=10) were filled with GelMA + SrR-loaded nanospheres and cured by UV light for 30 s. All of the wounds were carefully sutured, and the muscle layer was reverted back to the original position. The animals were euthanized 3 months after the surgery.
Histological and immunohistochemical evaluation
Samples were collected and fixed in formalin for 3 days, followed by 6 weeks of decalcification. Paraffin sections were made and stained with toluidine blue, safranin O/fast green, MMP-9 (Abcam, ab7003, UK) and β-catenin antibodies (Abcam, ab32572, UK) for immunohistochemical staining.
The histological characteristics of the regenerated cartilage tissue were scored using the International Cartilage Repair Society (ICRS) II scoring system[22], as shown in Table 2. Toluidine blue-stained and safranin O/fast green-stained sections were assessed by three independent doctors blinded to the grouping, and the average scores were calculated.
Table 2. The International Cartilage Repair Society II scoring system[22]
Histological parameter
|
Score (0–100)
|
1. Tissue morphology
|
0: Full thickness collagen fibers
100: Normal cartilage birefringence
|
2. Matrix staining
|
0: No staining
100: Full metachromasia
|
3. Cell morphology
|
0: No round/oval cells
100: Mostly round/oval cells
|
4. Chondrocyte clustering
|
0: Present
100: Absent
|
5. Surface architecture
|
0: Delamination or major irregularity
100: Smooth surface
|
6. Basal integration
|
0: No integration
100: Complete integration
|
7. Formation of a tidemark
|
0: No calcification front
100: Tidemark
|
8. Subchondral bone abnormalities/marrow fibrosis
|
0: Abnormal
100: Normal marrow
|
9. Inflammation
|
0: Present
100: Absent
|
10. Abnormal calcification/ossification
|
0: Present
100: Absent
|
11. Vascularization
(within the repaired tissue)
|
0: Present
100: Absent
|
12. Surface/superficial assessment
|
0: Total loss or complete disruption
100: Resembles intact articular cartilage
|
13. Mid/deep zone assessment
|
0: Fibrous tissue
100: Normal hyaline cartilage
|
14. Overall assessment
|
0: Bad, fibrous tissue
100: Good, hyaline cartilage
|
Statistical analysis
Data are shown as the mean ± SD and were analysed by SPSS 26.0 software. One-way analysis of variance (ANOVA) was used to determine the statistical significance of the differences among groups, and a P value<0.05 was considered statistically significant.