WITHDRAWN: Effects of TgCtwh3 Toxoplasma gondii ROP16 on neuronal apoptosis and β-amyloid production

doi:10.21203/rs.3.rs-3467977/v1

Download PDF

Research Article

WITHDRAWN: Effects of TgCtwh3 Toxoplasma gondii ROP16 on neuronal apoptosis and β-amyloid production

https://doi.org/10.21203/rs.3.rs-3467977/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

The full text of this preprint has been withdrawn, as it was submitted in error. Therefore, the authors do not wish this work to be cited as a reference. Questions should be directed to the corresponding author.

Editorial notes are used to provide important context regarding the topic of a preprint or to alert readers to potential issues concerning that preprint or a downstream publication associated with it. For more information on editorial notes, see our Editorial Policies.

Background

Toxoplasma gondii(T.gondii) has been demonstrated to be a causative agent of Alzheimer's disease (AD). Neuronal apoptosis and β-amyloid (Aβ) aggregation are some of the main pathological features of AD. In recent years, our group found that the main genotype of T.gondii in China is Chinese 1 (ToxoDB#9), and Rhoptry protein16 (ROP16) is an important virulence factor of this type of T.gondii. The effects of ROP16 on hippocampal neurons and β-amyloid have rarely been reported.

Methods

BALB/c mice were intraperitoneally injected with TgCtwh3 ΔROP16 and TgCtwh3 WT tachyzoites, respectively. Tissues from the hippocampal region of mice were taken one week after infection for pathomorphological analysis, and the expression levels of inflammatory factors, apoptosis-related proteins, as well as proteins and genes related to Aβ formation in the hippocampal region of mice were assessed by Western Blotting and qRT-PCR. In vitro experiments, the mouse hippocampal neuronal cell line HT22 was directly infected with TgCtwh3 ΔROP16 and TgCtwh3 WT tachyzoites, and the expression levels of the relevant proteins were analyzed by Western Blotting and immunofluorescence staining, and apoptosis of the infected HT22 cells was determined by flow cytometry.

Results

Histopathological changes showed abnormal morphology and reduced number of neurons in hippocampal zone of infected mice. In addition, the expression of pro-apoptotic proteins, pro-inflammatory factors as well as APP and BACE1 increased in control group, TgCtwh3 ΔROP16 group and TgCtwh3 WT group. In vitro experiments showed that the protein blotting results indicated that TgCtwh3 and its virulence factor ROP16 could lead to neuronal apoptosis and Aβ generation through the endoplasmic reticulum stress pathway and NF-κB signaling pathway. And the flow results showed that the apoptosis rate of HT22 cells in the three groups increased step by step.

Conclusion

TgCtwh3 ROP16 induces neuronal apoptosis, Aβ production and secretion of inflammatory factors.

T.gondii Chinese 1 genotype Wh3 strain

ROP16

hippocampal neuron

apoptosis

β-amyloid

Neurodegenerative disease is an epidemic and rare genetic disorder of the central nervous system. It is characterized mainly by the loss of neuronal populations and pathological protein formation [1]. As a multifactorial neurodegenerative condition, pathogenic infections, such as those caused by bacteria, viruses, fungi, and parasites, may increase the risk of developing Alzheimer's disease (AD). These infections may result in neuroinflammation, the development of β-amyloid(Aβ), and neuronal degeneration [2]. Aβ is a distinguishing lesion in the AD brain that produces Aβ peptides with varying lengths of 38–43 amino acids by cleaving the amyloid precursor protein (APP) primarily by two proteases, β-secretase (BACE1) and γ-secretase [3]. According to the study, upregulation of BACE1 can activate NF-κB pathway to make Aβ expression increase [4].

About 30% of the world's population is affected by Toxoplasma gondii (T.gondii) infections, which are mostly spread by encysts, thick, membrane spores that are resistant to environmental factors [5]. The immune response induced by T.gondii infection varies between acute (proliferative) and chronic (latent and dormant) stages, depending mainly on the virulence of the parasite strain [6]. There is mounting evidence that chronic Toxoplasma II and III infection in mice can develop cognitive and behavioral impairments like AD [7–9]. However, less research has been done on the more virulent type I strain's impact on hippocampus neurons after acute infection. After the infection enters the brain, neurons serve as the primary target for infection by the common brain-bound parasite T.gondii [10]. It has been found that the number of neurons in the hippocampal region decreases and apoptosis occurs in mice after parasite infection [11]. Neuroinflammation in general is defined as an inflammatory response within the central nervous system, characterized by the production of pro-inflammatory cytokines. The main immune cells involved in this process are microglia and astrocytes [12]. Microglia and astrocytes play a key role in this process as immune cells. In animal models of AD [13], some studies have discovered that microglia are active before plaque creation; also, patients with mild cognitive impairment (MCI) had enhanced microglial activation prior to Aβ production [14, 15]. These results imply that neuroinflammation occurs early in AD. Tumor necrosis factor (TNF), interleukin-1 (IL-1), and interleukin-6 (IL-6) are just a few of the cytokines that are released as a result of T.gondii infection, which causes a focused inflammatory response that starts a type 1 helper (Th1) cell-mediated immune response [16, 17]. And Aβ has been discovered to be raised to diverse degrees in the brains of mice that had been exposed to several T.gondii strains [18].

Target cells are primarily invaded by T.gondii through the secretion of a variety of parasitic proteins like rhoptry protein(ROP), dense granules(GRA), and micronemes(MIC) [19, 20]. Among them, the Chinese type 1 (ToxoDB #9) strain, which is endemic in China, was found by our group to carry both GRA15_II and ROP16_I/III effectors [21]. T. gondii Chinese 1 genotype Wh3 strain (TgCtwh3) and T. gondii Chinese 1 genotype Wh6 strain (TgCtwh6) are the representative strains. TgCtwh3 is a member of a robust strain, but TgCtwh6 is a member of a weak strain [22]. According to our prior research, TgCtwh6 can impair mice's cognitive and behavioral [8]. There is, however, very few research on how TgCtwh3 infection affects neurons in China, where both TgCtwh3 and TgCtwh6 can cause chronic infection in the population [23]. ROP16, one of the first ROP kinases identified, is a member of the family of genes encoding polymorphic serine/threonine proteins (ROP kinases) responsible for virulence [24, 25]. Recent research has shown that ROP16 can influence the phosphorylation of the host transcription factor STAT6 to promote environmental stress-induced cyst formation [26]. In the present study, we infected mice with TgCtwh3 ΔROP16 and TgCtwh3 WT tachyons and speculated the effect of ROP16 on mouse hippocampal neurons from in vivo and in vitro studies, respectively. Thus, this will help to understand the effects of T.gondii, a major epidemic in China, on brain-related functional areas.

2.1 Antibodies and Materials

Anti-APP, BIP antibodies were purchased from Immunoway (Plano, TX, USA). Anti-BACE, Bax, Bcl2, Cleaved-caspase3, Cleaved-caspase12, NF-κBp65, p-NF-κBp65 antibodies were purchased from Wanleibio (Shenyang, China). FITC-labeled goat anti-rabbit IgG, phenylmethanesulfonyl fluoride (PMSF) and phosphorylated protease inhibitors were purchased from Servicebio (Wuhan, China). Anti-β-actin and goat anti-rabbit antibodies were purchased from Proteintech (Chicago, IL, USA). Tauroursodeoxycholate sodium (Tauroursodeoxycholic acid, TUDCA, an endoplasmic reticulum stress inhibitor, Cat# HY-19696), 4-Methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine (JSH-23, NF-κB activation inhibitor, Cat# HY-13982) were obtained from MedChemExpress (New Jersey, USA).

Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were obtained from Biological Industries (Palestine). 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI), Penicillin-streptomycin, Annexin V-FITC Apoptosis Detection kit and SDS polyacrylamide gel electrophoresis were purchased from Beyotime (Shanghai, China). Hematoxylin and eosin (H&E), Nissl staining kit, Thioflavin S were purchased from Sigma (St. Louis, MO, USA). BCA protein assay kits was obtained from Biosharp (Hefei, China). TRIzol reagent was purchased from Thermo (MIT, USA). RIPA lysis buffer and nitrocellulose membrane were provided by Millipore (Billerica, MA, USA). Primer Script First Strand cDNA Synthesis Kit and SYBR Premix Ex Taq kit were purchased from Sparkjade (Shandong, China). Hippocampal neuronal cell line (HT22) and Vero cell line (Vero) were purchased from Procell Life Science (Wuhan, China). TgCtwh3 ΔROP16 tachyzoites were gifted by Dr. Cong Wang [27]. TgCtwh3 WT and TgCtwh3 ΔROP16 tachyzoites were kept in Vero cells, respectively, which were stored at -80℃ in our laboratory (Anhui Province Key Laboratory of Microbiology and Parasitology).

2.2 Animals

Thirty female BABL/c mice (8 to 10-week-old, specific pathogen free, SPF) averagely weighing from 18–20 g were purchased from Hangzhou Ziyuan Experimental Animal Technology Company, Zhejiang, China (production permit number: Scxk 2019-0004). The mice were treated in strict compliance with the Chinese National Institute of Health Guide for the Care and Use of Laboratory Animals. This animal experiment was approved by the Institutional Review Board of the Institute of Biomedicine at Anhui Medical University (permit number: AMU26093628). All mice were housed in a colony room of Anhui Province Key Laboratory of Microbiology and Parasitology under controlled conditions (12/12-hour circadian rhythm and temperature of 20 ± 2°C, humidity of 45 ± 5%), and fed with standard chow and pure water ad libitum.

After feeding for one week, all mice were randomly divided into 3 groups, ten in each: control group, TgCtwh3ΔROP16 group, and TgCtwh3 WT group. Each mouse in the TgCtwh3ΔROP16 group was infected through intraperitoneal injection with 1000 TgCtwh3ΔROP16 tachyzoites in 200µl normal saline; meanwhile, each mouse in the TgCtwh3 WT group was infected through intraperitoneal injection with 1000 TgCtwh3 WT tachyzoites in 200µl normal saline. Then all mice were euthanized on the 7th day post-infection and mice brain tissues were collected for histopathological analysis, protein and gene expression detection.

2.3 T.gondii and cell culture

Tachyzoites of both strains (TgCtwh3 WT and TgCtwh3ΔROP16) were cultured separately in Vero cells in DMEM medium containing 10% fetal bovine serum, 1% penicillin-streptomycin at 37°C and 5% CO₂.

HT22 cells were cultured in DMEM medium containing 10% FBS, 1% penicillin-streptomycin at 37°C, and 5% CO₂. The HT22 cells (1×10⁶) were added to a 6-well plate and cultured for 12 h, then TgCtwh3 ΔROP16 tachyzoites (3 × 10⁶) or TgCtwh3 WT tachyzoites (3 × 10⁶) were added into the plate to infect the HT22 cells for another 24 h followed by detecting protein expression of Cleaved-caspase3, Bax, Bcl2, APP, BACE1 and cell apoptosis using western blotting, immunofluorescence staining and flow cytometry assay.

In the experiment of endoplasmic reticulum stress inhibition by TUDCA, HT22 cells (5×10⁵) were inoculated in 12-well plates and divided into 6 groups: control group, TUDCA group, TgCtwh3ΔROP16 group, TgCtwh3ΔROP16 + TUDCA group, TgCtwh3 WT group, and TgCtwh3 WT + TUDCA group. After cultured for 12h, HT22 cells in the TUDCA, TgCtwh3ΔROP16 + TUDCA and TgCtwh3 WT + TUDCA group were pretreated for 12 h by adding TUDCA (200 µM) [28] into each well; then the TgCtwh3ΔROP16 (1.5×10⁶) or TgCtwh3 WT (1.5×10⁶) tachyzoites were added into corresponding group with MOI = 3 (Multiplicity Of Infection). After another 24 h of culture, HT22 cells were subjected to western blotting or flow cytometry assay.

In addition, in the experiment of NF-κB signaling pathway inhibition by JSH-23, HT22 cells (5×10⁵) were inoculated in 12-well plates and divided into 6 groups: control group, the JSH-23 group, TgCtwh3ΔROP16 group, TgCtwh3ΔROP16 + JSH-23 group, TgCtwh3 WT group, and TgCtwh3 WT + JSH-23 group. After cultured for 12 h, HT22 cells in the JSH-23, TgCtwh3ΔROP16 + JSH-23 and TgCtwh3 WT + JSH-23 group were pretreated for 12 h by adding JSH-23 (10 µM) [29] into each well; then the TgCtwh3ΔROP16 (1.5×10⁶) or TgCtwh3 WT (1.5×10⁶) tachyzoites were added into corresponding group with MOI = 3 (Multiplicity Of Infection). After incubation for another 24 h, HT22 cells were subjected to western blotting or immunofluorescence staining.

2.4 Hematoxylin and eosin (HE) Staining

Paraffin sections of brain (4µm) from at least three mice in each group were chosen at random, dewaxed three times in xylene and hydrated in gradient concentration of ethanol. The dewaxed paraffin sections were immersed in hematoxylin for 5 min, rinsed slowly with running water for several seconds, then differentiated with 1% hydrochloric acid alcohol for 30 s, rinsed slowly with running water for several seconds. Then these sections were immersed in eosin for 25 s-1 min. Finally, the sections were dehydrated routinely in anhydrous ethanol, permeabilized in xylene, sealed with neutral resin and left to dry naturally. All HE-stained tissue sections were observed under a light microscope (LEICA, Wetzlar, Germany) with magnifications of 20×10 and 40×10, and the images in field of view of hippocampal zone for each section were captured by an observer in a blinded manner.

2.5 Nissl Staining

Changes in the number of Nissl bodies in neurons of the hippocampal region of mice infected with different strains of the worm were observed by nissl staining. Paraffin sections were dewaxed to water and immersed in tarry violet staining solution at 56°C for 1 h. Deionized water was rinsed slowly. The sections were then placed in nissl differentiation solution for 2 min. Note the degree of differentiation under the microscope. Dehydration was then carried out with absolute ethanol, transparent with xylene, and finally sealed with neutral resin. All sections were observed under an optical microscope (40×10) (LEICA, Wetzlar, Germany), five visual fields were randomly observed by blind method, and the total number of positive areas was recorded for the final Image J (USA) analysis.

2.6 Thioflavin S plaque Staining

Thioflavin S binds specifically to mature β-amyloid, and staining allows clearer visualization of whether mature Aβ is produced and the distribution of Aβ in brain tissue. A solution with a concentration of 0.3% thioflavin was prepared in 50% alcohol and filtered. After paraffin sections were dewaxed to water, the sections were incubated with the staining solution at room temperature and protected from light for 8 min; PBS was used to wash the sections three times for 5 min each time; the nucleus were then re-stained with DAPI and incubated for 10 min protected from light, and the sections were finally sealed. The sections were placed under fluorescence microscope (20×10) (LEICA, Wetzlar, Germany) for observation, and the observer randomly collected five different fields of view in the hippocampal area by blind method. Pictures of the plaque area were examined with Image J (MD, USA).

2.7 Immunofluorescence Staining

Brain tissue paraffin sections were dewaxed to water before antigen repair; HT22 was infected with WH3 WT and WH3 ΔROP16 tachyzoites in 12-well plates for 24 h and closed with 4% paraformaldehyde for 15 min. Sections were first closed with immunofluorescent blocking solution for 1 h, then incubated with primary antibody APP (1:200), BACE1 (1:200), NF-κBp65 (1:200), p-NF-κBp65 (1:200)at 4°C overnight, and finally Goat anti-rabbit IgG coupled with FITC (1:200) was added and incubated for 1 h at 37°C. Finally, anti-fluorescent bursting agent containing DAPI was added dropwise. Images were obtained at least five times under a fluorescence microscope (20×10 and 40×10) (LEICA, Wetzlar, Germany) using a blinded method. Finally, they were analyzed with Image J (MD, USA).

2.8 Western Blotting

Lysis of approximately 80mg of hippocampal tissue or cultured HT22 cell line with RIPA lysis buffer supplemented with protease inhibitor. The extracted total protein concentration was then determined using a BCA protein concentration assay kit. Each protein sample (10ug) was added to a 12.5% polyacrylamide gel for electrophoresis and separation and transferred to a polyvinylidene difluoride membrane (PVDF). Non-specific binding was blocked using protein-free fast-blocking solution for about 20 min at room temperature. Membranes were incubated with APP (1:2000), BACE1 (1:500), Bax (1:1000), Bcl2 (1:500), Capsase3 (1:500), Caspase12(1:1500), BIP(1:2000), NF-κBp65 (1:1000), p-NF-κBp65 (1:1000) and β-actin (1:5000) Primary antibodies were incubated overnight at 4°C and then incubated with enzyme-labeled secondary antibodies (1:10,000) at room temperature for 1 h. Specific protein signals were detected with the ECL chemiluminescence kit. The Chemo Dox XRS system (Bio-Rad Laboratories, Hercules, CA, USA) was used to view the images from the blots. The optical density of each band was calculated using the Image J program (MD, USA).

2.9 Quantitative Real-Time PCR (RT-qPCR)

RNA was extracted from hippocampal tissues with TRIzol reagent, and RNA concentration and purity were determined by NanoDrop2000 (Thermo Scientific, Shanghai, China) software. The RNA was reverse transcribed to cDNA using the primer Script first Strand cDNA Synthesis Kit. qRT-PCR was performed using SYBR Premix Ex Taq kitand Light Cycler 96 (Roche, Switzerland) to detect the expression of IL-6, TNF-α, iNOS, TGF-β1, APP and BACE1 expression, and the thermal cycling conditions were programmed with 40 cycles of 15 s at 95°C followed by 30 s at 60°C. The expression of the relevant genes was analyzed by the 2-ΔΔCT method with statistical cycle thresholds. The abundance of target RNA transcripts was evaluated relatively quantitatively using the housekeeping gene GAPDH as a control. All qRT-PCRs were technical replicates. The gene-specific primer sequences are listed in Table 1.

Table 1

The primers used for qRT-PCR.
Primers	Forward primer(5’-3’)	Reverse primer(5’-3’)
IL-6	CCGGAGAGGAGACTTCACAG	CATTTCCACGATTTCCCAGA
TNF-α	ACGGCATGGATCTCAAAGAC	GTGGGTGAGGAGCACGTAGT
iNOS	CACCTTGGAGTTCACCCAGT	ACCACTCGTACTTGGGATGC
TGF-β1	CTGGATACCAACTACTGCTTCAG	TTGGTTGTAGAGGGCAAGGACCT
APP	TGAATGTGCAGAATGGAAAGTG	AACTAGGCAACGGTAAGGAATC
BACE1	GCAGACATGGAAGACTGTGGCTAC	GGCAGAGTGGCAACATGAAGAGG
GAPDH	CAACTTTGGCATTGTGGAAGG	ACACATTGGGGGTAGGAACAC

2.10 Flow cytometry

After HT22 was infected and uninfected by WH3 ΔROP16 and WH3 WT tachyzoites for 24 h, respectively, infected and uninfected cells were collected, and the apoptosis of HT22 cells was detected by FITC Annexin V Apoptosis Detection Kit and CytoFLEX flow cytometry. Finally, the results were analyzed by FlowJo_V10 for data analysis.

3 Statistical Analysis

All data were obtained from triplicate values representing three independent experiments with identical conditions. One-way ANOVA followed by the Bonferroni post hoc test was used for data analysis using GraphPad Prism 8.2.1 (GraphPad Software, San Diego, CA, USA). All results were assessed as mean ± SD (n = 5 replicates for each group), two-tailed P < 0.05 or P < 0.01 or P < 0.001 was regarded as statistically significant.

4.1 Establishment of the mouse infection model

To determine the optimal relationship between the number of mice infected with T.gondii and APP production, we injected mice intraperitoneally with different numbers of strains of T.gondii, and the Control group was injected with the same amount of saline. One week after infection, Western Blotting was performed on the hippocampus of mice, and the results showed that the injection of 1000 Toxoplasma tachyzoites (ANOVA, F _{(12, 26)} = 104.1, P < 0.0001) had a significant difference in APP production (Fig. 1A, B). Therefore, mice were infected in large batches for the remainder of the experiment. Compared with uninfected mice, mice infected with TgCtwh3 ΔROP16 and TgCtwh3 WT showed a typical hunchback posture, uneven fur, stiff limbs, and dull eyes (Fig. 1C).

4.2 TgCtwh3 ROP16 induces apoptosis in mouse hippocampal neurons

To assess the apoptosis of hippocampal neuronal cells in mice infected with TgCtwh3 ΔROP16 or TgCtwh3 WT tachyzoites, we observed that neurons in the hippocampal region of mice in the normal group were neatly arranged with regular morphology by HE staining; whereas, the infected group had disorganized neurons with a reduced number of neurons arranged and had more abnormally stained cells compared with the Control group; the TgCtwh3 WT group had a more disorganized neuronal arrangement in the hippocampal region and more abnormally deep-stained cells than the TgCtwh3 ΔROP16 group (Fig. 2D). Similarly, the results of Nissl staining showed that the number of Nissl vesicles in the hippocampal tissues of Control, TgCtwh3 ΔROP16, and TgCtwh3 WT groups of mice showed a stepwise decreasing trend (ANOVA, F _{(2, 6)} = 45.43, P = 0.0002). This suggests that ROP16 induces neuronal reduction in mouse hippocampal tissue (Fig. 2F, G). To determine whether the neuronal reduction was related to apoptosis, we took the hippocampus of three groups of mice to detect apoptosis-related proteins by protein blotting (Fig. 2A). The results showed that Caspase 3 (ANOVA, F _{(2, 6)} = 44.09, P = 0.0003) and Bax (ANOVA, F _{(2, 6)} = 19.51, P = 0.0024) were enhanced step by step, while Bcl-2 (ANOVA, F _{(2, 6)} = 42.14, P = 0.0003) decreased step by step (Fig. 2B, C, E), suggesting that ROP16 induced neuronal apoptosis in the hippocampal region.

4.3 TgCtwh3 ROP16 induces Aβ-related proteins expression elevated in mouse hippocampus

To verify whether TgCtwh3 infection leads to Aβ-related proteins expression elevated in the brains of infected mice and whether ROP16 plays a facilitating or inhibiting role in this process. We compared Aβ production in three groups by thioflavin S plaque staining. Thioredoxin S specifically binds to mature Aβ, and the staining showed different degrees of bright green plaques in the hippocampal tissues of infected mice compared with uninfected mice; and more bright green plaques in the TgCtwh3 WT group compared with the TgCtwh3 ΔROP16 group (Fig. 3D). This suggests that T.gondii infection can lead to increased Aβ expression (ANOVA, F _{(2, 6)} = 107.0, P < 0.0001) and that ROP16 has a promoting effect (Fig. 3E). In addition, Western Blot and qRT-PCR results showed that APP (ANOVA, F _{(2, 6)} = 39.79, P = 0.0003, for protein; ANOVA, F _{(2, 6)} = 195.4, P < 0.0001, for gene) and BACE1 (ANOVA, F _{(2, 6)} = 40.86, P = 0.0003, for protein; ANOVA, F _{(2, 6)} = 61.05, P < 0.0001, for gene) increased stepwise in Control, TgCtwh3 ΔROP16 and TgCtwh3 WT groups (Fig. 3A-C, F, G), indicating that infection with T.gondii promotes the expression of Aβ produces associated proteins and that ROP16 of TgCtwh3 promotes Aβ-related proteins production.

4.4 TgCtwh3 ROP16 promotes secretion of inflammatory factors in mouse hippocampal tissue

Inflammation is usually accompanied by secretion of inflammatory factors. To observe whether TgCtwh3 infection caused the secretion of inflammatory factors in the hippocampal region of mice, we extracted hippocampal tissue proteins and RNA from the infected and uninfected groups of mice, and analyzed the protein (Fig. 4A) and gene expression of iNOS, TNF-α, IL-6 and TGF-β1 by Western Blot and qRT-PCR. The results showed that the expression of pro-inflammatory factors iNOS (ANOVA, F _{(2, 6)} = 32.11, P = 0.0006, for protein; ANOVA, F _{(2, 6)} = 13.42, P = 0.0016, for gene), TNF-α (ANOVA, F _{(2, 6)} = 16.34, P = 0.0037, for protein; ANOVA, F _{(2, 6)} = 75.53, P < 0.0001, for gene) and IL-6 (ANOVA, F _{(2, 6)} = 79.81, P < 0.0001, for protein; ANOVA, F _{(2, 6)} = 15.74, P = 0.0041, for gene) was significantly increased (Fig. 4B-D, F-H); meanwhile, the expression of anti-inflammatory factor TGF-β1 (ANOVA, F _{(2, 6)} = 28.18, P = 0.0009, for protein; ANOVA, F _{(2, 6)} = 22.72, P = 0.0016, for gene) was significantly decreased(Fig. 4E, I). And compared with the TgCtwh3 ΔROP16 group, the expression of pro-inflammatory factors was higher and the expression of anti-inflammatory factors was lower in the TgCtwh3 WT group.

4.5 Infection with TgCtwh3 tachyzoites induces apoptosis in HT22 cells and ROP16 is pro-apoptotic

In vivo experiments have shown that TgCtwh3 ROP16 induces apoptosis in mouse hippocampal histiocytes and neurons, so does it similarly cause apoptosis in mouse hippocampal neuron HT22 cell line in vitro again? To verify this speculation, the two strains of tachyzoites were cultured with HT22 for 24 h, and the cell proteins were collected for Western Blot. The results of Western Blot showed that the pro-apoptotic proteins Cleaved-caspase3 (ANOVA, F _{(2, 6)} = 36.22, P = 0.0004) and Bax (ANOVA, F _{(2, 6)} = 328.2, P < 0.0001) were significantly higher and the anti-apoptotic protein Bcl-2 (ANOVA, F _{(2, 6)} = 160.5, P < 0.0001) was significantly lower in the infected group compared to the uninfected group. the TgCtwh3 WT group showed a significant increase in the pro-apoptotic proteins Cleaved-caspase3 and Bax, and a significant decrease in the anti-apoptotic protein Bcl-2 compared to the TgCtwh3 ΔROP16 group (Fig. 5A-D). In addition, the flow cytometry results showed that the apoptosis rate (ANOVA, F _{(2, 6)} = 393.2, P < 0.0001) of Control group, TgCtwh3 ΔROP16 group, and TgCtwh3 WT group increased step by step (Fig. 5E, F). This indicated that TgCtwh3 ROP16 could induce apoptosis in HT22 cells.

4.6 TgCtwh3 ROP16 promotes APP and BACE1 expression in HT22

To investigate whether TgCtwh3 ROP16 promotes the production of Aβ-related protein in HT22 cell line in vitro. We directly infected HT22 with TgCtwh3 ΔROP16 and TgCtwh3 WT tachyzoites, respectively. The expression of APP (ANOVA, F _{(2, 6)} = 95.41, P < 0.0001) and BACE1 (ANOVA, F _{(2, 6)} = 157.9, P < 0.0001) in infected HT22 was detected by Western blotting and immunofluorescence staining. The results showed that the protein expression levels of APP and BACE1 in the infected group were significantly higher than those in the control group, and the expression of APP and BACE1 in the infected TgCtwh3 WT group was significantly higher than that in the TgCtwh3 ΔROP16 group (Fig. 6A-C). In addition, the immunofluorescence results showed that the expression of APP (ANOVA, F _{(2, 29)} = 63.31, P < 0.0001) and BACE1 (ANOVA, F _{(2, 20)} = 57.21, P < 0.0001) protein-positive cells was up-regulated in Control, TgCtwh3 ΔROP16 and TgCtwh3 WT groups (Fig. 6D-G). This suggests that direct infection by TgCtwh3 tachyzoites can lead to the elevation of APP and BACE1 in HT22, and that ROP16 has a facilitating role in this, further suggesting that TgCtwh3 ROP16 may lead to the elevation of Aβ-related protein in HT22.

4.7 TgCtwh3 ROP16 promotes HT22 cell apoptosis through the ERS pathway

Our previous results showed that TgCtwh3 ROP16 induced apoptosis in HT22 cells. To investigate the specific mechanism involved, we pretreated HT22 cells with 200µM TUDCA for 12 h and then cultured the two Toxoplasma tachyzoites by adding them separately at MOI = 3 to observe whether the ERS pathway is involved in TgCtwh3 ROP16-induced apoptosis in HT22. Western Blot results showed that compared with the control group, the expression of BIP (ANOVA, F _{(5, 12)} = 45.61, P < 0.0001), Cleaved-caspase12 (ANOVA, F _{(5, 12)} = 24.67, P < 0.0001) and Cleaved-caspase3 (ANOVA, F _{(5, 12)} = 22.92, P < 0.0001) were significantly elevated in HT22 cells in the co-culture group of TgCtwh3 ΔROP16 and TgCtwh3 WT tachyzoites, whereas the expression of BIP, Cleaved-caspase12 and Cleaved-caspase3 was significantly reduced in the HT22 cells that were pre-treated with TUDCA inhibitor (Fig. 7A-C, E). In addition, after pretreatment with TUDCA, the apoptosis rates of HT22 cultured with TgCtwh3 ΔROP16 and TgCtwh3 WT tachyzoites were 17.54% and 23.95%, respectively, which were significantly lower than that of the TUDCA-untreated TgCtwh3 ΔROP16 group (26.01%) and TgCtwh3 WT group (37.7%) (ANOVA, F _{(5, 12)} = 125.7, P < 0.0001) (Fig. 7D).

Analysis of Western Blot results in the ERS-mediated apoptosis pathway in HT22 cells cultured with Toxoplasma tachyzoites showed that TgCtwh3 ΔROP16 and TgCtwh3 WT strains up-regulated the expression level of BIP and activated caspase12 and caspase3 in HT22 cells. at the same time, the caspase12 inhibitor TUDCA attenuated Toxoplasma tachyzoite-induced apoptosis. These results suggest that TgCtwh3 ΔROP16 with the TgCtwh3 WT worm strain can induce apoptosis in the HT22 cell line via the ERS pathway and that ROP16 plays a facilitating role in it.

4.8 TgCtwh3 ROP16 promotes Aβ-related protein production in HT22 cells through the NF-κB signaling pathway

To further investigate the mechanism of TgCtwh3 ROP16-induced Aβ-related protein production in HT22 cell line, we pretreated HT22 with 10µM of the NF-κB signaling pathway inhibitor JSH-23 [29], and then cultured the cells in the treated and untreated groups with TgCtwh3 ΔROP16 and T Ctwh3 WT, respectively, the WB results showed that the expression levels of APP in JSH-23-treated cells expressed significantly lower levels of APP (ANOVA, F _{(5, 12)} = 26.84, P < 0.0001), BACE1 (ANOVA, F _{(5, 12)} = 21.78, P < 0.0001), NF-κBp65 (ANOVA, F _{(5, 12)} = 29.94, P < 0.0001) and p-NF-κBp65 (ANOVA, F _{(5, 12)} = 44.55, P < 0.0001), while those in the untreated group were significantly higher(Fig. 8A-E). Similarly, the results of cellular immunofluorescence were also similar, and it could be seen that the untreated group had stronger fluorescence expression of APP (ANOVA, F _{(5, 32)} = 40.83, P < 0.0001), BACE1 (ANOVA, F _{(5, 29)} = 136.3, P < 0.0001), NF-κBp65 (ANOVA, F _{(5, 31)} = 64.06, P < 0.0001) and p-NF-κBp65 (ANOVA, F _{(5, 34)} = 169.4, P < 0.0001), while the group using JSH-23 had relatively weaker fluorescence expression of APP, BACE1, NF-κBp65 and p-NF-κBp65 (Fig. 8F-M). These results suggest that TgCtwh3 ROP16 can lead to elevated Aβ-related protein through the NF-κB signaling pathway.

A rising body of evidence points to a strong correlation between T.gondii infection and Alzheimer's disease[8, 30], as well as significant effects on neuronal structure and function[31]. According to our earlier research, the pathophysiology of TgCtwh6 is mostly related to neuronal death, β-amyloid (Aβ) formation, and the secretion of inflammatory factors, which results in chronic infection and cognitive behavioral impairments in mice[8]. The majority of the mice that are affected by TgCtwh3 get acute illnesses, and all of them pass away within two weeks without developing any brain cysts[32]. However, in our country, both TgCtwh3 and TgCtwh6 cause chronic infection in the population[23]. So, do TgCtwh3 and TgCtwh6 result in the same pathogenic alterations in neurons? If true, it would be clear that T.gondii Chinese1 is a significant factor in the cognitive-behavioral alterations that have affected the Chinese people. Additionally, we are aware that ROP16 is one of the key virulence components of T. gondii[33]. It's interesting to note that ROP16 and GRA15 are both present in T. gondii of the Chinese1 genotype[21]. By using TgCtwh3 with knockdown of ROP16 and TgCtwh3 WT to infect mouse and HT22 cell lines, respectively, we can hypothesize the function of ROP16 in Toxoplasma gondii infection of neurons.

In mammals, an intermediate host, T.gondii exists mainly in two different forms, tachyzoites and bradyzoites, with tachyzoites being the rapidly replicating and pathogenic form[27]. Type I strains are equally deadly in mice regardless of the infective dose because of the host immune response and several other factors[34]. We discovered that intraperitoneal injection of various tachyzoites amounts could cause an increase in APP in all hippocampus regions of mice, and injection of 1,000 tachyzoites caused noticeably varied APP production in the two groups. As a result, we used a huge number of tachyzoites to infect mice, and every mouse in the infected groups displayed abnormal appearance and posture. In the investigations that followed, we made an effort to comprehend how TgCtwh3 ΔROP16 infection with TgCtwh3 WT infection affected the hippocampus region of the mouse brain and the function of ROP16 there.

After infecting the host, the parasite passes through the blood-brain barrier and enters the central nervous system. There, it can invade all nucleated cells, with neurons being its primary target cell type[10], and it can also activate microglia to consume astrocytes and produce inflammatory factors[35, 36]. During T.gondii infection, ROP16, a member of the rhoptry protein family of T. gondii, is a crucial virulence factor that may quickly penetrate the nucleus of cells[19, 37, 38]. Previous research has demonstrated that Toxoplasma-mediated apoptosis is crucial for the development of neurodegenerative lesions and other neuropathologic encephalitis-related processes[39]. And ROP18 can induce apoptosis in neuronal cells[40]. The hippocampal neurons in the infected group of mice were found to be arranged abnormally and to be fewer in number. Additionally, there were more abnormally deep-stained neurons in the TgCtwh3 WT group than in the TgCtwh3 ΔROP16 group, and the reduction of hippocampal neurons was more severe in the TgCtwh3 WT group than in the TgCtwh3 ΔROP16 group; Cleaved-caspase3 and Bax expression increased whereas Bcl-2 expression decreased in all three groups (Control, TgCtwh3 ΔROP16, and TgCtwh3 WT), demonstrating that apoptosis occurs in the hippocampus region of infected mice and that ROP16 triggers the development of apoptosis. Additionally, neuronal apoptosis was a factor in the decrease in the hippocampal region's neuronal population.

Additionally, in all three groups, the expression of APP and BACE1 in the hippocampus region of mice considerably increased, and Aβ plaques had partially deposited there. Additionally, we discovered that infected animals had higher levels of iNOS, TNF-α, and IL-6 expression in the hippocampus region. This shows that inflammation occurs together with an increase in Aβ in the hippocampus of infected mice.

In summary, it has been observed that neuronal loss, Aβ deposition, and neuroinflammation are significant histopathologic hallmarks of AD disease[41]. Additionally, neuronal apoptosis is a significant factor in neuron loss[42]. And our study found that TgCtwh3, like TgCtwh6, could lead to neuronal apoptosis, Aβ production, and neuroinflammation in mouse hippocampus, in which ROP16 plays an inducing and promoting role.

The endoplasmic reticulum stress-mediated apoptosis route is a recently identified apoptotic mechanism that plays a role in the development and progression of numerous diseases, including cancer, diabetes mellitus, heart disease, and neurodegenerative illnesses[43, 44]. Unfolded protein response (UPR) is the main reaction mechanism. ER stress is brought on by a buildup of unfolded and/or misfolded proteins, which then activates the UPR[45]. Immunoglobulin heavy chain-binding protein (BIP), also known as glucose-regulated protein 78 (GRP78) is thought to be the predominant chaperone protein in the ER that binds to unfolded proteins and dissociates from membrane-bound ER stress sensors, thereby inhibiting mRNA translation to protect the cell from excess unfolded proteins[46–48]. Therefore, BIP/GRP78 can maintain endoplasmic reticulum stability and normal cellular function, and when BIP/GRP78 expression is elevated it can be used as an important marker of ERS activation[49]. Additionally, it has been demonstrated that Caspase12 mediates the ERS-mediated apoptotic pathway, activates downstream apoptotic signals (such as Caspase3), and is a necessary mediator of apoptosis triggered by a variety of ER-directed pro-apoptotic signals[50]. It has been found that T.gondii virulence factor ROP18 may be involved in neuronal apoptosis through the ERS-mediated apoptotic pathway[40]. And TgCtwh3 can also induce C17.2 apoptotic phenomenon through ERS signaling pathway[51]. To investigate the apoptotic mechanism of TgCtwh3 ROP16 on hippocampal neurons, we cultured HT22 in vitro and pretreated it with endoplasmic reticulum inhibitor (Tauroursodeoxycholate, TUDCA). Our results by immunoblotting revealed that ROP16 enhanced the expression of BIP, Caspase12, and Cleaved-caspase3 in hippocampal neurons; whereas the expression pretreated with TUDCA was relatively attenuated. In summary, ROP16, a virulence component in TgCtwh3, can participate in hippocampal neuronal apoptosis through endoplasmic reticulum stress.

Previously, we have found that TgCtwh3 induces elevation of APP and BACE1 leading to Aβ production, which is promoted by its virulence factor ROP16. It has been found that cangrelor reverses Aβ1–42 induced cognitive deficits through inhibition of oxidative stress, neuroinflammation and synaptic dysfunction mediated by Nrf2/HO-1 and NF-κB signaling[52]. Other studies have shown that the p65 subunit of NF-κB binds to the κB element of the BACE1 promoter and induces the expression of β-secretase[53]. Thus the elevated expression of APP and BACE1 levels in the brains of AD patients is associated with elevated NF-κB signaling pathway[54]. In our study, when HT22 was infected with TgCtwh3 ΔROP16 and TgCtwh3 WT tachyzoites, the expression of NF-κBp65 and p-NF-κBp65 was up-regulated, while the production of BACE1 and APP was increased, which suggested that the infection of TgCtwh3 tachyzoites with HT22 could produce Aβ through the NF-κB signaling pathway, and in addition, due to the fact that the TgCtwh3 ΔROP16 group expressed less NF-κBp65, p-NF-κBp65, APP, and BACE1 than the TgCtwh3 WT group, we believe that ROP16 can induce Aβ production through the NF-κB signaling pathway. And now more and more studies have now suggested that the NF-κB signaling pathway is closely related to Aβ production in AD[52, 55, 56].

In addition, several studies have demonstrated that activation of the NF-κB signaling pathway induces the release of cytokines and chemokines from microglia, which leads to chronic inflammation in AD[57]. Therefore, we hypothesized that TgCtwh3 also leads to the secretion of inflammatory factors in the hippocampus of mice through the NF-κB signaling pathway. It has also been shown that Aβ can directly induce neuronal death[58, 59]. In our study, acute infection with T.gondii resulted in an increase of APP with BACE1 in the hippocampal region of mice, and Aβ began to be deposited. Therefore, we speculate that part of neuronal apoptosis is due to Aβ generation.

In summary, we found that TgCtwh3, like TgCtwh6, induces apoptosis of hippocampal neurons, Aβ production, and secretion of inflammatory factors in the hippocampal region of mice during the acute phase of infection. TgCtwh3 and TgCtwh6 are two representative strains of T.gondii of Chinese1 type; therefore, we believe that T.gondii of Chinese1 type is a non-negligible causative agent of cognitive-behavioral alterations (e.g., Alzheimer's disease) in our population.

AD: Alzheimer's disease; APP: Amyloid precursor protein; Aβ: Beta-amyloid; BACE1: β-secretase 1; DAPI: 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride; DMEM: Dulbecco’s modifed Eagle’s medium; FBS: Fetal bovine serum; FCM: Flow cytometry; GRA15_Ⅱ: T. gondii type Ⅱ strain Gense granule protein 15; HE: Hematoxylin and eosin; HT22: Mouse hippocampal neuronal cell line; IHC: Immunohistochemistry; IL-1β: interleukin-1β; IL-6: interleukin-6; JSH-23: 4-Methyl-N1- (3-phenylpropyl) -1,2-phenylenediamine; MCI: Mild Cognitive Impairment; MIC: micronemes; ROP16_Ⅰ/Ⅲ: T. gondii type Ⅰ/Ⅲ strain rhoptry protein 16; ΔROP16: knock out rhoptry protein16; RT-qPCR: Quantitative Real-Time PCR; SPF: Specific Pathogen Free; TgCtwh3: Toxoplasma gondii Chinese 1 genotype Wh3 strain; TgCtwh6: Toxoplasma gondii Chinese 1 genotype Wh6 strain; T.gondii: Toxoplasma gondii; Th1: type 1 helper; TNF: tumor necrosis factor; TUDCA: Tauroursodeoxycholate; WT: Wide Type

Acknowledgements

We thank the assistant of the Center for Scientific Research of Anhui Medical University.

Funding

This work was supported by the Provincial University Natural Science Research Key Project of Anhui (No. kJ2019A0222).

Availability of data and materials

All articles from which data was cited to support the conclusions of this manuscript are listed in the text and the reference.

Authors’ contributions

Deyong Chu, Kunpeng Qin and Jilong Shen designed the experiments; Di Yang, Qing Tao, Cong Wang, Lei Liu and Mengtao Gong conducted the experiments; Mengmeng Jin, Qingli Luo and Meijuan Zheng performed the test and statistical analyses; Di Yang wrote this manuscript. Deyong Chu, Jilong Shen, Jian Du, and Li Yu edited the manuscript.

All authors read and approved the final manuscript.

Ethics approval and consent to participate

Animal procedures were approved by the Institutional Review Board of the Institute of Biomedicine at Anhui Medical University (permit number: AMU26093628).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Dugger BN, Dickson DW. Pathology of Neurodegenerative Diseases. Cold Spring Harb Perspect Biol. 2017;9(7).
Zhou B, Lu JG, Siddu A, Wernig M, Sudhof TC. Synaptogenic effect of APP-Swedish mutation in familial Alzheimer's disease. Sci Transl Med. 2022;14(667):eabn9380.
Oakley H, Cole SL, Logan S, Maus E, Shao P, Craft J, et al. Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer's disease mutations: potential factors in amyloid plaque formation. J Neurosci. 2006;26(40):10129-40.
Guglielmotto M, Monteleone D, Boido M, Piras A, Giliberto L, Borghi R, et al. Abeta1-42-mediated down-regulation of Uch-L1 is dependent on NF-kappaB activation and impaired BACE1 lysosomal degradation. Aging Cell. 2012;11(5):834-44.
El Saftawy EA, Amin NM, Sabry RM, El-Anwar N, Shash RY, Elsebaie EH, et al. Can Toxoplasma gondii Pave the Road for Dementia? J Parasitol Res. 2020;2020:8859857.
Jung BK, Pyo KH, Shin KY, Hwang YS, Lim H, Lee SJ, et al. Toxoplasma gondii infection in the brain inhibits neuronal degeneration and learning and memory impairments in a murine model of Alzheimer's disease. PLoS One. 2012;7(3):e33312.
Tyebji S, Seizova S, Garnham AL, Hannan AJ, Tonkin CJ. Impaired social behaviour and molecular mediators of associated neural circuits during chronic Toxoplasma gondii infection in female mice. Brain Behav Immun. 2019;80:88-108.
Tao Q, Yang D, Qin K, Liu L, Jin M, Zhang F, et al. Studies on the mechanism of Toxoplasma gondii Chinese 1 genotype Wh6 strain causing mice abnormal cognitive behavior. Parasit Vectors. 2023;16(1):30.
Wana MN, Watanabe M, Chiroma SM, Unyah NZ, Abdullahi SA, Nordin S, et al. Toxoplasma gondii induced cognitive impairment in rats via dysregulation of dopamine receptors and indoleamine 2,3 dioxygenase. Heliyon. 2023;9(3):e14370.
Cabral CM, Tuladhar S, Dietrich HK, Nguyen E, MacDonald WR, Trivedi T, et al. Neurons are the Primary Target Cell for the Brain-Tropic Intracellular Parasite Toxoplasma gondii. PLoS Pathog. 2016;12(2):e1005447.
Tao Q, Wang X, Liu L, Ji Y, Luo Q, Du J, et al. Toxoplasma gondii Chinese I genotype Wh6 strain infection induces tau phosphorylation via activating GSK3beta and causes hippocampal neuron apoptosis. Acta Trop. 2020;210:105560.
Wang C, Zong S, Cui X, Wang X, Wu S, Wang L, et al. The effects of microglia-associated neuroinflammation on Alzheimer's disease. Front Immunol. 2023;14:1117172.
Hanzel CE, Pichet-Binette A, Pimentel LSB, Iulita MF, Allard S, Ducatenzeiler A, et al. Neuronal driven pre-plaque inflammation in a transgenic rat model of Alzheimer's disease. Neurobiol Aging. 2014;35(10):2249-62.
Femminella GD, Dani M, Wood M, Fan Z, Calsolaro V, Atkinson R, et al. Microglial activation in early Alzheimer trajectory is associated with higher gray matter volume. Neurology. 2019;92(12):E1331-E43.
Dani M, Wood M, Mizoguchi R, Fan Z, Edginton T, Hinz R, et al. Tau Aggregation Correlates with Amyloid Deposition in Both Mild Cognitive Impairment and Alzheimer's Disease Subjects. J Alzheimers Dis. 2019;70(2):453-63.
Miller CM, Boulter NR, Ikin RJ, Smith NC. The immunobiology of the innate response to Toxoplasma gondii. Int J Parasitol. 2009;39(1):23-39.
Liesenfeld O, Parvanova I, Zerrahn J, Han SJ, Heinrich F, Munoz M, et al. The IFN-gamma-inducible GTPase, Irga6, protects mice against Toxoplasma gondii but not against Plasmodium berghei and some other intracellular pathogens. PLoS One. 2011;6(6):e20568.
Cabral CM, McGovern KE, MacDonald WR, Franco J, Koshy AA. Dissecting Amyloid Beta Deposition Using Distinct Strains of the Neurotropic Parasite Toxoplasma gondii as a Novel Tool. ASN Neuro. 2017;9(4):1759091417724915.
Saeij JP, Boyle JP, Coller S, Taylor S, Sibley LD, Brooke-Powell ET, et al. Polymorphic secreted kinases are key virulence factors in toxoplasmosis. Science. 2006;314(5806):1780-3.
Taylor S, Barragan A, Su C, Fux B, Fentress SJ, Tang K, et al. A secreted serine-threonine kinase determines virulence in the eukaryotic pathogen Toxoplasma gondii. Science. 2006;314(5806):1776-80.
Cheng W, Liu F, Li M, Hu X, Chen H, Pappoe F, et al. Variation detection based on next-generation sequencing of type Chinese 1 strains of Toxoplasma gondii with different virulence from China. BMC Genomics. 2015;16:888.
Li M, Mo XW, Wang L, Chen H, Luo QL, Wen HQ, et al. Phylogeny and virulence divergency analyses of Toxoplasma gondii isolates from China. Parasite Vector. 2014;7.
Wang L, He LY, Meng DD, Chen ZW, Wen H, Fang GS, et al. Seroprevalence and genetic characterization of Toxoplasma gondii in cancer patients in Anhui Province, Eastern China. Parasit Vectors. 2015;8:162.
Saeij JP, Coller S, Boyle JP, Jerome ME, White MW, Boothroyd JC. Toxoplasma co-opts host gene expression by injection of a polymorphic kinase homologue. Nature. 2007;445(7125):324-7.
Peixoto L, Chen F, Harb OS, Davis PH, Beiting DP, Brownback CS, et al. Integrative genomic approaches highlight a family of parasite-specific kinases that regulate host responses. Cell Host Microbe. 2010;8(2):208-18.
Kochanowsky JA, Chandrasekaran S, Sanchez JR, Thomas KK, Koshy AA. ROP16-mediated activation of STAT6 enhances cyst development of type III Toxoplasma gondii in neurons. PLoS Pathog. 2023;19(4):e1011347.
An R, Tang YW, Chen LJ, Cai HJ, Lai DH, Liu K, et al. Encephalitis is mediated by ROP18 of Toxoplasma gondii, a severe pathogen in AIDS patients. P Natl Acad Sci USA. 2018;115(23):E5344-E52.
Liu Y, Wen D, Gao JQ, Xie B, Yu HL, Shen QC, et al. Methamphetamine induces GSDME-dependent cell death in hippocampal neuronal cells through the endoplasmic reticulum stress pathway. Brain Res Bull. 2020;162:73-83.
Peng D, Li J, Deng Y, Zhu X, Zhao L, Zhang Y, et al. Sodium para-aminosalicylic acid inhibits manganese-induced NLRP3 inflammasome-dependent pyroptosis by inhibiting NF-kappaB pathway activation and oxidative stress. J Neuroinflammation. 2020;17(1):343.
Xiao J, Savonenko A, Yolken RH. Strain-specific pre-existing immunity: A key to understanding the role of chronic Toxoplasma infection in cognition and Alzheimer's diseases? Neurosci Biobehav Rev. 2022;137:104660.
Parlog A, Schluter D, Dunay IR. Toxoplasma gondii-induced neuronal alterations. Parasite Immunol. 2015;37(3):159-70.
Li M, Mo XW, Wang L, Chen H, Luo QL, Wen HQ, et al. Phylogeny and virulence divergency analyses of Toxoplasma gondii isolates from China. Parasit Vectors. 2014;7:133.
Hernandez-de-Los-Rios A, Murillo-Leon M, Mantilla-Muriel LE, Arenas AF, Vargas-Montes M, Cardona N, et al. Influence of Two Major Toxoplasma Gondii Virulence Factors (ROP16 and ROP18) on the Immune Response of Peripheral Blood Mononuclear Cells to Human Toxoplasmosis Infection. Front Cell Infect Microbiol. 2019;9:413.
Dubey JP, Hotea I, Olariu TR, Jones JL, Darabus G. Epidemiological review of toxoplasmosis in humans and animals in Romania. Parasitology. 2014;141(3):311-25.
Mukhopadhyay D, Arranz-Solis D, Saeij JPJ. Influence of the Host and Parasite Strain on the Immune Response During Toxoplasma Infection. Front Cell Infect Microbiol. 2020;10:580425.
Sangare LO, Yang NH, Konstantinou EK, Lu D, Mukhopadhyay D, Young LH, et al. Toxoplasma GRA15 Activates the NF-kappa B Pathway through Interactions with TNF Receptor-Associated Factors. Mbio. 2019;10(4).
Kochanowsky JA, Thomas KK, Koshy AA. ROP16-Mediated Activation of STAT6 Suppresses Host Cell Reactive Oxygen Species Production, Facilitating Type III Toxoplasma gondii Growth and Survival. Mbio. 2021;12(2).
Chang S, Shan X, Li X, Fan W, Zhang SQ, Zhang J, et al. Toxoplasma gondii Rhoptry Protein ROP16 Mediates Partially SH-SY5Y Cells Apoptosis and Cell Cycle Arrest by Directing Ser15/37 Phosphorylation of p53. Int J Biol Sci. 2015;11(10):1215-25.
Dincel GC, Atmaca HT. Increased expressions of ADAMTS-13 and apoptosis contribute to neuropathology during Toxoplasma gondii encephalitis in mice. Neuropathology. 2016;36(3):211-26.
Wan L, Gong L, Wang W, An R, Zheng M, Jiang Z, et al. T. gondii rhoptry protein ROP18 induces apoptosis of neural cells via endoplasmic reticulum stress pathway. Parasit Vectors. 2015;8:554.
Scheltens P, De Strooper B, Kivipelto M, Holstege H, Chetelat G, Teunissen CE, et al. Alzheimer's disease. Lancet. 2021;397(10284):1577-90.
Wnuk A, Kajta M. Steroid and Xenobiotic Receptor Signalling in Apoptosis and Autophagy of the Nervous System. Int J Mol Sci. 2017;18(11).
Yang YZ, Sun M, Shan YY, Zheng XM, Ma HM, Ma WZ, et al. Endoplasmic Reticulum Stress-Mediated Apoptotic Pathway Is Involved in Corpus Luteum Regression in Rats. Reprod Sci. 2015;22(5):572-84.
Ariyasu D, Yoshida H, Hasegawa Y. Endoplasmic Reticulum (ER) Stress and Endocrine Disorders. Int J Mol Sci. 2017;18(2).
Huang R, Hui Z, Wei S, Li D, Li W, Daping W, et al. IRE1 signaling regulates chondrocyte apoptosis and death fate in the osteoarthritis. J Cell Physiol. 2022;237(1):118-27.
Liu Z, Liu G, Ha DP, Wang J, Xiong M, Lee AS. ER chaperone GRP78/BiP translocates to the nucleus under stress and acts as a transcriptional regulator. Proc Natl Acad Sci U S A. 2023;120(31):e2303448120.
Vidal CM, Ouyang C, Qi Y, Mendez-Dorantes C, Coblentz A, Alva-Ornelas JA, et al. Arginine regulates HSPA5/BiP translation through ribosome pausing in triple-negative breast cancer cells. Brit J Cancer. 2023;129(3):444-54.
Tseng CC, Zhang P, Lee AS. The COOH-Terminal Proline-Rich Region of GRP78 Is a Key Regulator of Its Cell Surface Expression and Viability of Tamoxifen-Resistant Breast Cancer Cells. Neoplasia. 2019;21(8):837-48.
Pfaffenbach KT, Lee AS. The critical role of GRP78 in physiologic and pathologic stress. Curr Opin Cell Biol. 2011;23(2):150-6.
Nakagawa T, Zhu H, Morishima N, Li E, Xu J, Yankner BA, et al. Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature. 2000;403(6765):98-103.
Zhou J, Gan X, Wang Y, Zhang X, Ding X, Chen L, et al. Toxoplasma gondii prevalent in China induce weaker apoptosis of neural stem cells C17.2 via endoplasmic reticulum stress (ERS) signaling pathways. Parasit Vectors. 2015;8:73.
Jin S, Wang X, Xiang X, Wu Y, Hu J, Li Y, et al. Inhibition of GPR17 with cangrelor improves cognitive impairment and synaptic deficits induced by Abeta(1-42) through Nrf2/HO-1 and NF-kappaB signaling pathway in mice. Int Immunopharmacol. 2021;101(Pt B):108335.
Chen CH, Zhou W, Liu S, Deng Y, Cai F, Tone M, et al. Increased NF-kappaB signalling up-regulates BACE1 expression and its therapeutic potential in Alzheimer's disease. Int J Neuropsychopharmacol. 2012;15(1):77-90.
Sun E, Motolani A, Campos L, Lu T. The Pivotal Role of NF-kB in the Pathogenesis and Therapeutics of Alzheimer's Disease. Int J Mol Sci. 2022;23(16).
Thawkar BS, Kaur G. Inhibitors of NF-kappaB and P2X7/NLRP3/Caspase 1 pathway in microglia: Novel therapeutic opportunities in neuroinflammation induced early-stage Alzheimer's disease. J Neuroimmunol. 2019;326:62-74.
Jin X, Liu MY, Zhang DF, Zhong X, Du K, Qian P, et al. Baicalin mitigates cognitive impairment and protects neurons from microglia-mediated neuroinflammation via suppressing NLRP3 inflammasomes and TLR4/NF-kappaB signaling pathway. CNS Neurosci Ther. 2019;25(5):575-90.
Chiarini A, Armato U, Hu P, Dal Pra I. Danger-Sensing/Patten Recognition Receptors and Neuroinflammation in Alzheimer's Disease. Int J Mol Sci. 2020;21(23).
Lee SY, Lee JW, Lee H, Yoo HS, Yun YP, Oh KW, et al. Inhibitory effect of green tea extract on beta-amyloid-induced PC12 cell death by inhibition of the activation of NF-kappaB and ERK/p38 MAP kinase pathway through antioxidant mechanisms. Brain Res Mol Brain Res. 2005;140(1-2):45-54.
Kaltschmidt B, Uherek M, Wellmann H, Volk B, Kaltschmidt C. Inhibition of NF-kappaB potentiates amyloid beta-mediated neuronal apoptosis. Proc Natl Acad Sci U S A. 1999;96(16):9409-14.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

WITHDRAWN: Effects of TgCtwh3 Toxoplasma gondii ROP16 on neuronal apoptosis and β-amyloid production

Status:

Version 1

Editorial Note

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials AND Methods

2.1 Antibodies and Materials

2.2 Animals

2.3 T.gondii and cell culture

2.4 Hematoxylin and eosin (HE) Staining

2.5 Nissl Staining

2.6 Thioflavin S plaque Staining

2.7 Immunofluorescence Staining

2.8 Western Blotting

2.9 Quantitative Real-Time PCR (RT-qPCR)

2.10 Flow cytometry

3 Statistical Analysis

Results

4.1 Establishment of the mouse infection model

4.2 TgCtwh3 ROP16 induces apoptosis in mouse hippocampal neurons

4.3 TgCtwh3 ROP16 induces Aβ-related proteins expression elevated in mouse hippocampus

4.4 TgCtwh3 ROP16 promotes secretion of inflammatory factors in mouse hippocampal tissue

4.5 Infection with TgCtwh3 tachyzoites induces apoptosis in HT22 cells and ROP16 is pro-apoptotic

4.6 TgCtwh3 ROP16 promotes APP and BACE1 expression in HT22

4.7 TgCtwh3 ROP16 promotes HT22 cell apoptosis through the ERS pathway

4.8 TgCtwh3 ROP16 promotes Aβ-related protein production in HT22 cells through the NF-κB signaling pathway

Discussions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1