Oxidative damage and cell cycle delay induced by vanadium(III) in human cells

doi:10.21203/rs.3.rs-3471901/v1

Download PDF

Research Article

Oxidative damage and cell cycle delay induced by vanadium(III) in human cells

https://doi.org/10.21203/rs.3.rs-3471901/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Vanadium (V) is a metal that can enter the environment through natural routes or anthropogenic activity. In the atmosphere, V is present as V oxides, among which vanadium(III) oxide (V₂O₃) stands out. Cytogenetic studies show that V₂O₃ is genotoxic and cytostatic and induces DNA damage; however, the molecular mechanisms leading to these effects have not been fully explored. Therefore, we used human peripheral blood lymphocytes treated in vitro and evaluated the effects of V₂O₃ on the phases of the cell cycle, the expression of molecules that control the cell cycle and detect DNA damage, and the induction of oxidative stress. The results reveal that V₂O₃ does not produce changes in cell viability at the concentrations (2, 4, 8 or 16 µg/mL) and exposure time (24 h) used. However, V₂O₃ modifies the percentage of G₁ and S phase cells in the cell cycle, decreases the expression of mRNA in their respective proteins (cyclin D, cyclin E, cdk2 and cdk4) and increases the expression of γH2AX and the levels of reactive oxygen species. The ability of V₂O₃ to cause cell cycle delay in G₁-S phase may be associated with a decrease in mRNA cyclin-cdk and its proteins and with intracellular oxidative stress, which may cause DNA double-strand damage and H2AX phosphorylation.

human lymphocytes

proteins

mRNA

cyclins and cdk

γH2AX

DNA damage.

Vanadium (V) is a transition metal found in nature in approximately 65 minerals; it ranks fifth among the most abundant metals in the earth's crust and first in the ocean (Bai et al. 2021). V has various oxidation states, and its + 3, +4, and + 5 oxides are an environmental problem. It is estimated that 130,000 to 260,000 tons of V are released per year, including approximately 65,000 tons from forest fires, volcanic eruptions and mineral erosion; the remainder of V is of anthropogenic origin (Gustafsson 2019). The main sources of emissions are the burning of fossil fuels, as well as metallurgical mining, chemical, agricultural, energy and other industrial activities (Ścibior and Kurus 2019; Wiklund et al. 2020; Bai et al. 2021). The chemical species released into the environment include vanadium oxides, among which vanadium(V) oxide as pentoxide is the most abundant (V₂O₅), followed by oxides in oxidation states IV and III, V₂O₄ and V₂O_3, respectively (Pavageau et al. 2004; Mjejri et al. 2017). In recent years, some companies have attempted to reduce V₂O₅ emissions, as V₂O₅ is corrosive to the metal parts of machinery and causes other oxides to be released (such as V₂O₃), by manufacturing catalysts that prevent the formation of V₂O₅ (Martin et al. 2020; Hu et al. 2023). The effects of occupational and environmental exposure to V are well documented, and environmental exposures can cause respiratory distress, organ damage, and possibly death (Assem and Levy 2012; Fortoul et al. 2014).

Previous studies have investigated the in vitro and in vivo toxic effects of vanadium oxides, and V₂O₅ is among the most studied because vanadium (V) is the most toxic vanadium oxides to mammals (Altamirano-Lozano et al. 2014; Mateos-Nava et al. 2021; Montiel-Flores et al. 2021; López-Valdez et al. 2022; Álvarez-Barrera et al. 2022, 2023). However, the intensity of toxicity depends on the oxidation state of the metal, each oxide exerts its own effects, and little is known about vanadium(III). Cytogenetic assays show that V₂O₃ is cytotoxic and genotoxic; the metal decreases the mitotic index and the cell proliferation index, increases the frequency of numerical chromosome aberrations and premature centromere separation, increases sister chromatid exchanges, and produces single strand breaks in DNA (Owusu-Yaw 1990; Rodríguez-Mercado et al. 2010, 2011; Mateos-Nava et al. 2017; Álvarez-Barrera et al. 2023). The results of chromosomal damage are inconclusive; in Chinese hamster ovary and bone marrow of mice cells, structural chromosomal aberrations are increased (Owusu-Yaw 1990; Álvarez-Barrera et al. 2023), but in human lymphocyte cultures, this effect is not observed (Rodríguez-Mercado et al. 2010; Mateos-Nava et al. 2017).

DNA damage is known to activate several cellular responses through complex protein networks, including cell cycle control and DNA repair proteins (Ciccia and Elledge 2010). Single- and double-strand breaks in DNA are detected by proteins such as ATR (ataxia-telangiectasia mutated Rad3-related) and ATM (ataxia-telangiectasia mutated); both signaling pathways converge on the phosphorylation of histone H2AX (Tanaka et al. 2006; Maréchal and Zou 2013), and H2AX expression provides an indicator of DNA damage due to xenobiotic exposure (Tanaka et al. 2006; Meier et al. 2007; Savic et al. 2009). γH2AX recruits Brca1 and 53BP1 (p53) (Meerang et al. 2011; Mattiroli et al. 2012), the latter of which is responsible for cell cycle sensing, to repair DNA damage (cell survival) or to activate cell death signals, such as apoptosis (Hafner et al. 2019). V₂O₃ induces genotoxicity; however, DNA damage sensor proteins, such as p53, do not show changes (Mateos-Nava et al. 2021), so the damage may be sensed by other proteins, such as γH2AX. Therefore, in the current study, we focused on the effects of vanadium(III) oxide on the cell cycle; the expression of both mRNAs to generate their respective proteins, which control the cell cycle; the expression of the DNA damage sensor protein (γH2AX); and the assessment of oxidative stress in human peripheral blood cells in vitro.

Reagents

The following reagents were used for the development of the protocols: vanadium(III) oxide (V₂O₃, CAS 1314-34-7 with 99.99% purity), which was macerated and dissolved in distilled water, Histopaque®-1077, 5(6)-carboxyfluoroscein diacetate mixed isomers (CFDA), ethidium bromide (BE), phosphate buffered saline (PBS) and propidium iodide from Sigma‒Aldrich, Inc., MO, USA. PB-MAXTM Karyotyping Medium from GIBCO BRL-Invitrogen Corporation, NY USA. Acrylamide, N,N ́-methylene-bis-acrylamide, glycine, sodium dodecylsulfate (SDS), `N,`N,`N,`N,`N-tetra-methyl-ethylenediamine (TEMED), tris hydroxymethyl-aminomethane (Tris), ammonium persulfate, and the Bio-Rad Protein Assay were obtained from Bio-Rad Laboratories, CA USA.

Protease inhibitors aprotinin, leupeptin, anti-cyclin D (sc-246), anti-cyclin E (sc-248), anti-Cdk 2 (sc- 6248), anti-Cdk 4 (sc-53636) primary antibodies, anti-actin (sc-8432), anti-γH2AX (sc-517348), horseradish peroxidase-conjugated secondary antibody m-IgGk BP-HRP (sc-516102), goat anti-mouse IgG-HRP), Tween-20, Western blotting Luminol Reagent sc-2048 and dihydrorhodamine 123 (sc-203027) were obtained from Santa Cruz Biotechnology, Inc., CA USA. Ethylenediaminetetraacetic acid (EDTA) was obtained from BD Diagnostics Mexico. TRIzol Reagent, ReverAid First Strand cDNA (K-1622) and Maxima SYBR Green/ROX qPCR Master Mix (K-0221) were obtained from Thermo Fisher Scientific, MA, USA.

Lymphocyte cultures and treatments

Peripheral blood samples were collected from three volunteers by the Vacutainer® system. Lymphocytes were isolated with Histopaque®-1077 and incubated at 1x10⁷ in 5 mL of culture medium for 48 h at 37°C. Twenty-four h after culture initiation, V₂O₃ treatments were administered at concentrations of 2, 4, 8 or 16 µg/mL and left in incubation for 24 h; an untreated group (0 µg/mL) was counted. Concentrations were selected according to previous reports. The procedures involving human volunteers adhered to the guidelines of the Helsinki and Tokyo declarations and were approved by the Committee of Ethics and Biosecurity of the FES-Zaragoza, UNAM (registration number FESZ-CE/21-118-01).

Viability

Cell viability was assessed at the beginning and end of the exposure time to V₂O₃ using dual staining with fluorochromes (0.125 µg/µL CFDA and 0.025 µg/µL BE). Ten microliters of the cell sample was placed in 10 µL of the fluorochrome mixture (1:1) and incubated for 15 min. Subsequently, under a fluorescence microscope (Nikon HFX-DX Optiphot-2 with Filter G-2A), 100 cells per culture were sorted by separating viable cells (emitting green fluorescence) from nonviable cells (nuclei fluorescing red).

Cell cycle analysis of DNA content

After 24 h of exposure to V₂O₃ concentrations, the DNA content in the different phases of the cell cycle was analyzed by flow cytometry. Cells were fixed, permeabilized and incubated in staining solution (0.1% Triton X-100/PBS, 200 µg/mL RNase A and 50 µg/mL propidium iodide). A total of 1x10⁴ cells were acquired on a BD FACSAriaTM II cytometer (Becton Dickinson and Company, CA USA.) and histograms were constructed using WinMDI 2.9 software developed by Joseph Trotter. Estimation of the number of nuclei in each phase of the cell cycle (G₁, S and G₂/M) was performed using the free software Cylchred developed by T. Hoy, Cardiff University.

Analysis of protein expression levels

At the end of the treatments, proteins were obtained by lysing the cells with RIPA buffer (150 mM NaCl, 5 mM EDTA, 1% Nonidet P-40, 0.1% SDS, 1 mM DTT, 1 mM NaVO₄, 1 mM Na₂HPO₄, 5 mM Na₂HPO₄ and 10 mM NaH₂PO₄) and protease inhibitors. Protein concentration was determined using the Bio-Rad Protein Assay reagent.

Subsequently, the proteins were separated by 12% polyacrylamide gel electrophoresis (SDS‒PAGE) by applying a constant current of 100 V, transferred to a Bio-Rad PVDF membrane by electroblotting with a constant current of 145 mA, blocked with 5% TBST fat-free milk powder (0.05% Tween 20 in Tris-buffered saline) and then incubated overnight at 4°C with one of the following primary antibodies: anti-cyclin D, anti-cyclin E, anti-Cdk 4, anti-Cdk 2, anti-γH2AX and anti-actin (the latter as a loading marker).

The membrane was incubated with the secondary antibody for 90 min, washed and subsequently incubated with luminol Western reagent. Proteins of interest were visualized as bands. The relative intensity of the proteins was assessed using ImageJ 1.45 s software (NIH, USA, available at http://rsb.info.nih.gov/ij).

RNA extraction and cDNA synthesis

Total RNA was isolated from 1x10⁷ cells by the standard TRIzol extraction method and recovered in 40 µL of molecular biology grade water, and then its purity and quantity were determined with a biophotometer (Eppendorf AG 22331); in addition, the integrity of the total RNA was determined by horizontal agarose gel electrophoresis (1%).

RNA samples were reverse transcribed into cDNA in a total volume of 20 µl using 5 µl total RNA, 1 µl oligo primer (dT) and RevertAid First Strand cDNA Synthesis kit containing 5X reagent buffer, RNAsa inhibitor, dNTPs and RevertAid M-MuLV RT, following the supplier's instructions. The reaction was carried out at 42°C for 60 min and finally for 5 min at 70°C. Subsequently, the reaction tubes containing the reverse transcription (RT) preparations were cooled in an ice chamber for PCR amplification of the cDNA.

Polymerase chain reaction (PCR)

Specific primer sequences and product sizes are listed in Table 1. GAPDH was used as a constitutive gene to normalize the expression levels of the target genes. The reaction mixture for RT‒PCR (10 mM dNTPs, 50 mM MgCl₂, 10x PCR buffer (50 mM KCl, 20 mM Tris-HCl at pH 8.3) and RNase-free water) was placed in a thermal cycler with the following conditions: 95°C for 120 s, 95°C for 15 s, 64°C for 30 s, 72°C for 60 s. The last three steps were repeated for 30 cycles and 72°C for 5 min. The PCR products were loaded onto an agarose gel (1%) together with the GAPDH-derived PCR products from the different samples. With the help of the Bio-Rad program of the ChemiDoc™ kit, the relative intensity of gene expression was obtained.

Assessment of reactive oxygen species (ROS)

Dihydrorhodamine 123 (DHR) dye was used to assess the level of intracellular ROS in the form of hydrogen peroxide (H₂O₂). Cells were incubated with 10 µM DHR for 30 min in the dark at 37°C, and excess dye was removed with PBS. Samples were read by flow cytometry (BD FACSAria II from BDBiosciences^®) to acquire 2X104 cells at 505 nm excitation and 529 nm emission, and analyses were performed on a Floreada.io. (2022) (https://floreada.io/).

Statistical analyses

The data obtained were analyzed using Prism 9.0.1 software for Mac and are presented as the mean ± standard deviation (SD) of three independent experiments performed in duplicate (n = 6). To determine the significant differences between the treated and untreated groups, ANOVA was applied with Tukey's (equal variances) or Dunnett’s (different variances) post hoc test; p < 0.05 or p < 0.01 was considered a significant value.

Cell viability

The different treatments with V₂O₃ did not modify the viability of lymphocytes (Table 2). In untreated cultures, it was higher than 97%, while in treated cultures, it was higher than 95%.

Cell cycle

With respect to the analysis of DNA content to determine the different phases of the cell cycle, we observed a trend in which the percentage of cells in the G₁ phase decreased while the proportion of cells in S phase increased, mainly in cultures treated with 8 and 16 μg/mL V₂O₃. (45.57 ± 9.26 G₁ phase of group controls vs. 33.08 ± 2.98 and 34.27 ± 10.23 in the concentrations of 8 or 16 μg/mL vanadium, respectively). Although these results are not statistically significant, we consider that there is cell cycle delay in the G₁ to S transition (Figure 1).

Proteins

Data on protein expression levels show that exposure of lymphocytes to V₂O₃ decreases the relative intensity of cyclin and Cdk. In relation to cyclins, differences were observed at a concentration of 16 μg/mL for cyclin D and at 8 and 16 μg/mL vanadium(III) for cyclin E, while for Cdk2 and Cdk4, a decrease was observed at various concentrations (Figure 2).

mRNA

On the other hand, the mRNA expression levels of CYCLIN D remained unchanged; however, a decrease in PCR products for CYCLIN E was observed at low concentrations (2 and 4 μg/mL) and a significant decrease was observed at various concentrations for CDK4 (8 and 16 μg/mL) and CDK2 (2, 8 and 16 μg/mL) (Figure 3).

DNA damage sensor protein g-H2AX

Regarding the results obtained for the expression levels of g-H2AX, a concentration-related increase was observed, with significant differences in the concentrations of 8 and 16 μg/mL V₂O₃ (Figure 4).

ROS

The induction of DHR oxidation was obtained by FSC/SSC dot plots, in which V₂O₃ treatments increased the fluorescence intensity at all concentrations, with significant differences at 2 and 4 μg/mL (Figure 5). Although significant differences were not observed for some concentrations, the increase was 0.6-fold in all treatments with respect to the control; therefore, this increase is important enough to discuss.

Cell viability

The viability test with CFDA-BE is an indicator of metabolic activity and death due to cell membrane damage. Treatments with V₂O₃ did not change the percentage of viable lymphocytes after 24 h of treatment, and the results correspond with previous reports for this compound (Mateos-Nava et al. 2017, 2021) and for other vanadium oxides (Rojas et al. 1996; Rodríguez-Mercado et al. 2011). However, V and its compounds are known to induce cell toxicity at concentrations ≥ 200 µM and exposure times of 48 h or more (Ray et al. 2006; Fu et al. 2008).

Cell cycle

Vanadium oxides are cytostatic as they reduce the proportion of cells entering mitosis and decrease the number of times a cell divides (Roldán and Altamirano 1990; Rodríguez-Mercado 2003, 2010). Cytogenetic studies of human lymphocyte cultures have shown that V₂O₃ increases the average generation time by 26 to 32 h (Mateos-Nava et al. 2017), indicating disturbances in cell cycle progression. In this study, we found a decrease in the G₁ phase and an increase in the S phase of the cell cycle. Although our results are not statistically significant, physiological delays in the transition from G₁ to S were observed, which may be related to the decrease in the expression of proteins that control the progression from one phase to the next. Previous reports support our results, in which V salts have been found to induce delays in the G₁/S transition, in S, and in G₂/M in different human cell lines, such as C141, MCF7, EC109, and AsPC-1 (Zhang et al. 2002, 2004; Ray et al. 2006; Yang et al. 2016; Wu et al. 2016).

Expression levels of mRNA and proteins

Cell cycle progression depends on the association of cyclin/cdk. The cyclin D/cdk4 complex is necessary for the cell to exit G₀ phase, while the cyclin E/cdk2 complex keeps pRb phosphorylated and allows the cell to complete the G₁ phase and enter S phase (Blomen and Boonstra 2007). In this study, the mRNA and protein expression levels of cyclin D, cyclin E, cdk2 and cdk4 decreased upon administration of V₂O₃; as a result, the cycle is momentarily arrested by lymphocytes as the protein expression levels needed to form cycling/cdk complexes is not reached.

V compounds have been shown to modify the expression levels of some RNAs (Ingram et al. 2007), as well as cycling and cdk proteins involved in cell cycle regulation (Fu et al. 2008; Yang et al. 2016; Xi et al. 2021; Mateos-Nava et al. 2021). V compounds have been shown to inhibit mRNA synthesis by reacting with nucleotides; in addition, they activate protein phosphatases, kinases, or enzymes involved in the degradation of these polymers (Macara 1980; Williams et al. 1993; Williams et al. 1996), which can subsequently lead to decreased expression of RNAs as gene products. Notably, the delay we observed may also be related to vanadium(III)-induced DNA damage, as cells that incur damage stop their cycle to repair DNA lesions.

γH2AX as a DNA damage sensor

γH2AX is a sensor of the DNA damage response and is indicative of double strand breaks. Our results show that the relative intensity of γH2AX increases. V₂O₃ induces single strand breaks in DNA (Rodríguez-Mercado et al. 2011) and chromosomal damage (Owusu-Yaw 1990; Álvarez-Barrera et al. 2023), an effect that has been observed with other V compounds (VCl₃, V₂O₄ and V₂O₅) (Rojas et al. 1996; Caicedo et al. 2007; Rodríguez-Mercado et al. 2003, 2011). Double strand breaks in DNA are the most damaging effects to the cell because they are related to the formation of structural chromosomal aberrations (Rodríguez-Mercado et al. 2010), and vanadium(IV) has been demonstrated to induce this type of damage in human lymphocytes (Rodríguez-Mercado et al. 2003, 2011). V₂O₃ treatments induce H2AX phosphorylation, revealing that this chemical species can induce double-chain injury, directly or indirectly (by intracellularly changing the oxidation state from III to IV).

γH2AX regulates repair pathways such as p53, which is responsible for cell cycle arrest among other functions; however, V₂O₃ does not modify p53 expression levels and does modify H2AX phosphorylation. Therefore, this alternative pathway may be responsible for the cell cycle delays observed by V₂O₃ treatments.

ROS levels

In addition, vanadium(III) oxide in lymphocyte cultures increases oxidative stress. DNA damage is linked to ROS, V^V has been shown to promote the production of H₂O₂ (Ngwa et al. 2009; Zwolak 2020) and V^III the formation of radicals, such as ·OH (Lloyd et al. 1998; Du y Espenson et al. 2005; Fickl et al. 2006), which can lead to the oxidation of nitrogenous bases. As previously determined, when multiple lesions occur continuously on both strands of DNA, double-strand breaks can occur in this molecule (Lloyd et al. 1998; Sharma et al. 2016). Although increased H₂O₂ was observed in this work, H₂O₂ cannot directly damage DNA; the products of H₂O₂ are the causative agents, such as ·OH, which may be generated through reacting H₂O₂ with V₂O₃ (V^III + H₂O₂ → VO²⁺ + ·OH + H⁺ or 2V^III + H₂O₂ → 2VO²⁺ + 2H⁺). In this reaction, VO²⁺ (V^IV) can enter the redox, Fenton or Haber-Weiss reactions and enhance the effects (Du y Espenson 2005; Soriano-Agueda et al. 2016; Ścibior and Kurus 2019; He et al. 2022).

Finally, in this work, we found that V₂O₃ does not modify cell viability; however, it delays the cell cycle in G₁-S phase. This delay is associated with a decrease in mRNA cyclin-cdk as their respective protein in addition to intracellular oxidative stress, which may cause DNA double-strand damage and H2AX phosphorylation. These effects may explain the induction of chromosome damage observed in other experimental models. Further studies are needed to specify the type of DNA damage, elucidate the pathway that detects DNA damage, and identify the repair mechanisms induced by V₂O₃.

ACKNOWLEDGEMENTS

Alcántara-Mejía thanks Posgrado en Ciencias Biológicas, UNAM, and to the scholarship CONAHCYT-927419, this paper is of the requirements for obtaining a Doctoral degree at the Posgrado en Ciencias Biológicas, UNAM.

FUNDING DECLARATION

This wok was supported by Universidad Nacional Autónoma de México project PAPIIT IN229220 and IN210324.

CONFLICT OF INTEREST

The authors have declared that they have is no conflict of interest.

AUTHOR CONTRIBUTION DECLARATION IN THE MANUSCRIPT.

Conceived and designed the experiments; Alcántara-Mejía, V.A., Altamirano-Lozano, M.A. and Rodríguez-Mercado, J.J.

Performed the experiments; Alcántara-Mejía, V.A., Mateos-Nava, R.A. and Álvarez-Barrera, L.

Analyzed and interpreted the data; Alcántara-Mejía, V.A., Mateos-Nava, R.A., Santiago-Osorio, E., Bonilla-González, E. and Rodríguez-Mercado J. J.

Contributed reagents, materials, analysis tools or data; Álvarez-Barrera, L., Santiago-Osorio, E., Bonilla-González, E., Altamirano-Lozano, M.A. and Rodríguez-Mercado J.J.

Wrote the paper; Alcántara-Mejía, V.A. and Rodríguez-Mercado J. J.

Altamirano-Lozano MA, Alvarez-Barrera L, Mateos-Nava RA, Fortoul TI, Rodriguez-Mercado JJ (2014) Potential for genotoxic and reprotoxic effects of vanadium compounds due to occupational and environmental exposures: An article based on a presentation at the 8th International Symposium on Vanadium Chemistry, Biological Chemistry, and Toxicology, Washington DC, August 15–18, 2012. J Immunotoxicol 11:19–27.
Álvarez‐Barrera L, Rodríguez‐Mercado JJ, Mateos‐Nava RA, Ocampo‐Aguilera NA, Altamirano‐Lozano MA (2022) Vanadium (IV) oxide affects embryonic development in mice. Environ Toxicol 37:1587–1596.
Álvarez-Barrera L, Rodríguez-Mercado JJ, Mateos-Nava RA, Acosta-San Juan A, Altamirano-Lozano MA (2023) Cytogenetic damage by vanadium (IV) and vanadium (III) on the bone marrow of mice. Drug Chem Toxicol 1–8.
Assem FL, Levy LS (2012) Inhalation Toxicity of Vanadium. In: Michibata, H. (eds) Vanadium. Springer, Dordrecht, pp, 209–224.
Bai X, Luo L, Tian H, Liu S, Hao Y, Zhao S, Lin S, Zhu C, Guo Z, Lv Y (2021) Atmospheric vanadium emission inventory from both anthropogenic and natural sources in China. Environ Sci 55:11568–11578.
Blomen VA, Boonstra J (2007) Cell fate determination during G₁ phase progression. Cell Mol Life Sci 64:3084–3104.
Caicedo M, Jacobs JJ, Reddy A, Hallab NJ (2007) Analysis of metal ion- induced DNA damage, apoptosis, and necrosis in human (Jurkat) T-cells demonstrates Ni²⁺ and V³⁺ are more toxic than other metals: Al³⁺, Be²⁺, Co²⁺, Cr³⁺, Cu²⁺, Fe³⁺, Mo⁵⁺, Nb⁵⁺, Zr²⁺. J Biomed Mater Res A 86:905–913.
Ciccia A, Elledge SJ (2010) The DNA damage response: Making it safe to play with knives. Mol Cell 40:179–204.
Du G, Espenson JH (2005) Oxidation of vanadium(III) by hydrogen peroxide and the oxomonoperoxo vanadium(V) ion in acidic solutions: a kinetics and simulation study. Inorg Chem. 44:5514–5522.
Fickl H, Theron AJ, Grimmer H, Oommen J, Ramafi GJ, Steel HC, Visser SS, Anderson R (2006) Vanadium promotes hydroxyl radical formation by activated human neutrophils. Free Radic Biol Med 40:146–155.
Fortoul TI, Rojas-Lemus M, Rodriguez-Lara V, Gonzalez-Villalva A, Ustarroz-Cano M, Cano-Gutierrez G, Altamirano-Lozano M (2014) Overview of environmental and occupational vanadium exposure and associated health outcomes: an article based on a presentation at the 8th International Symposium on Vanadium Chemistry, Biological Chemistry, and Toxicology, Washington DC, August 15–18, 2012. J Immunotoxicol 11:13–18.
Fu Y, Wang Q, Yang XG, Yang XD, Wang K (2008) Vanadyl bisacetylacetonate induced G1/S cell cycle arrest via high-intensity ERK phosphorylation in HepG2 cells. J Biol Inorg Chem. 13:1001–1009.
Gustafsson JP (2019) Vanadium geochemistry in the biogeosphere –speciation, solid-solution interactions, and ecotoxicity. Appl Geochem 102:1–25.
Hafner A, Bulyk ML, Jambhekar A, Lahav G (2019) The multiple mechanisms that regulate p53 activity and cell fate. Nat Rev Mol Cell Biol 20:199–210.
He X, Jarrell ZR, Liang Y, Smith MR, Or ML, Marts L, Jones DP (2022) Vanadium pentoxide induced oxidative stress and cellular senescence in human lung fibroblasts. Redox Biol 55:1–12.
Hu P, Hu P, Vu TD, Li M, Wang S, Ke Y, Zheng X, Mai L, Long Y (2023) Vanadium Oxide: Phase Diagrams, Structures, Synthesis, and Applications. Chem Rev 123:4353–4415.
Ingram JL, Antao-Menezes A, Turpin EA, Wallace DG, Mangum JB, Pluta LJ, Thomas RS, Bonner JC (2007) Genomic analysis of human lung fibroblasts exposed to vanadium pentoxide to identify candidate genes for occupational bronchitis. Resp Res 8:1–13.
Lloyd DR, Carmichael PL, Phillips DH (1998) Comparison of the formation of 8-hydroxy-2 ‘-deoxyguanosine and single-and double-strand breaks in DNA mediated by fenton reactions. Chem Res Toxicol 11:420–427.
López-Valdez N, Rojas-Lemus M, Bizarro-Nevares MP, González-Villalva AE, Ustarroz-Cano ML, Casarrubias-Tabarez B, Guerrero-Palomo G, Cervantes-Valencia ME, Rivera-Fernández N, Fortoul TI (2023) Sex differences in vanadium inhalation effects in non-ciliated bronchiolar cells. Histol Histopathol 38:765–777.
Macara IG (1980) Vanadium an element in search of a role. TIBS 5:92–94.
Maréchal A, Zou L (2013) DNA damage sensing by the ATM and ATR kinases. Cold Spring Harb Perspect Biol 5:1–18.
Martin J, Schafner K, Turek T (2020) Preparation of electrolyte for vanadium redox‐flow batteries based on vanadium pentoxide. Energy Technol 8:1–10.
Mateos-Nava RA, Rodríguez-Mercado JJ, Altamirano-Lozano MA (2017) Premature chromatid separation and altered proliferation of human leukocytes treated with vanadium (III) oxide. Drug. Chem Toxicol 40:457–462.
Mateos-Nava RA, Rodríguez-Mercado JJ, Álvarez-Barrera L, García-Rodríguez MC, Altamirano-Lozano MA (2021) Vanadium oxides modify the expression levels of the p21, p53, and Cdc25C proteins in human lymphocytes treated in vitro. Environ Toxicol 29:1–8.
Mattiroli F, Vissers JH, van Dijk WJ, Ikpa P, Citterio E, Vermeulen W, Marteijn JA, Sixma TK (2012) RNF168 ubiquitinates K13-15 on H2A/H2AX to drive DNA damage signaling. Cell 150:1182–1195.
Meerang M, Ritz D, Paliwal S, Garajova Z, Bosshard M, Mailand N, Janscak P, Hubscher U, Meyer H, Ramadan K (2011) The ubiquitin-selective segregase VCP/p97 orchestrates the response to DNA double-strand breaks. Nat Cell Biol 13:1376–1382.
Meier A, Fiegler H, Munoz P, Ellis P, Rigler D, Langford C, Blasco MA, Carter N, Jackson SP (2007) Spreading of mammalian DNA-damage response factors studied by ChIP-chip at damaged telomeres. EMBO J 26:2707–2718.
Mjejri I, Rougier A, Gaudon M (2017) Low-cost and facile synthesis of the vanadium oxides V₂O₃, VO₂, and V₂O₅ and their magnetic, thermochromic and electrochromic properties. Inorg Chem 56:1734–1741.
Montiel-Flores E, Mejía-García OA, Ordoñez-Librado JL, Gutierrez-Valdez AL, Espinosa-Villanueva J, Dorado-Martínez C, Reynoso-Erazo L, Tron-Alvarez R, Rodríguez-Lara V, Avila-Costa MR (2021) Alzheimer-like cell death after vanadium pentoxide inhalation. Heliyon 7:1–5.
Ngwa HA, Kanthasamy A, Anantharam V, Song C, Witte T, Houk R, Kanthasamy AG (2009) Vanadium induces dopaminergic neurotoxicity via protein kinase Cdelta dependent oxidative signaling mechanisms: Relevance to etiopathogenesis of Parkinson's disease. Toxicol Appl Pharma 240:273–285.
Owusu-Yaw J, Cohen MD, Fernando SY, Wei CI (1990) An assessment of the genotoxicity of vanadium. Toxicol Lett 50:327–336.
Pavageau MP, Morin A, Seby F, Guimon C, Krupp E, Pécheyran C, Poulleau J, Donard OF (2004) Partitioning of metal species during an enriched fuel combustion experiment. speciation in the gaseous and particulate phases. Environ Sci Technol 38:2252–2263.
Ray RS, Rana B, Swami B, Venu V, Chatterjee M (2006) Vanadium mediated apoptosis and cell cycle arrest in MCF7 cell line. Chem Biol Interact 163:239–247.
Rodríguez-Mercado JJ, Roldán-Reyes E, Altamirano-Lozano M (2003) Genotoxic effects of vanadium (IV) in human peripheral blood cells. Toxicol Lett 144:359–369.
Rodríguez-Mercado JJ, Álvarez-Barrera L, Altamirano-Lozano MA (2010) Chromosomal damage induced by vanadium oxides in human peripheral lymphocytes. Drug Chem Toxicol 33:97–102.
Rodríguez-Mercado JJ, Mateos-Nava RA, Altamirano-Lozano MA (2011) DNA damage induction in human cells exposed to vanadium oxides in vitro. Toxicol Vitro 25:1996–2002.
Rojas E, Valverde M, Herrera LA, Altamirano-Lozano M, Ostrosky-Wegman P (1996) Genotoxicity of vanadium pentoxide evaluate by the single cell gel electrophoresis assay in human lymphocytes. Mutat Res 359:77–84.
Roldán E, Altamirano M (1990) Chromosomal aberrations, sister chromatid exchanges, cell-cycle kinetics and satellite association in human lymphocytes culture exposed to vanadium pentoxide. Mutat Res 245:61-65.
Savic V, Yin B, Maas NL, Bredemeyer AL, Carpenter AC, Helmink BA, Yang-Lott KS, Sleckman BP, Bassing CH (2009) Formation of dynamic g- H2AX domains along broken DNA strands is distinctly regulated by ATM and MDC1 and dependent upon H2AX densities in chromatin. Mol Cell 34:298–310.
Ścibior A, Kurus J (2019) Vanadium and oxidative stress markers - in vivo model: a review. Curr Med Chem 26:5456–5500.
Sharma RP, Flora JS, Drown DB, Oberg SG (1987) Persistence of vanadium compounds in lungs after intracheal instillation in rats. Toxicol Ind Health 3:321–329.
Soriano-Agueda LA, Ortega-Moo C, Garza J, Guevara-Garcia JA, Vargas R (2016) Formation of reactive oxygen species by vanadium complexes. Comput Theor Chem. 1077:99–105.
Tanaka T, Huang X, Halicka HD, Zhao H, Traganos F, Albino AP, Dai W, Darzynkiewicz Z. (2007) Cytometry of ATM activation and histone H2AX phosphorylation to estimate extent of DNA damage induced by exogenous agents. J Int Soc Anal Cytol 71:648–661.
Wiklund JA, Kirk JL, Muir DC, Gleason A, Carrier J, Yang F (2020) Atmospheric trace metal deposition to remote Northwest Ontario, Canada: Anthropogenic fluxes and inventories from 1860 to 2010. Sci Total Environ 749:1–20.
Williams P, Etcheverry S, Baran E (1993) Über die Wechselwirkung des Vanadyl(IV)-Kations mit Nucleobasen / Interaction of the Vanadyl(IV) Cation with Nucleic Bases. Zeitschrift für Naturforschung B 48:1845–1847.
Williams PAM, Etcheverry SB, Baran EJ (1996) A spectrophotometric study of the interaction of VO2+ with cytosine in nucleotides. J Inorg Biochem1:285–289.
Wu JX, Hong YH, Yang XG (2016) Bis(acetylacetonato)-oxidovanadium(IV) and sodium metavanadate inhibit cell proliferation via ROS-induced sustained MAPK/ERK activation but with elevated AKT activity in human pancreatic cancer AsPC-1 cells. J Biol Inorg Chem 8:919–929.
Xi WS, Li JB, Liu YY, Wu H, Cao A, Wang H (2021) Cytotoxicity and genotoxicity of low-dose vanadium dioxide nanoparticles to lung cells following long-term exposure. Toxicology 459:1528–1559.
Yang J, Zhang Z, Jiang S, Zhang M, Lu J, Huang L, Zhang T, Gong K, Yan S, Yang Z, Shao G (2016) Vanadate-induced antiproliferative and apoptotic response in esophageal squamous carcinoma cell line EC109. J Toxicol Environ Health 79:864–868.
Zhang Z, Huang C, Li J, Shi X (2002) Vanadate-induce cell growth arrest is p53- dependent through activation of p21 in C141 cells. J Inorg Biochem 89:142–148.
Zhang Z, Gao N, He H, Huang C, Luo J, Shi X (2004) Vanadate active Akt and promoted S phase entry. Mol Cell Biochem 255:2227–237.
Zwolak I (2020) Protective effects of dietary antioxidants against vanadium-induced toxicity: A review. Oxid Med Cell Longev 2020:1–14.

Table 1 Primer sequence. A reference gene (GAPDH) was used to evaluate the expression of P53, P21, CYCLIN D, CYCLIN E, CDK2 and CDK4.
Gen	Forward	Reverse	pb
GAPDH	5 ́GGAGCGAGATCCCTCCAAAAT 3 ́	5 ́GGCTGTTGTCATACTTCTCATGG 3 ́	197
P53	5 ́CTGGCCCCTGTCATCTTCTG 3 ́	5 ́ CCGTCATGTGCTGTGACTGC 3 ́	242
P21	5 ́ TGAGCGATGGAACTTCGACT 3 ́	5 ́ GACAGTGACAGGTCCACATGG 3 ́	210
CICLINA D	5 ́TACTTCAAGTGCGTGCAGAAGGAC 3 ́	5 ́ TCCCACACTTCCAGTTGCGATCAT 3 ́	498
CICLINA E	5 ́ TCCTGGATGTTGACTGCCTT 3 ́	5 ́ CACCACTGATACCCTGAAACCT 3 ́	109
CDK 2	5 ́ CCTGGATGAAGATGGACGGA 3 ́	5 ́ TGGAAGAAAGGGTGAGCCA 3 ́	99
CDK 4	5 ́ CAGATGGCACTTACACCCGT 3 ́	5 ́ GTTTCCACAGAAGAGAGGCTTTC 3 ́	150
The genes were purchased from Alpha DNA, PROBIOTEK.

Table 2 Viability of human lymphocyte cultures before treatment (0 h) and 24 h after exposure to V₂O₃.
V₂O₃ treatment in μg/mL	Viability (%)
V₂O₃ treatment in μg/mL	0 h	24 h
0 (without)	99.5 ± 0.5	97.7 ± 2.6
2	98.7 ± 1.5	95.5 ± 4.7
4	99.1 ± 0.5	95.5 ± 1.9
8	99.0 ± 0.8	96.2 ± 1.7
16	98.5 ± 1.7	97.0 ± 3.4
Data are presented as the mean ± SD, from three independent experiments performed in duplicate (n = 6).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Oxidative damage and cell cycle delay induced by vanadium(III) in human cells

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

Reagents

Lymphocyte cultures and treatments

Viability

Cell cycle analysis of DNA content

Analysis of protein expression levels

RNA extraction and cDNA synthesis

Polymerase chain reaction (PCR)

Assessment of reactive oxygen species (ROS)

Statistical analyses

RESULTS

DISCUSSION

Cell viability

Cell cycle

Expression levels of mRNA and proteins

γH2AX as a DNA damage sensor

ROS levels

Declarations

References

Tables

Additional Declarations

Status:

Version 1