Animals
All procedures involving animals and their care were conducted in accordance with National Institutes of Health guide for the care and use of laboratory animals (27). The experimental protocol was reviewed and approved by the Ethics Committee of Iran University of medical sciences (ethic code: IR.IUMS.FMD.REC 1396.9321324002). Male Wistar rats aged 3 weeks and weight of 58 ± 4 g were obtained from the Pasteur Institute (Tehran, Iran). They were individually housed in stainless steel cages in an air-conditioned room (21–24 °C, 50–60% relative humidity) with a 12/12 h light/dark cycle.
Experimental Design, Diet And Treatment
Our study consists of two phases: i) obesity induction; ii) intervention in obese rats (Fig. 1). The rats were acclimatized for one week after arrival and then randomly assigned to two groups including HFD group fed Semi-purified HFD (n = 50) and normal diet (ND) group which fed standard laboratory chow-diet. We mixed standard chow powder with milk butter (40% w/w) and prepared HFD. The compositions of HFD and ND are shown in Table 1. High-fat pelleted diet was prepared and stored at 4 °C and then used freshly within two days of preparation.
Table 1
Composition of consumed diets
Dietary Composition(g/kg) | ND | HFD | CRD |
Carbohydrate | 536.2 | 335.125 | 335.125 |
Fiber | 42 | 26.25 | 26.25 |
Protein | 260.8 | 163 | 163 |
Lipid | 40 | 400 | 400 |
Calcium | 9.5 | 5.93 | 5.93 |
Phosphorus | 6.5 | 4.06 | 4.06 |
Salt | 5 | 3.125 | 3.125 |
Moisture | 50 | 31.25 | 31.25 |
Ash | 50 | 31.25 | 31.25 |
Energy density (kcal/g) | 3.6 | 5.6 | 5.6 |
ND: normal diet; HFD: high fat diet; CRD: calorie restriction diet |
Animals had free access to food and water during the obesity induction phase. We weighed animals every week and compared the two groups with each other to assess HFD-induced obesity. The mean weight of rats in the HFD group was elevated significantly relative to the control ND after 17 weeks (443.28 ± 46.62 g vs 396.24 ± 28.79 g; P < 0.05). Further, the obesity model was induced in the HFD group. In the second phase of the study, obese rats were randomly divided into five groups (n = 10) matched for body weight for eight weeks including a) RJ group; 100 mg/kg/day RJ orally added to CRD b) TRF group; 85 mg/kg/day TRF orally added to CRD c) RJ + TRF group; both 100 mg/kg/day RJ with 85 mg/kg/day TRF orally added to CRD d) CRD group; CRD with no added RJ and TRF as control for RJ, TRF and RJ + TRF groups and e) HFD group; HFD with no added RJ and TRF as control for CRD group.
Administered doses of RJ and TRF were chosen considering previous studies based on no observed adverse effects (24, 28). The composition of CRD was similar to HFD but the calorie of CRD was 30% lower than the amount of calorie in ad libitum intake of HFD (Table 1). The CRD was weighed then determined amount of RJ and TRF were added and then supplemented food was fed to rats. Animals had free access to food in the HFD group. We purchased Lyophilized RJ powder from Bulk Supplements Co, Ltd, (Henderson, USA) with 6% of 10-H2DA. TRF was obtained from ExcelVite Co, Ltd (Perak, Malaysia) and comprise α-tocotrienol (12%), β-tocotrienol (2%), γ-tocotrienol (19.3%) and δ-tocotrienol (5.5%) together with α-tocopherol (11.9%). At the end of the experiment, animals were kept fasting overnight and blood was collected via cardiac puncture from rats anesthetized with xylazine and ketamine.
Two parts of the inguinal WAT and interscapular BAT were dissected, cleaned off their adhering tissues and washed with phosphate-buffered saline (PBS) solution. One part was frozen at − 80 °C in RNAlater stabilization solution (Qiagen, Inc. Germany) for determination of genes expression levels with real-time reverse transcription polymerase chain reaction (RT-PCR), while the other part was fixed in 10% formalin buffered solution for 7 days at room temperature for histological assessment.
Rna Isolation And Quantitative Real-time Pcr
Total RNA was isolated from adipose tissues using Trizol Reagent (Thermo fisher, USA). The quality and quantity of extracted RNA were evaluated spectrophotometrically (NanoDrop One/Onec, Thermo Scientific). Reverse transcription of total RNA to complementary DNA (cDNA) was conducted using the RevertAid First Strand cDNA Synthesis Kit
(Thermo Scientific, USA). The cDNA was prepared from 1 µg of mRNA and was subjected to RT-PCR on a quantitative PCR System. PCR amplification was performed with a fluorescence thermal cycler (Light Cycler system; Roche Diagnostics, Mannheim, Germany) system using SYBR green kit (Takara Bio Inc., Shiga, Japan) and rat specific primer sequences targeting the genes including UCP-1, PGC1-α, PPAR-α, PPAR-γ, SIRT1 and β-actin. The specific forward and reverse primers for the assessed gene were designed using the NCBI Primer Bank and were got from Metabion international AG (Steinkirchen, Germany). The sequences of primers are tabulated in Table 2.
Table 2
List of rat-specific primers used in qRT-PCR
Gene | Forward | Reverse |
UCP-1 | TTCTTTTCTGCGACTCGGAT | GCCCAATGGTGTTTAGCATC |
PPAR-α | GGACTTGAATGACCAGGTTAC | TCAGCATCCCGTCTTTGTTCA |
PPAR-Ƴ | GTTCGCCAAGGTGCTCCAGAA | AAGGCTCATATCTGTCTCCGT |
SIRT1 | CTCTGAAAGTAAGACCAGTAG | ACATCGCAGTCTCCAAGAAGC |
PGC1-α | TACACAACCGCAGTCGCAAC | TCCACACTTAAGGTTCGCTCA |
β-actin | TCAGGTCATCACTATCGGCAA | TTACGGATGTCAACGTCACAC |
The cDNA was amplified in the three steps: 95 °C (10 min), 95 °C (10 s), 60 °C (10 s), for 45 cycles with 100% ramp rate. Relative expression of the genes of interest was calculated as relative Ct value and normalized to housekeeping gene (β-actin) (29). We analyzed triplicate Ct values for each sample.
2.5. Histological Assay
For histological examination, WAT and BAT that fixed in 10% formalin were dehydrated using different solutions of alcohol and then embedded in paraffin. Paraffin-embedded tissues were sectioned at a thickness of 5 µm cut by microtome and stained with hematoxylin and eosin (H&E). The sections were viewed under the microscope (magnification, X400).
The sections were viewed triplicate by a skilled histologist under the microscope (magnification, 40X). we conducted histomorphometric studies based on our previous work (30). Actually, 100 sections of each sample of WAT and BAT (10 microscopic fields that were selected randomly and 10 lams were provided from each sample) were assessed and the mean percentage of evaluated adipose tissue (BAT, WAT and beige) and connective tissue were considered for each group.
2.6. Statistical Analysis
One-sample Kolmogorov-Smirnov test was used to analyze the normality of data. All Data were expressed as mean ± SEM. Differences between groups were tested using one-way analysis of variance (ANOVA), with Tukey’s post hoc test analysis for multiple comparisons.
The results of gene expression were presented as fold changes. All analyses were performed using the Statistical Package for the Social Sciences (SPSS Inc. Chicago, IL, USA, version 21). The Prism software, version 6·0 (GraphPad, CA, USA) was used for drawing figures. A P value < 0.05 was considered statistically significant.