2.1 Clinical samples
212 samples of gastric cancer tissue and 60 samples of adjacent normal gastric tissue from patients were obtained from the First Affiliated Hospital of China Medical University from 2003 to 2010. None of the patients received preoperative chemotherapy or radiotherapy, and all of them were proven to have gastric cancer by pathology. The cancer tissue was fixed with formalin and preserved in paraffin. All pathological data were complete, and the postoperative follow-up was sufficient. All patients were approved by the ethics committee of China Medical University to participate in the study and provided written informed consent.
2.2 Immunohistochemistry of human gastric cancer
To fix gastric cancer tissue samples, 10% formalin was used, then the tissue was paraffin-embedded and cut into 4-μm slices. The xylene and alcohol were used for dewaxing and rehydrating. Endogenous peroxidase activity was blocked by using hydrogen peroxide (30%), the citrate buffer (pH 6.0) was used to boil the the sections fro 3 minutes in a pressure cooker. Next, normal goat serum was used for incubating the sections to reduce the nonspecific binding. Finally, the tissue sections were incubated (4°C, 12 h) with anti-STEAP1 antibody (1:200 dilution, B-4, SC-271872, Santa Cruz, USA). Finally, the sections were stained with diaminobezidin (DAB) for 60 sec, stained with hematoxylin for 2 min and sealed with neutral resin. Two pathologists examined all tumor slides randomly. We evaluated STEAP1 staining intensity as follows: scored 0 (negative), 1 (weakly negative), 2 (weak positive), and 3 (strong positive). The percentage scores of positive cells per single field vision were as follows: scored 1 (0-25%), 2 (26-50%), 3 (51-75%), and 4 (76-100%). We multiplied the two scores above and obtained a final score ranging from 0 to 12. Tumor samples with a score <6 were considered as negative expression; on the contrary, the score ≥6 was considered as positive expression.
2.3 Animals
Twenty-four BALB/c nude female mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The mice were raised in the animal experimental center of of China Medical University. The twenty-four nude mice were randomly divided into four groups. Two groups were used for hypodermic injection, and the other two groups were intraperitoneally injected with 3×106 cells per nude mouse. All animal experimental steps were approved by the Animal Research Committee of China Medical University.
2.4 Cell culture
GES-1, a normal gastric mucosa cell line was obtained from Nanjing Cobioer Biotechnology Co., Ltd. The gastric cancer cell lines MGC-803 and SGC-7901 were obtained from the Chinese Academy of Sciences. AGS was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). MGC-803, SGC-7901 and GES-1 cells were cultured in DMEM containing 10% FBS. AGS line was cultured in DMEM-F12 medium containing 10% FBS. All cells were cultured at 37°C in a 5% CO2 incubator.
2.5 Cell transfection
ShRNA lentivirus was purchased from Shanghai Genechem Co., Ltd. The NC group insertion sequence was TTCTCCGAACGTGTCACGT. There were three shRNA sequences used (shRNA1: CCAACTTCATAATGGAACCAA; shRNA2: CAGCACACACAGGAACTCTTT; and shRNA3: AAGCTAGGAATTGTTTCCCTT). The STEAP1 containing cDNA plasmid and Flag empty plasmid were purchased from Beijing SinoBiological Co., Ltd. Lipofectamine 3000 reagent (Thermo Fisher Scientific, Inc.) was used for plasmid transfection. The cells were harvested 48 h after transfection. Western blot analysis and RT-PCR were used to check the transfection efficiency.
2.6 RT-PCR
TRIzol reagent was used to extracted total RNA. The reverse transcription kit PrimeScript RT was purchased from Takara. The primer designs were provided by Huada Gene Co., and the sequences were as follows: GAPDH, 5’-GTCTCCTCTGACTTCAACAGCG-3’ (forward), 5’-ACCACCCTGTTGCTGTAGCCAA-3’ (reverse); β-actin, 5’-CACCATTGGCAATGAGCGGTTC-3’ (forward), 5’-AGGTCTTTGCGGATGTCCACGT-3’ (reverse); CCND1, 5’-TCTACACCGACAACTCCATCC-3’ (forward), 5’-TCTGGCATTTTGGAGAGGAAGTG-3’ (reverse); P27, 5’-ATAAGGAAGCGACCTGCAACCG-3’ (forward), 5’-TTCTTGGGCGTCTGCTCCACAG-3’ (reverse); CDK4, 5’-CTCGTGCTGATGCTACTGAGGA-3’ (forward), 5’-GGTCGGCGCAGTTGGGCTCC-3’ (reverse); E-cadherin, 5’-GCCTCCTGAAAAGAGAGTGGAAG-3’ (forward), 5’-TGGCAGTGTCTCTCCAAATCCG-3’ (reverse); N-cadherin, 5’-CCTCCAGAGTTTACTGCCATGAC-3’ (forward), 5’-GTAGGATCTCCGCCACTGATTC-3’ (reverse); MMP-2, 5’-AGCGAGTGGATGCCGCCTTTAA-3’ (forward), 5’-CATTCCAGGCATCTGCGATGAG-3’ (reverse); MMP9, 5’-GCCACTACTGTGCCTTTGAGTC-3’ (forward), 5’-CCCTCAGAGAATCGCCAGTACT-3’ (reverse); IL1β, 5’-CCACAGACCTTCCAGGAGAATG-3’ (forward), 5’-GTGCAGTTCAGTGATCGTACAGG-3’ (reverse); and IL6, 5’-AGACAGCCACTCACCTCTTCAG-3’ (forward), 5’-TTCTGCCAGTGCCTCTTTGCTG-3’(reverse).
2.7 Western blot analysis
All proteins were obtained by lysing the cells. Proteins were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, 8%). After transferring to a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA, USA), the membranes were incubated overnight at 4°C with antibodies against STEAP1 (SC-271872, 1:400) from Santa Cruz, USA. The other antibodies used are as follows. GAPDH (60004-1-Ig, 1:10000), β-actin (60008-1-Ig, 1:10000), IL1β (16806-1-AP, 1:1000), IL6 (66146-1-Ig, 1:1000), and NF-kB (14220-1-AP, 1:1000) were purchased from Proteintech Group, Wuhan, China. P27 (3686, 1:1000), CDK4 (2546, 1:1000), AKT (4691, 1:1000), P-AKT (4060, Ser473, 1:2000), FoxO1 (2880, 1:1000), P-foxO1 (9464, 1:2000), E-cadherin (14472, 1:1000), N-cadherin (13116, 1:1000), Vimentin (5741, 1:1000), MMP-2 (4022, 1:1000), MMP9 (13667, 1:1000), c-Jun (9165,1:1000), P-c-Jun (3270, 1:2000), Erk (4695, 1:1000), and P-Erk (4370, 1:2000) were purchased from Cell Signaling Technology, USA. P-NF-kB (109458, 1:3000) was purchased from Abcam, UK. Then the goat anti-rabbit and anti-mouse IgG secondary antibodies were used to incubate the membrane at room temperature for 60 min. Finally, the ECL was used to visualize and detect the proteins by using BioImaging Systems (UVP Inc., Upland, CA, USA).
2.8 Cell Counting Kit-8 (CCK-8) assay
SGC-7901 and MGC-803 cells were transfected with an empty vector, STEAP1 plasmid, negative control virus, or sh-STEAP1 virus. Cells were seeded at 3000 per well into a 96-well plate, and CCK-8 solution (Beyotime, Shanghai, China) was added into every well at 24h, 48h, 72h and 96 h. A microplate reader was used to measure the absorbance values and estimate the cell proliferation rates.
2.9 Colony formation assay
For the colony formation assay, SGC-7901 and MGC-803 cells were transfected with plasmid or shRNA for 36 h and plated into 6-well cell plates (1000 cells/well). The cells were cultured in a 37°C incubator for 2-3 weeks, fixed with alcohol for 30 min, and stained with Trypan Blue for 20 min at room temperature. The colonies with more than 50 cells were counted. Finally, an HD camera was used to obtain the images.
2.10 Flow cytometry
We used a flow cytometry assay to detect the cell cycle stage. SGC-7901 and MGC-803 cells were transfected with plasmid or shRNA and plated into 6-well plates (1×105 cells/well). After 24 h, the cells were harvested using 0.25% trypsin in 1.5 ml Eppendorf tubes. Then, the cells were stained with propidium iodide (PI, 500 μ/tube, KeyGEN, Nanjing, China) at 37°C in the dark for 30 min. Finally, the cells were analyzed using a FACSCalibur flow cytometer (Becton Dickinson, USA).
2.11 Transwell assay
Cell migration experiments were performed using a 24-well transwell chamber with a pore size of 8 μm (Costar). A total of 5×104 cells in serum-free DMEM were placed in the upper chamber, and DMEM with 10% FBS was added to the lower chamber. After more than 10 hours, the migration experiment was terminated, and the cells were observed in the medium below. Then, the cells on the membrane in the bottom chamber were fixed with 75% alcohol for 30 min and stained with Trypan Blue at room temperature for 20 min. Images were obtained using an inverted microscope. In addition, the transwell chamber was also used for cell invasion experiments. For these experiments, in addition to the above steps, Matrigel (1:9 dilution, BD Bioscience) was added to the upper chamber to observe the change in cell invasion ability.
2.12 Wound healing assay
A wound healing assay was used to observe the migration of cells. In this study, 1×105 cells were seeded into 6-well plates for every group. After the cells had covered the entire plate, a pipette tip was used to make a scratch in the cell monolayer, and phosphate buffer saline (PBS) was used to wash the floating cells three times. Subsequently, we used serum-free DMEM instead of the former medium. Finally, an inverted microscope (Olympus, Japan) was used to take images at 0 h and 96 h. The difference in scratch distance between the two phases can reflect the difference in the cell migration ability.
2.13 ELISA assay
The ELISA assay can be used to detect the amount of secretory proteins in cells. Cells in each group were seeded into 6-well culture plates at a density of 1×106 cells/well. Two milliliters of DMEM with 10% FBS were used to culture the cells. After 48 h, the cell culture medium was collected, and the secretory proteins were detected using an ELISA kit (VAL101; VAL102, R&D Systems, MN, USA). The procedures were performed according to the manufacturer’s instructions.
2.14 Statistical analysis
GraphPad Prism 7.0 was used for image editing. The data were expressed as the means±SEMs. SPSS 21.0 statistical software was used for data analysis. The chi-square test was used to examine possible correlations between STEAP1 expression and clinicopathological factors. Survival rates were calculated using Kaplan-Meier analysis. The log-rank test was used for single-factor analysis. Cox risk proportion model was used for multi-factor analysis, and a value of P<0.05 was considered statistically significant.