Rhoifolin Improves Bleomycin-induced Fibrosis in Vivo and in Vitro through NRF2/HO-1 Pathway

doi:10.21203/rs.3.rs-3540469/v1

Download PDF

Research Article

Rhoifolin Improves Bleomycin-induced Fibrosis in Vivo and in Vitro through NRF2/HO-1 Pathway

https://doi.org/10.21203/rs.3.rs-3540469/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Purpose: An investigation shows that COVID-19's convalescing pulmonary lesions will experience varying degrees of fibrosis after being inspected by an imaging test. Traditional Chinese medicine frequently treats pulmonary fibrosis using honeysuckle. Rhoifolin (ROF), which is in large amounts of honeysuckle and has some anti-inflammatory qualities, has yet to be researched to see if it also has anti-fibrosis properties. This investigation will examine the main mechanism and see if rhoifolin can alleviate experimental lung fibrosis.

Methods: Bleomycin was used to establish the lung fibrosis model in SD rats, and the effects of ROF on lung histopathology and appearance, as well as PCR measurements, were observed. Expression levels were determined by Western blot analysis. Bleomycin and LPS were used to cause pulmonary fibrosis and inflammation in A549 lung epithelial cells. Related mRNA were measured using real-time PCR following treatment with BLM and LPS, respectively. A western blot was performed to identify the signal pathway's activation.

Results: The results showed that ROF lessened lung tissue damage in rats with pulmonary fibrosis. Reduce the level of pulmonary fibrosis in rat lung tissue and increase SMAD7 and HO-1 protein expression while lowering N-cadherin protein expression in vivo. In an in vitro experiment, A549 cells were modeled using BLM and LPS, respectively. ROF may decrease the relative protein expression of N-cadherin, P-JAK1, P-IKKβ, and PP65 while increasing Nrf2, Smad7, and HO-1 protein expression.

Conclusion: The findings of this study provide proof that ROF has a strong inhibitory effect on pulmonary fibrosis and that its mechanism is closely linked to the NRF2/HO-1 pathway. As a result, our research provides robust experimental support for the potential use of ROF as a potential therapeutic agent for ameliorating pulmonary fibrosis.

COVID-19

ROF

Pulmonary fibrosis

Bleomycin

SD rat

The coronavirus disease of 2019 (COVID-19) has spread like an epidemic, causing patients to suffer significant lung damage, loss of lung function, and reduced quality of life, the World Health Organization (WHO) said on 11 March 2020. Studies have shown that after being absorbed by an imaging test, the convalescing pulmonary lesions of COVID-19 will have varied degrees of fibrosis [1–4]. Pulmonary fibrosis after COVID-19 disease is the main sequela of COVID-19, and its pathological mechanism is very close to Idiopathic pulmonary fibrosis(IPF), which is mainly related to such inflammation, transdifferentiation, and hypoxia[5–7]. Its pathological features include excessive fibroblast activation, increased interstitial collagen, abnormal extracellular matrix (ECM) deposition, and inflammation, resulting in deteriorating lung structure and impaired respiratory function. Progressive dyspnea is the main clinical symptom, along with cough, expectoration, exhaustion, emaciation, and lack of appetite. As the condition progresses, it culminates in cardiopulmonary failure[8–11]. There is no particularly effective treatment in the clinic, and actively seeking drugs to improve pulmonary fibrosis is of positive significance.

Honeysuckle (Lonicerae Japonicae Flos) has various pharmacological effects, chemical constituents, and therapeutic value. Honeysuckle contains organic acids, flavonoids, volatile oils, iridoids, triterpene saponins, and other compounds [12–13]. For instance, while iridoids have anti-inflammatory, analgesic, heat-clearing, and detoxifying actions, flavonoids primarily have antiviral, antilipemic, anti-tumor factors, antibacterial, and antiallergic activities [14]. It has been found that honeysuckle is commonly used in traditional Chinese medicine to treat pulmonary fibrosis [15].ROF is one of the active ingredients in Flos Lonicerae and is found in large amounts. Previous pharmacological studies show that it has anti-inflammatory activity, but whether it can improve pulmonary fibrosis has not been studied. In this paper, the ameliorative effect of ROF on pulmonary fibrosis is investigated using SD rats and in vitro fibrosis models, and its mechanism is tentatively discussed.

Chemicals

Rhoifolin(ROF)(DY0053, purity > 99%) was purchased from Chengdu Lemeitian Medicine Technology Company (Chengdu, China). Bleomycin was obtained from CSNpharm(CSN10472).

Animal Treatment

BLM-Induced Pulmonary Fibrosis Rat Model

SD rats (250–280 g, lot: 00314136) purchased from Beijing Wei Tong Li Hua Experimental Animal were randomized into five groups of eight mice per group: control, BLM, high dose of ROF (HROF), low dose of ROF (LROF) and pirfenidone (PFD) groups. To model pulmonary fibrosis in rats, the model and the other groups, except the control group, received intratracheal bleomycin (4.5 mg/kg). The control and BLM groups received physiological saline daily; 20 and 10 mg/kg ROF dissolved in 0.25% carboxymethylcellulose sodium (i.g.) were administered to the HROF-LROF groups. The dose in the PFD group was 5 mg/kg. Each rat was intragastrically administered once daily and maintained for 28 days.

Pulmonary index

After modeling the SD rats and 28 days after drug administration, each group removed the entire lung, filtered the water from the lung tissue with filter paper, photographed and weighed, and calculated the lung index (wet weight/body weight *100%).

Histology

Rat lung tissue was immersed in 4% paraformaldehyde embedded sectioned at four µm thickness for HE staining. Tissue sections were examined by light microscopy. Grading by modified Ashcroft method (grades 0–8): Under the same magnification (20×10), three fields of view were randomly selected in H&E-stained sections of lung tissue from rats in each group (to avoid bronchi and large and medium-sized vessels) to assess the degree of pulmonary fibrosis. The grading scoring criteria are shown in Table 1.

Table 1

Ashcroft score
Fibrosis grade	Improved Ashcroft method scoring scale
0	Normal lung
1	Minimal fibrous, thickening of alveolar or bronchiolar walls
2–3	Moderate thickening of walls without obvious damage to lung architecture
4–5	Increased fibrosis with definite damage to lung architecture and formation of fibrous bands or small fibrous one-mass
6–7	Severe distortion of structure and large fibrous areas
8	Total fibrotic obliteration

Masson staining

Pulmonary fibrosis was analyzed, changes in pulmonary fibrosis were evaluated according to collagen volume fraction, and collagen fiber area was measured. After imaging, Image J software is used for analysis, and blue collagen is used as the color selection standard to calculate the integral of the pixel area of blue collagen fiber in the target area, i.e., the collagen volume fraction (CVF).

RNA Extraction and Real-time PCR

Treatment of animal samples: Take about 30 mg of lung tissue. Total RNA was isolated from the cell samples by Trizol and a Prime Script TM RT reagent kit (Life Technologies) to copy DNA. Then, RT-PCR was performed using SYBR Premix Ex TaqTM (AG11701, Accurate Biology). Using GAPDH as an internal reference gene, the following primer pairs were used to amplify α-SMA and TGF-β (Table 2).

Table 2

Primer Sequence of Genes of Rats
Genes		Primer antisense(5’-3’)
GAPDH	AGTGCCAGCCTCGTCTCATA	GATGGTGATGGGTTTCCCGT
TGF-β	ACCGCAACAACGCAATC	TTCCGTCTCCTTGGTTCAG
α-SMA	GCTGTGCTATGTCGCTCTGG	TCCTTCTGCATCCTGTCAGC

A549 cells were plated in six-well culture plates. There were six groups in this experiment: control, BLM model (20µg/ml), PFD (0.5mg/ml), and high, medium, and low dose ROF (100, 50, 25µM). Another set of cells used LPS as the cell modeling agent and DEX (10 µg/mL) as the positive drug. Each group was treated with BLM except the control group. Stimulation for 24 hours, the cells are scraped off. Using GAPDH as an internal reference gene for the amplification of alpha-SMA, vimentin, and N-cadherin, the following primer pairs were used. (Table 3).

Table 3

Primer Sequence of Genes of A549 Cell
Genes		Primer antisense(5’-3’)
GAPDH	AAGAAGGTGGTGAAGCAGG	GTCAAAGGTGGAGGAGTGG
N-cadherin	ATCAAGCCTGTGGGAATCCG	AGCTGTGGGGTCATTGTCAG
α-SMA	TAGCACCCAGCACCATGAAG	CTGCTGGAAGGTGGACAGAG
Vimentin	GGACTCTGATTAAGACGGTT	AGAAAGGCATTGAAAGCTG
IL-6	GAGGGCTCTTCGGCAAATGT	GCCCAGTGGACAGGTTTCTG
IL-1β	ATGATGGCTTATTACAGTGGCAA	TTCACATCTACGCTGTACCCC
TNF-α	GCCCTGGTATGAGCCCATCT	AGTAGACCTGCCCAGACTCG

Western Blotting Analysis

50 mg of lung tissue was collected, and 500 µL lysate was dissolved in RIPA buffer containing a 1% protease/phosphatase inhibitor mixture (Boster) in RIPA buffer. The tissue was homogenized, and the BCA kit determined the protein concentration. Total protein was separated by 8% SDS polyacrylamide gel electrophoresis (Millipore, Billerica, MA, USA) in each sample (50 mg for animal, 25 mg for cell), onto polyvinylidene fluoride membrane, incubated for one hour in blocking solution containing 5% BSA-TBST and overnight at four °C with primary antibody. Membranes were then washed three times for 10 minutes each, With TBST followed by incubation with the appropriate secondary antibodies for 1 hour at room temperature. Image J software calculated The relative protein expression and compared it with the internal control.

Cell Culture

The A549 cell was obtained from the Guangzhou Saiku Biology Technology company (Guangzhou, China). Cells were maintained with 1640 (Gibco BRL, Grand Island) in a moist atmosphere of 95% air and 5% CO2, fortified with 10% FBS.

Cell Viability Assay

Logarithmic phase A549 Cells were planted into 96-well plates; each well contains 5 × 103 cells.

The ROF groups were added with different concentrations of ROF (3.126, 6.25, 12.5, 25, 50, 100,200 µM) dissolved in 1640 (Gibco BRL, Grand Island), control and blank groups for a further 24 hours, 48 h under standard cell culture conditions. Subsequently, 20 µL of 5 mg/mL thiazole blue (MTT) was added to each well and incubated continuously at 37°C for 4 hours. Discard media from each well, add 150 µL dimethylsulfoxide (DMSO), and shake for 5 minutes. A plate reader was used to read the optical density at 520 nm.

Each plate was divided into five groups: control, model, LROF, MROF, and HROF. Except for the control group, each group received BLM (20 µg/mL), LROF, MROF, and HROF received 25 µM, 50 µM and 100 µM ROF, respectively. Subsequent procedures were the same as above.

The model group received different concentrations of LPS (0.125, 0.25, 0.5, 1, 2, 5, 10, 20 µg/mL) dissolved in 1640. Other steps were the same as described above.

Analysis

Experimental data were analyzed using SPSS26.0, and data were expressed as. The data were subjected to a standard distribution test first. The variance homogeneity test was conducted if the data were subjected to normal distribution. When the variances were homogeneity, and the sample contents of each group were the same, pairwise comparison was conducted using the Tukey test in One-way ANOVA. When the variances were homogeneous, and the sample contents in each group were not the same, the pairwise comparison was performed using the Scheffe test in a one-way analysis of variance. When the clashes were not uniform, the non-parametric test was used for pairwise comparison between groups. P < 0.05 was considered statistically significant, and the statistical analysis results were plotted using GraphPad Prism 5.0.

Effect of ROF on lung tissue damage in pulmonary fibrosis rats

Bleomycin is a family of compounds produced by Streptomyces verticillis. [16] BLM is a commonly used inducer for the preparation of experimental pulmonary fibrosis. BLM nasal drip for 28 days is currently accepted as the preparation method of the pulmonary fibrosis model. For this reason, we have also used this model to investigate the ameliorative effect of the oral administration of ROF on the experimental model of pulmonary fibrosis.

The weights of the rats were recorded every two days in Fig. 1a. The rats in the normal group in Fig. 1b had smooth, well-touchable lung surfaces with no visible lesions. In the model group, the softness of the lung tissue had decreased, and there were localized hemorrhagic areas with congestion and a hard texture. The appearance of the lung tissue in the drug-treated group was significantly improved.

In addition, the model group rats' lung coefficient increased significantly (P < 0.05) compared to the sham-operated group (Fig. 1c); in contrast, the lung coefficient of the low-dose ROF group decreased, but there was no significant difference (P > 0.05), whereas the lung coefficient of the high-dose ROF group and the positive drug PFD group decreased. The difference was significant (P < 0.05).

Lung tissue sections from the blank control rats (Fig. 1d) showed clear lung tissue structure, no inflammatory cell infiltration in the alveolar septum, no inflammatory exudate in the bronchial and alveolar cavities, and no evidence of pulmonary fibrosis. After modeling, there was a massive consolidation of the lung tissue, rupture and collapse of the alveolar wall, massive fibroblast proliferation, and obvious infiltration of giant inflammatory cells. The alveolar system was largely intact in the high-dose and PFD groups, with only a tiny proportion of alveoli showing hemorrhage and rupture and minimal inflammatory cell infiltration. Rat HE-stained sections were used to assess the degree of fibrosis in each group of rats using the enhanced Ashcroft scoring criteria. The Ashcroft score of the model group increased compared to the sham-operated group, with a significant difference (P < 0.05), as shown in Fig. 1e. Compared with the model group, the ROF scores of the low-dose and high-dose groups decreased (P < 0.05), and the Ashcroft score of the rats in the positive group decreased(P < 0.05).

Figure 1. The lung damage brought on by BLM in rats can be improved with ROF: Rats were treated with BLM (4.5 mg/kg), ROF (20 and 10 mg/kg), and PFD (5 mg/kg). (a) Trends of body weight gain in rats were observed. (b) showed The appearance of rat pulmonary. (c) showed the rat pulmonary index. (d) showed the Pulmonary fibrosis damage of the lung (x200). (e) Shows the Ashcroft scoring scale for evaluating the degree of fibrosis in H&E stained sections of rats in each group; Data are expressed as mean ± SEM (n = 6–8).

Effect of ROF on fibrosis Severity in pulmonary fibrosis rats

As seen in Fig. 2a, the light blue area represents the area of collagen. The area of collagen fibers was calculated as shown in Fig. 2b. After imaging, Image J software was used for analysis, and blue collagen was used as the reference color to measure the collagen volume fraction (CVF), or the pixel area proportion score of blue collagen fibers in the measurement target area. Collagen volume fraction in the lung tissue of rats in the model group increased statistically significantly (P < 0.05) compared to the sham surgery group. The pixel areas of collagen fibers in rats in the ROF dosage groups and the positive drug PFD group decreased significantly (P < 0.05) compared with the model group.

Another critical factor in the development of pulmonary fibrosis is high oxidative stress, and superoxide dismutase (SOD) is a marker for lipid peroxidation. As shown in Fig. 2e, SOD levels were reduced in the BLM group compared to blank control, with a significant difference (P < 0.05). The positive drug PFD and LROF groups showed an increasing trend but no statistical significance compared to the BLM group, and the HROF group showed significant differences (P < 0.05).

As shown in Fig. 2c and d, the expression levels of α-SMA mRNA and TGF-β mRNA in the model group increased significantly (P < 0.05) compared with the sham surgery group. Compared with the model group, the expression levels of TGF-β and α-SMA mRNA decreased in the positive drug PFD group and the low-dose urushioside group, but there was no statistical difference. However, TGF-β and α-SMA mRNA expression levels in the high-dose ROF group decreased significantly (P < 0.05).

Effect of ROF on the expression of N-cadherin, Smad 7, and HO-1 in rats with pulmonary fibrosis

As shown in Fig. 3, it was found that the expression of Smad7 and HO-1 decreased in lung tissue after BLM modeling. The expression of N-cadherin increased in the model group with statistical significance (P < 0.05). In contrast, the expression of N-cadherin decreased, and Smad7 was raised in the ROF and PFD groups at different doses. Compared with the model group, the positive drug PFD group and the high-dose ROF group can increase the expression of HO-1, but there is no statistical significance (P > 0.05).

Effect of ROF on BLM-Induced A549 Cells

Highly proliferative A549 cells, also known as human alveolar basal epithelial cells from lung cancer, were used to study lung conditions. In this experiment, a model of lung fibrosis was created. First, the MTT toxicity of ROF was investigated in A549 cells (Fig. 4a). According to the experimental results, ROF at 200 µM had no discernible effect on the activity of A549 cells (P > 0.05). To further evaluate the effect of ROF on the viability of BLM-stimulated A549 cells, we performed MTT assays 24 and 48 hours after ROF injection. According to the previous basic research in the laboratory, the dosage of bleomycin is 20 µg/ml, and that of pirfenidone is 0.5 mg/ml. The BLM group showed a significant decrease (P < 0.05) compared to the normal group after 24 hours. Compared to the BLM group, the BLM + ROF group did not significantly affect the cells' viability. The longer the time, the lower the cell activity of the BLM and BLM + ROF groups compared with the blank group (Fig. 4b).

We measured the mRNA levels of α-SMA, cadherin, and vimentin to examine the anti-fibrosis effect of ROF further. A549 cells were divided into control, BLM, ROF (25, 50, and 100 µM), and PFD groups. Cells were harvested 24 hours after dosing for polymerase chain reaction analysis. After BLM treatment, α-SMA, cadherin, and vimentin mRNA expression were significantly increased. Compared with the BLM group, the mRNA expression levels of α-SMA and N-cadherin were reduced considerably in the medium-dose and high-dose ROF groups (P < 0.05) (Fig. 4c), (d)). In the vimentin PFD group, the mRNA expression levels were decreased in the ROF low and, medium and high dose groups (both P < 0.05) (Fig. 4e).

We investigated the effect of ROF on the expression of the pulmonary fibrosis-related proteins N-cadherin and smad7 and the Nrf2/HO-1 pathway protein. A549 cells were divided into control, BLM, ROF (25, 50, and 100 µM), and PFD groups. Compared with the normal group, the protein expression of N-cadherin was significantly increased in the BLM group (P < 0.05), and the protein expressions of Nrf2, HO-1, and Smad7 were significantly decreased (P < 0.05). Compared to the BLM group, the protein expressions of N-cadherin, HO-1, and Smad7 in the ROF-treated group showed significant trends (P < 0.05), and the protein expression of Nrf2 was significantly different only in the high-dose ROF group (P < 0.05). (Fig. 4)

Effect of ROF on inflammatory factors of A549 cells induced by LPS

Much literature has demonstrated that ROF has a specific anti-inflammatory effect. The early pathological manifestations of pulmonary fibrosis are similar to acute lung injury; these are all inflammatory lung lesions where inflammatory factors are important. In the in vitro experiment, we will also look at the anti-inflammatory effect of ROF on A549 cells induced by LPS.

A549 cells were divided into blank and LPS groups. At 24 h after treatment, we examined whether LPS affected the growth of A549 cells by using the MTT method (Fig. 5a).In the experiment, LPS at the concentration of 1 mg/mL was selected for modeling.

There were control, LPS, ROF (25, 50, and 100 µM) and Dex groups. Cells were harvested 24 hours after dosing for polymerase chain reaction analysis. Compared with the blank group, the mRNA expressions of IL-1β, IL-6, and TNF-α were increased in the LPS group, and there were significant differences (P < 0.05). Compared with the LPS group, IL-1β and TNF-α mRNA expressions in the DEX group were decreased and significantly different (P < 0.05)(Fig. 5bc). In contrast, that of IL-6 showed no significant difference (P > 0.05) (Fig. 5d). Compared with the LPS group, the mRNA expressions of IL-1β, IL-6, and TNF-α were decreased in the medium-dose and high-dose ROF groups, and there were significant differences (P < 0.05). However, there was no statistical significance in the low-dose ROF group.

Effect of ROF on NκB pathway induced by lipopolysaccharide in A549 cells

The cells were divided into the control group, the LPS model group, the ROF groups (25, 50, 100 µM), and the DEX group. As shown in Fig. 6, the protein expression levels of P-JAK1/JAK1, P-IKKβ/IKKβ, and PP65/P-65 were significantly increased in the LPS group compared with the blank group (P < 0.05). Compared with the LPS group, the expression levels of P-IKKβ/IKKβ and PP65/P-65 in the low-dose ROF group were significantly decreased (P < 0.05), and the expression of P-JAK1/JAK1 protein was decreased without significant difference (P > 0.05). Compared with the LPS group, the expression levels of the three proteins in the high-dose ROF medium groups decreased, and the differences were significant (P < 0.05). (P < 0.05) Compared with the LPS group, the expressions of P-JAK1/JAK1, P-IKKβ/IKKβ, and PP65/P-65 proteins were decreased in the positive drug groups, but there was no significant difference (P > 0.05).

The symptoms associated with COVID-19 are diverse, ranging from mild upper respiratory symptoms to severe acute respiratory distress syndrome. Pulmonary fibrosis occurs in various clinical settings and is the leading cause of morbidity and mortality.Fibroblast/myofibroblast activation and excessive extracellular matrix accumulation in the lungs are the hallmarks of fibrosis and remodeling. The main clinical manifestations are progressive dyspnoea accompanied by cough, sputum production, fatigue, wasting, loss of appetite, and other symptoms, and the disease progresses, eventually leading to cardiopulmonary failure [17–19]. The pathological mechanism of pulmonary fibrosis is not well understood. However, inflammatory immune response, extracellular matrix deposition, epithelial-mesenchymal transition, and oxidative stress are thought to be closely related to the development of pulmonary fibrosis. Currently, two drugs for pulmonary fibrosis (pirfenidone and nidanib) have been approved for marketing worldwide, and more than a dozen drugs are in clinical research. However, the effect could be better, and there are many side effects and high prices.

Honeysuckle was called "Lonicera japonica Thunb"[20] in ancient times, and Lonicera japonica Thunb was listed as the highest grade in "A Record of Famous Doctors." Honeysuckle has many chemical components, broad pharmacological effects, and high medicinal value. Among the traditional Chinese medicines and their compounds used in the clinical treatment of pulmonary fibrosis, it is found that honeysuckle is frequently used in the anti-pulmonary fibrosis treatment of traditional Chinese medicine. For example, Qingjin Bufei Decoction [21] Can reduce serum TNF-α levels in rats with bleomycin-induced lung fibrosis. At the same time, early intervention with Qingjin Bufei Decoction can slow down the process of pulmonary fibrosis in rats with pulmonary fibrosis induced by bleomycin. ROF is an important active ingredient in Flos Lonicerae. Studies have shown that ROF has multiple pharmacological effects, including anti-tumor, anti-hypertensive, and antioxidant effects.

We want to use bleomycin, typically used to create a pulmonary fibrosis rat model. To determine whether ROF has a therapeutic effect on pulmonary fibrosis and its impact on fibrosis factors and inflammatory factors, bleomycin was used for in vivo modeling, and BLM and LPS were used for in vitro modeling of pulmonary fibrosis. The rat lung fibrosis model was established using in vivo research; 10 and 20 mg/kg ROF were applied as low and high doses. The anti-fibrosis effect of 10 mg/kg ROF was insignificant according to data from rat body weight, behavioral observation, and morphological changes in lung tissue, and the high dose of ROF had a good anti-pulmonary fibrosis effect.

A549 cells were initially used in the in vitro experiment to investigate the effect of ROF on BLM cells after modeling. Epithelial-mesenchymal transition (EMT) [22] is a major contributor to lung fibrosis. In vitro research has shown that ROF can reduce fibrosis by significantly reducing relative mRNA expressions of α-SMA, N-cadherin, and vimentin, these fibrosis factors. Nuclear factor-related factor2 (Nrf2) is a key oxidative stress response regulator and is a major cause of lung fibrosis[23].In addition, one of the most abundant antioxidant enzymes, heme oxygenase-1 (HO-1) [24], protects against lung fibrosis in rats. The results show that ROF has some therapeutic effect on pulmonary fibrosis rats in vivo and can improve the degree of fibrosis in A549 cells in vitro.

According to the research, the development of pulmonary fibrosis is mainly the result of previous acute pulmonary inflammation, which is caused by many etiological factors and has not been solved with time, leading to the deposition of fibrotic tissue in the lung. In 2014, the FDA approved Pirfenidone and Nittanyl to treat pulmonary fibrosis, in which pirfenidone can improve the symptoms of pulmonary fibrosis through anti-oxidation and anti-inflammation.[25]Early pathological signs of pulmonary fibrosis are pulmonary inflammatory lesions, just like acute lung damage.LPS is sometimes employed to create models of lung fibrosis, and it is crucial in sepsis-related lung fibrosis [26].

A549 cells were simultaneously modeled with LPS in vitro. According to the experimental results, ROF has anti-inflammatory properties and could reduce the relative mRNA expression of IL-6, IL-1, and TNF-α. In addition, through the P-IKKβ/NF-kβ pathway, ROF may reduce the expression of P-JAK1, P-IKKβ, and P-P65 proteins and the inflammation associated with lung fibrosis.

In conclusion, ROF has anti-inflammatory and anti-fibrosis properties and may be developed into an effective drug for treating pulmonary fibrosis. This paper suggests that the amelioration of pulmonary fibrosis by ROF may be related to the influence of the Smad signaling pathway. In the follow-up study, we will further clarify the signaling mechanism of ROF by using related Smad inhibitors.

BLM:bleomycin;ROF:Rhoifolin;WHO:World Health Organization;IPF:Idiopathic pulmonary fibrosis;ECM:extracellular matrix;PFD:pirfenidone;CVF:collagen volume fraction ;SOD:superoxide dismutase.

Ethics approval and consent to participate

This animal experiment was reviewed and approved by the Animal Care and Use Committee of Guangzhou University of Traditional Chinese Medicine (2020058).

Consent for publication

Applicable.

Competing interests

The authors have no competing interests to declare.

Funding

Liang Liu was supported by the National Key Technologies Research and Development Program [2022YFC0867500].

Availability of data and materials

The datasets generated or analysed during the current study are available from the corresponding author on reasonable request.

Author contributions

XW, QW, and PZ are in charge of the experiment. JZ, HS, and FL are in order of the data analysis, and J W is in order of the experimental technology support. FX, LL, and LH gave guidance on the practical direction.

George PM, Wells AU, Jenkins RG. Pulmonary fibrosis and COVID-19: the potential role for antifibrotic therapy. The Lancet Respiratory medicine. 2020;8(8):807–15. https://doi.org/10.1016/S2213-2600(20)30225-3.
Tanni SE, Fabro AT, de Albuquerque A, Ferreira EVM, Verrastro CGY, Sawamura MVY, Ribeiro SM, Baldi BG. Pulmonary fibrosis secondary to COVID-19: a narrative review. Expert Rev Respir Med. 2021;15(6):791–803. https://doi.org/10.1080/17476348.2021.1916472.
Noble PW, Barkauskas CE, Jiang D. Pulmonary fibrosis: patterns and perpetrators. J Clin Investig. 2012;122(8):2756–62. https://doi.org/10.1172/JCI60323.
Richards RJ, Masek LC, Brown RF. Biochemical and cellular mechanisms of pulmonary fibrosis. Toxicol Pathol. 1991;19(4 Pt 1):526–39. 10.1177/019262339101900418.
Cordier JF. Fibrose pulmonaire idiopathique [Idiopathic pulmonary fibrosis]. Rev Prat. 2007;57(20):2227–34.
Swigris JJ, Brown KK. Idiopathic pulmonary fibrosis: a decade of progress. J Bras Pneumol. 2006;32(3):249–60.
Green FH. Overview of pulmonary fibrosis. Chest. 2002;122(6 Suppl):334S–9. 10.1378/chest.122.6_suppl.334s.
Garantziotis S, Steele MP, Schwartz DA. Pulmonary fibrosis: thinking outside of the lung. J Clin Invest. 2004;114(3):319–21. 10.1172/JCI22497.
Noble PW, Homer RJ. Back to the future: a historical perspective on the pathogenesis of idiopathic pulmonary fibrosis. Am J Respir Cell Mol Biol. 2005;33(2):113–20. 10.1165/rcmb.F301.
Alvarez-Sala R, Prados C, Garciá FR, et al. Fibrosis pulmonar idiopática: nuevas perspectivas diagnósticas y terapéuticas [Idiopathic pulmonary fibrosis: new diagnostic and therapeutic perspectives]. An Med Interna. 1993;10(7):355–60.
Buhl R, Meier-Sydow J, Vogelmeier C. Pathogenese der idiopathischen Lungenfibrose [Pathogenesis of idiopathic pulmonary fibrosis]. Immun Infekt. 1995;23(3):92–6.
Li M, Wang Y, Jin J, Dou J, Guo Q, Ke X, Zhou C, Guo M. Inhibitory Activity of Honeysuckle Extracts against Influenza A Virus In Vitro and Vivo. Virol Sin. 2021;36(3):490–500. https://doi.org/10.1007/s12250-020-00302-6.
Lee YR, Chang CM, Yeh YC, Huang CF, Lin FM, Huang JT, Hsieh CC, Wang JR, Liu HS. Honeysuckle Aqueous Extracts Induced let-7a Suppress EV71 Replication and Pathogenesis In Vitro and Vivo and Is Predicted to Inhibit SARS-CoV-2. Viruses. 2021;13(2):308. https://doi.org/10.3390/v13020308.
Shang X, Pan H, Li M, Miao X, Ding H. Lonicera japonica Thunb.: ethnopharmacology, phytochemistry, and pharmacology of an important traditional Chinese medicine. J Ethnopharmacol. 2011;138(1):1–21. https://doi.org/10.1016/j.jep.2011.08.016.
Lee HL, Kim JM, Go MJ, Kim TY, Joo SG, Kim JH, Lee HS, Kim HJ, Heo HJ. Protective Effect of Lonicera japonica on PM2.5-Induced Pulmonary Damage in BALB/c Mice via the TGF-β and NF-κB Pathway. Antioxid (Basel Switzerland). 2023;12(4):968. https://doi.org/10.3390/antiox12040968.
Kapanci Y, Desmouliere A, Pache JC, Redard M, Gabbiani G. Cytoskeletal protein modulation in pulmonary alveolar myofibroblasts during idiopathic pulmonary fibrosis. Possible role of transforming growth factor-beta and tumor necrosis factor-alpha. Am J Respir Crit Care Med. 1995;152(6 Pt 1):2163–9. https://doi.org/10.1164/ajrccm.152.6.8520791.
Polke M, Herth FJF. Immer besser therapierbar: Lungenfibrosen [Increasingly treatable: Pulmonary Fibrosis]. MMW Fortschr Med. 2023;165(Suppl 1):36–8. 10.1007/s15006-023-2331-3.
DeRemee RA, Andersen HA. Pulmonary fibrosis. Ann Intern Med. 1977;86(5):662–3. 10.7326/0003-4819-86-5-662.
Pardo A, Selman M. Molecular mechanisms of pulmonary fibrosis. Front Biosci. 2002;7:d1743-d1761. Published 2002 Aug 1. 10.2741/pardo MLA.
Yang H, Hua C, Yang X, Fan X, Song H, Peng L, Ci X. Pterostilbene prevents LPS-induced early pulmonary fibrosis by suppressing oxidative stress, inflammation, and apoptosis in vivo. Food Funct. 2020;11(5):4471–84. https://doi.org/10.1039/c9fo02521a.
Park SA, Kim MJ, Park SY, Kim JS, Lee SJ, Woo HA, Kim DK, Nam JS, Sheen YY. EW-7197 inhibits hepatic, renal, and pulmonary fibrosis by blocking TGF-β/Smad and ROS signaling. Cell Mol Life Sci. 2015;72(10):2023–39. https://doi.org/10.1007/s00018-014-1798-6.
Zhu Y, Tan J, Xie H, Wang J, Meng X, Wang R. HIF-1α regulates EMT via the Snail and β-catenin pathways in paraquat poisoning-induced early pulmonary fibrosis. J Cell Mol Med. 2016;20(4):688–97. 10.1111/jcmm.12769.
Zhang Z, Qu J, Zheng C, Zhang P, Zhou W, Cui W, Mo X, Li L, Xu L, Gao J. Nrf2 antioxidant pathway suppresses Numb-mediated epithelial-mesenchymal transition during pulmonary fibrosis. Cell Death Dis. 2018;9(2):83. https://doi.org/10.1038/s41419-017-0198-x.
Liu Y, Lu F, Kang L, Wang Z, Wang Y. Pirfenidone attenuates bleomycin-induced pulmonary fibrosis in mice by regulating Nrf2/Bach1 equilibrium. BMC Pulm Med. 2017;17(1):63. https://doi.org/10.1186/s12890-017-0405-7.
Wei HY, Ma X. Tamoxifen reduces infiltration of inflammatory cells apoptosis and inhibits the IKK/NF-kB pathway after spinal cord injury in rats. Neurol sciences: official J Italian Neurol Soc Italian Soc Clin Neurophysiol. 2014;35(11):1763–8. https://doi.org/10.1007/s10072-014-1828-z.
Savin IA, Zenkova MA, Sen'kova AV. Pulmonary Fibrosis as a Result of Acute Lung Inflammation: Molecular Mechanisms, Relevant In Vivo Models, Prognostic and Therapeutic Approaches. Int J Mol Sci. 2022;23(23):14959. 10.3390/ijms232314959. Published 2022 Nov 29.

No competing interests reported.

Rawdata.pdf

Download PDF

Editorial decision: Revision requested
20 Aug, 2024
Reviews received at journal
27 Jul, 2024
Reviewers agreed at journal
12 Jul, 2024
Reviewers agreed at journal
10 Jul, 2024
Reviews received at journal
24 Mar, 2024
Reviewers agreed at journal
13 Mar, 2024
Reviewers invited by journal
13 Mar, 2024
Editor assigned by journal
13 Mar, 2024
Editor invited by journal
03 Nov, 2023
Submission checks completed at journal
03 Nov, 2023
First submitted to journal
02 Nov, 2023

You are reading this latest preprint version

Rhoifolin Improves Bleomycin-induced Fibrosis in Vivo and in Vitro through NRF2/HO-1 Pathway

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Chemicals

Animal Treatment

BLM-Induced Pulmonary Fibrosis Rat Model

Pulmonary index

Histology

Masson staining

RNA Extraction and Real-time PCR

Western Blotting Analysis

Cell Culture

Cell Viability Assay

Analysis

Results

Effect of ROF on lung tissue damage in pulmonary fibrosis rats

Effect of ROF on fibrosis Severity in pulmonary fibrosis rats

Effect of ROF on BLM-Induced A549 Cells

Effect of ROF on inflammatory factors of A549 cells induced by LPS

Effect of ROF on NκB pathway induced by lipopolysaccharide in A549 cells

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1