The importance of the dihydrodaidzein racemase and dihydrodaidzein reductase activities and the host microorganism to achieve an efficient equol production by engineered lactic acid bacteria

doi:10.21203/rs.3.rs-3620459/v1

Equol is an isoflavone produced from daidzein by the microbial metabolism and it is of great interest for human health. Since equol production was described in bacteria that are difficult to grow and considered unsafe, the heterologous expression of genes involved in equol production in Generally Recognized As Safe (GRAS) and easily culturable bacteria is of great interest for the production of equol in large quantities. The heterologous expression of daidzein reductase (dzr), dihydrodaidzein reductase (ddr), tetrahydrodaidzein reductase (tdr) and dihydrodaidzein racemase (ifcA) from Slakia isoflavoniconvertens DSM 22006 in GRAS bacteria demonstrated that these bacteria were capable of producing equol from dihydrodaidzein (DHD), but only a few strains could produce equol from daidzein, always in low concentrations, with the exception of Limisolactobacillus fermentum INIA 584L and Limosilactobacillus fermentum INIA 832L. This study demonstrated that lactic acid bacteria can be engineered to produce bioactive compounds such as equol with high efficiency and the much higher production of equol by these strains was due to the greater activities of dihydrodaidzein racemase (DDRC), which acts in conjunction with daidzein reductase to produce DHD (S), and dihydrodaidzein reductase (DHDR), which may be related with the reducing power. In addition, the heterologous expression of ddr in GRAS bacteria produced equol and dehydroequol from DHD in addition to tetrahydrodaidzein.

Equol

dihydrodaidzein racemase

dihydrodaidzein reductase

NADPH

engineered bacteria

Equol is the most stable isoflavone, with the highest estrogenic [1] and antioxidant activity [2]; it is easily absorbed and has a lower clearance than daidzein [3]. For these reasons, equol plays an important role in the prevention of different chronic diseases, including cancer, menopause and cardiovascular disease [4–6]. However, equol is produced by only 25–50% of humans (so-called equol producers); this percentage depends of the dietary habits, the country and the type of community [8–9]. The Asian population has a higher percentage of equol producers, whereas this percentage is lower in Western countries [10]. Therefore, the development of functional foods enriched in equol is of great interest for people everywhere, and especially for those people whose microbiota is incapable of producing equol, or who produce it in low concentrations after ingesting foods rich in isoflavones such as soybeans or soy beverages. These functional foods enriched in equol would be of great relevance to combat, prevent or alleviate the symptoms of certain diseases related to aging such as menopause, cardiovascular diseases, metabolic syndrome, diabetes and neurodegenerative diseases.

The metabolic pathway from daidzein to equol has been elucidated in different prokaryotic microorganisms such as Slackia sp. strain NATTS, Lactococcus garviae 20–92, Eggerthella sp. strain YY7918 and Slackia isoflavoniconvertens DSM 22006 capable of producing equol [5]. Moreover, the daidzein reductase (dzr), dihydrodaidzein reductase (ddr), tetrahydrodaidzein reductase (tdr) and dihydrodaidzein racemase (ifcA) genes were identified as responsible for equol production in different equol-producing strains, such as S. isoflavoniconvertens (Fig. 1S) [11]. However, most of these bacteria have two drawbacks: they cannot be used in food as they are not considered GRAS and they are fastidious bacterium, moreover they grow poorly, making it difficult to produce equol in high concentrations. Therefore, transferring their metabolic engineering from bacteria such as S. isoflavoniconvertens, Adlercreutzia equolifaciens and Asaccharobacter celatus to GRAS bacteria is a possible solution to produce this compound in high concentrations [12, 13]

The heterologous expression of the dzr, ddr, tdr and ifcA genes of S. isoflavoniconvertens in L. fermentum INIA 584L and L. fermentum INIA 832L showed high equol production, with important differences compared to other LAB strains such as Lactococcus lactis MG1363, Lactiplantibacillus plantarum WCFS1 and Lacticaseibacillus casei BL23 [12]being apparent. Moreover, these previous tests raised doubts about the functioning of dihydrodaidzein racemase (DDRC), since DDRC only seemed to work in L. fermentum INIA 584L and L. fermentum INIA 832L, the only strains that showed high equol production. Even in these two strains, DDRC did not seem to have an effect on the transformation of dihydrodaidzein (DHD) to equol, contrary to what was shown in previous works [14]. In addition, Mayo et al. [5] also found problems in the production of equol by LAB from the heterologous expression of equol biosynthesis genes from Adlercreutzia equolifaciens [15].

Since the development of equol-enriched functional foods to combat and prevent age-related diseases is very interesting, in this work we extended the heterologous expression of the dzr, ddr, tdr and ifcA genes of Slackia isoflavoniconvertens to new species and genera of LAB as well as a bifidobacteria strain (Table 1). Later, our objective was to understand which enzymes are responsible for the differences between the strains capable of producing high concentrations of equol (L. fermentum INIA 584L and L. fermentum INIA 832L), and the rest of bacteria, and to study their mechanism of action. In addition, we discovered important new aspects of DHDR in equol production.

Equol production by LAB and bifidobacteria strains harbouring dzr^P, ddr-tdr^P and ifcA^P

The work previously developed by our group [12] was extended with new LAB and bifidobacteria strains, such as S. thermophilus INIA 461, E. faecalis INIA 4, L. reuteri INIA P572, L. fermentum INIA P143, L. paracasei INIA P272, L. rhamnosus INIA P540 and B. breve INIA P734. Moreover, we also used L. lactis MG1363, L. fermentum INIA 584L and L. fermentum INIA 832L previously used by Ruiz de la Bastida et al. (2021). We observed that the new strains harbouring dzr^P and ddr-tdr^P either did not produce equol from daidzein, or the equol production was in concentrations lower than that shown by L. fermentum INIA 584L and L. fermentum INIA 832L, and even lower than those produced by L. lactis MG1363 (Figure 1A). We did not observe equol production from daidzein by B. breve INIA P734, S. thermophilus INIA 461, L. rhamnosus INIA P540 or E. faecalis INIA 4 harbouring dzr^P and ddr-tdr^P. However, L. reuteri INIA P572, L. fermentum INIA P143 and L. paracasei INIA P272 harbouring dzr^P and ddr-tdr^P produced between 4.76 ± 0.94 and 16.34 ± 1.90 µM of equol from daidzein (Figure 1A).

The incorporation of the heterologous expression of dihydrodaidzein racemase (ifcA) only showed an increase in equol production in L. fermentum INIA 584L and L. fermentum INIA 832L. The production of equol from daidzein by L. fermentum INIA 584L increased from 44.34 ± 3.26 to 172.70 ± 10.02 µM with the incorporation of the heterologous expression of ifcA. Meanwhile, the equol production from daidzein by L. fermentum INIA 832L increased from 38.34 ± 6.45 to 165.70 ± 12.41 µM.

All the new strains harbouring tdr-ddr^P showed equol production from DHD, although at concentrations always lower than 25 µM. The production of equol from DHD for these strains was much lower than the production of equol using L. fermentum INIA 584L and L. fermentum INIA 832L (Figure 1B). The incorporation of the heterologous expression of ifcA (ifcA^P) did not show an increase in equol production from DHD in any of the strains used.

Effect of the heterologous expression of ifcA in the production of equol from daidzein and DHD

After the results of the equol production by LAB and bifidobacteria strains observed in this work and previously by Ruiz de la Bastida et al. [12], we focused our work on the heterologous expression of ddr and ifcA, because both DDRC and DHDR could be responsible for the differences in the equol production observed between the different bacteria studied.

L. lactis strains harbouring (dzr^P + ddr-tdr^P) and (dzr^P + ddr-tdr^P + ifcA^P) showed an equol production of 22.83 ± 2.67 µM and 20.76 ± 2.26 µM, respectively. Hence, the heterologous expression of ifcA in L. lactis MG1363 did not seem to affect the equol production. Whereas, as mentioned above, the heterologous expression of ifcA together with dr and ddr-tdr (dzr^P + ddr-tdr^P + ifcA^P), in L. fermentum INIA 584L and L. fermentum INIA 832L, showed an increase in equol production 4 to 5 times greater with respect to that observed without the presence of ifcA (Table 2).

The most interesting data appeared when L. lactis harbouring dzr^P and tdr-ddr^P (dr + ddr-tdr) were co-incubated with L. fermentum INIA 584L or L. fermentum INIA 832L harbouring ifcA^P (dzr^P + ddr-tdr^P + ifcA^PL. fer.584L or ifcA^P L. fer.832L). Equol production increased two to three-fold in the presence of the heterologous expression of ifcA in L. fermentum INIA 584L (42.15 ± 1.67 µM) and L. fermentum INIA 832L (43.25 ± 3.18 µM) (Table 2). This data demonstrated that the heterologous expression of ifcA from S. isoflavoniconvertens in L. fermentum strains helps to increase equol production by L. lactis harbouring dzr^P and tdr-ddr^P.

On the other hand, the coincubation of L. lactis harbouring dzr^P and L. fermentum 584L harbouring tdr-ddr^P showed a production of 36.56 ± 6.34 µM of equol, and the addition of L. fermentum INIA 584L harbouring ifcA^P showed an important increase in equol production (158.32 ± 13.12 µM). Equol production was similar when L. fermentum 584L harbouring tdr-ddr^P and ifcA^P were combined with L. lactis harbouring dzr^P (158.32 ± 13.12 µM) and L. fermentum 584L harbouring dzr^P (172.70 ± 10.02 µM) (Table 2).

Finally, the heterologous expression of dr, tdr-ddr and ifcA in L. fermentum INIA 584L and L. fermentum INIA 832L showed a higher production of equol from daidzein than from DHD, whereas L. lactis harbouring tdr-ddr^P showed higher equol production from DHD (Table 3). The heterologous expression of ifcA did not demonstrate any effect on equol production from DHD in L. lactis and L. fermentum strains. However, the combination of L. lactis harbouring tdr-ddr^P and L. fermentum INIA 584L harbouring ifcA^Pdid show an effect of the heterologous expression of ifcA, and a significant increase in equol production from DHD was observed.

Effect of the heterologous expression of ifcA on DHD production from daidzein

In order to understand the differences observed in the amount of equol produced by the presence of DDRC, we studied how DDRC influenced the production of DHD and THD cis and THD trans. As mentioned above, the effect of DDRC on the production of equol from DHD was low, and, in addition, we observed that the heterologous expression of (dzr^P + tdr-ddr^P + ifcA^P) was capable of transforming most of the daidzein into equol in L. fermentum INIA 584L and 832L. Thus, something is happening in the transformation of daidzein into DHD and THD in L. fermentum INIA 584L and 832L that facilitates the production of equol when DDRC is present.

The heterologous expression of ifcA in L. fermentum INIA 584L produced an increase in the transformation of daidzein in DHD by L. fermentum INIA 584L dzr^P following 4, 8, 12, 16 and 24 hours of incubation (Figure 2A). At longer times, 36 hours or more, we did not observe a significant effect of ifcA on the production of DHD, since most of the daidzein was transformed into DHD. We could not differentiate DHD-R from DHD-S. However, we observed an increase in the rate of transformation of daidzein into DHD with the heterologous expression of ifcA in L. fermentum strains.

On the other hand, no difference was observed in DHD production when L. lactis harbouring dzr^P or L. lactis harbouring dzr^P and ifcA^P were incubated with daidzein (Figure 2B). However, when L. lactis dzr^P was incubated with L. fermentum INIA 584L ifcA^P, we observed an increase in the rate of transformation of daidzein into DHD, similar to that observed in Figure 2A.

Effect of the heterologous expression of ifcA on the production of THD from daidzein

ddr was cloned separately from tdr to observe the formation of THD cis and THD trans in order to understand the differences observed in the amount of equol produced by the presence of DDRC. The incubation of L. lactis and L. fermentum INIA 584L and L. fermentum INIA 832L harbouring dzr^P and ddr^P with daidzein clearly showed the formation of both THD cis and THD trans. The absence of the heterologous expression of ifcA, L. fermentum INIA 584L and L. fermentum INIA 832L showed that the area ratios of THDcis/THDtrans measured by HPLC-ESI/MS were 1.51 ± 0.14 and 1.48 ± 0.21, respectively (Table 4). While an area ratio of 1.26 ± 0.08 was observed in the case of L. Lactis. This demonstrated a higher THD cis production from daidzein in the absence of DDRC.

The heterologous expression of ifcA together with dzr and ddr (dr^P + ddr^P + icfA^P) clearly showed a change in the ratio of THD trans/THD cis areas as a consequence of an increase in THD trans and a decrease in THD cis concentrations. Thus, the concentration of THD trans produced in the presence of the DDRC was three times that of THD cis in L. fermentum INIA 584L and double that in L. fermentum INIA 832L.

L. lactis MG1363 (dr^P + ddr^P) showed a THD trans/THD cis ratio of 1.26 ± 0.08, whereas the incorporation of the heterologous expression of ifcA (dr^P + ddr^P + icfA^P) showed a ratio of 1.18 ± 0.06. When L. lactis MG1363 (dr^P + ddr^P) was incubated together with L. fermentum INIA 584L ifcA^P, it showed a ratio of 0.77 ± 0.11. A higher concentration of THD trans compared to THD cis was also observed with the heterologous expression of ifcA, and this difference increased with the heterologous expression of ifcA in the L. fermentum strains (Table 4).

L. fermentum strains (dr^P + ddr^P) showed a THD production between 10 and 20 times greater than that shown by L. lactis (dr^P + ddr^P), both in the presence and absence of the heterologous expression of ifcA (Figure 3A). These differences were observed despite the fact that most of the daidzein had been transformed into DHD in both the L. fermentum strains and in L. lactis. This data demonstrated a much higher activity of DHDR in these L. fermentum strains.

In addition, the heterologous expression of dzr and ddr (dr^P + ddr^P) in both L. fermentum strains showed the production of equol and a compound that was identified as dehydroequol (C₁₅H₁₂O₃) (Figure 3B). Moreover, the heterologous expression of ifcA together with that of dzr and ddr increased the production of equol and dehydroequol. While the heterologous expression of ddr in L. lactis did not show the production of these compounds, possibly as a consequence of the lower production of THD.

Effect of the heterologous expression of ifcA on the production of THD from DHD

The heterologous expression of ddr in both L. fermentum strains showed a 5 to 10 fold greater production of THD from DHD compared to when ddr was expressed in L. lactis (Figure 3C). As for daidzein, THD production was higher in the L. fermentum strains, demonstrating the highest DHDR activity in the L. fermentum strains. On the other hand, the heterologous expression of ifcA did not show variations in the THD cis/THD trans ratio in the transformation of DHD in THD (Table 4).

The heterologous expression of ddr in L. fermentum INIA 584L and L. fermentum INIA 832L also showed equol (32.18 ± 3.35 and 29.92 ± 5.76 µM) and dehydroequol (8.18 ± 2.45 and 9.06 ± 1.85 µM) production from DHD. From DHD, we also observed the production of equol (5.19 ± 2.32 µM) and dehydroequol (3,67 ± 1,63 µM) with the heterologous expression of ddr in L. lactis, although at a significantly lower concentration than that produced in the L. fermentum strains (Table 4). Moreover, the heterologous expression of ifcA in L. fermentum INIA 584L INIA 832L showed an increase in equol production from DHD by DHDR, although the increase in equol production due to the presence of DDRC was not significant (Table 4).

Role of the heterologous expression of tdr in equol production:

tdr was also cloned independently of ddr and its heterologous expression was analyzed. As expected, coincubations of the different strains harbouring ddr^P with the same strains harbouring tdr^P showed an increase in equol production mainly by the L. fermentum strains. So, whereas L. fermentum INIA 584L and 832L (dr^P + ddr^P + ifcA^P) produced 44.13 ± 5.63 and 45.56 ± 7.80 µM of equol from daidzein, respectively, the incorporation of the heterologous expression of tdr (dr^P + ddr^P +tdr^P + ifcA^P) showed an equol production of 141.14 ± 8.23 and 124.27 ± 8.34 µM, respectively (Table 5). The incorporation of tdr^P produced a decrease in both THD cis and THD trans as a consequence of the increase in the transformation of THD into equol. Moreover, when we used DDRC in addition to DHDR and THDR the concentrations of both THD cis and THD trans practically disappeared (Figure 6).

As mentioned above, DHDR acts on DHD to mainly produce THD, and also to produce equol and dehydroequol. However, the combination of DHDR and THDR increases the efficiency of equol production and decreases the concentration of dehydroequol (Table 4).

The heterologous expression of ddr and tdr in the same cells (ddr-tdr^P), or in different cells (ddr^P + tdr^P), showed differences in equol production (Table 3). Coincubation of tdr and ddr on separate cells (tdr^P + ddr^P) showed a decrease in equol production. We observed that L. fermentum INIA 584L and L. fermentum INIA 832L (dr^P+ ddr-tdr^P+ ifcA^P) produced 172.70 ± 10.02 and 165.70 ± 12.41 µM of equol, respectively, from daidzein, whereas L. fermentum INIA 584L and L. fermentum INIA 832L (dr^P + ddr^P + tdr^P + ifcA^P), produced 141.14 ± 8.23 and 124.27 ± 8.34 µM of equol, respectively (Table 4). Similar results were observed in the equol production from DHD, although the differences were not significant.

Effect of NADPH on equol production

To study the influence of the presence of NADPH on equol production, L. lactis MG1363 and L. rhamnosus INIA P540 harbouring (dr^P + ddr-tdr^P + ifcA^P) or (ddr-tdr^P + ifcA^P) were incubated with daidzein and DHD, respectively, in the presence and absence of NADPH. The presence of NADPH showed a significant increase in equol production from both daidzein and DHD. L. lactis MG1363 harbouring (dr^P + ddr-tdr^P + ifcA^P) and (ddr-tdr^P + ifcA^P) produced 20.26 + 1.20 and 29.50 + 2.16 µM of equol from daidzein and DHD, respectively, in the absence of NADPH. Whereas the presence of NADPH showed an equol production of 29.52 + 2.95 and 38.27 + 1.98 µM from daidzein and DHD, respectively (Figure 4).

On the other hand, L. rhamnosus INIA P540 (dr^P + ddr-tdr^P + ifcA^P) was unable to produce equol from daidzein, and L. rhamnosus INIA P540 (ddr-tdr^P + ifcA^P) was only able to produce 1.55 ± 0.85 µM of equol from DHD, in the absence of NADPH. Whereas, L. rhamnosus INIA P540 (dr^P + ddr-tdr^P + ifcA^P) produced 8.05 ± 1.10 µM of equol from daidzein, and L. rhamnosus INIA P540 (ddr-tdr^P + ifcA^P) produced 9.67 ± 1.65 µM of equol from DHD, in the presence of NADPH (Figure 4).

The heterologous expression of dzr, ddr, tdr and ifcA genes from S. isoflavoniconvertens DSM22006 in different LAB and Bifidobacterium strains showed differences in equol production, and also in DDRC functioning. We observed the low or null production of equol from daidzein by most of the LAB strains, with the exception of L. fermentum INIA 584L and L. fermentum INIA 832L in concordance with a previous work [12]. Moreover, L. fermentum INIA 584L and L. fermentum INIA 832L were the only strains that showed an evident influence of DDRC on the production of equol agreeing with a previous work [12]. On the other hand, Mayo et al. [5] also verified that the heterologous expression of dzr, ddr, tdr and ifcA of Adlercreutzia equolifaciens DSM19450TL in L. casei only produced a small amount of equol from dihydrodaidzein, but did not produce any equol from daidzein. Therefore, with the exception of L. fermentum INIA 584L and L. fermentum INIA 832L, the production of equol through the heterologous expression of dzr, ddr, tdr and ifcA from intestinal microorganisms in LAB seems a difficult strategy, providing poor results with the exceptions of two L. fermentum strains. The study of the heterologous expression of these genes in L. fermentum strains, and its comparison with the heterologous expression in L. lactis, helped to understand how DZR, THDR, DHDR and DDRC work in the production of equol, and the possible reasons for the high efficient equol production in the two L. fermentum strains mentioned.

Schröder et al. [11] demonstrated that DZR from S. isoflavoniconvertens exclusively formed the (R)-enantiomers of dihydrodaidzein from daidzein; however, racemic mixtures were observed during conversion by the cell extracts. We could not detect the different DHD isomers by HPLC or HPLC-ESI/MS. However, the heterologous expression of ddr from S. isoflavoniconvertens in L. fermentum and L. lactis strains showed the production of THD cis and THD trans from DHD, as well as from daidzein with the help of DZNR (Fig. 3). Since DHDR transforms DHD-S into THD trans and DHD-R into THD cis [14], we concluded that heterologous expression of dzr from S. isoflavoniconvertens in LAB produces a higher concentration of DHD-R compared to DHD-S, and the ratio of production of both isomers varies between the different strains in the same way as the ratio of THD cis and THD trans does (Table 4). However, part of the THD trans had been transformed by DHRC into equol and dehydroequol in L. fermentum strains (Fig. 5A).

Peirotén et al. [16] showed that DZR worked very well in different LAB and bifidobacterium strains and DHD production from daidzein did not show important differences between LAB strains. In concordance with these data, the incubation of L. lactis dzr^P with L. fermentum INIA 584L tdr-ddr^P showed an equol production similar to that demonstrated with L. fermentum INIA 584L dzr^P and L. fermentum INIA 584L tdr-ddr^P (Table 2). The different activity of DHDR and THDR, together with the already mentioned different activity of DDRC, could be responsible for the different equol production in LAB strains. Therefore, we set out to study the heterologous expression of ddr and tdr in L. fermentum INIA 584L, L. fermentum INIA 832L and in L. lactis MG136, and delve into DDRC with the aim of being able to understand how these enzymes work.

L. fermentum strains ddr^P showed greater THD production from daidzein and DHD compared to L. lactis ddr^P (Fig. 3A and 3C) in the presence and absence of DDRC. These results demonstrated the higher activity of DHDR in L. fermentum INIA 584L and L. fermentum INIA 832L. Moreover, the heterologous expression of ddr in L. fermentum showed the production of equol and dehydroequol without the heterologous expression of tdr (Table 4, Fig. 3B, Fig. 5B). However, L. lactis ddr^P was only capable of producing equol from daidzein with the heterologous expression of tdr. Hence, it is evident that the greater activity of DHDR is responsible for the differences between L. fermentum INIA 584L and 832L and the rest of the microorganisms. While tdr does not appear to be important in the observed differences in equol production, since most of the THD cis and THD trans disappear in both L. lactis and L. fermentum strains with the heterologous expression of tdr (Fig. 6).

The other important difference in equol production is that the heterologous expression of ifcA only showed significant increases in equol production in the L. fermentum strains, and mainly from daidzein. Since the presence of DHD(R) and DHD(S) could not be analyzed, we studied the production of THD cis and THD trans. The proportions of both THD cis and THD trans produced from daidzein by DHDR and DZR changed with the heterologous expression of ifcA, increasing the concentration of THD trans and reducing that of THD cis (Table 4), probably due to a previous increase in DHD (S). This would justify the increase in equol production in L. fermentum INIA 584L and L. fermentum INIA 832L when DDRC is present.

Furthermore, as shown in Table 4 and Fig. 3S, part of the THD trans is transformed into equol and dehydroequol. Therefore, the proportion of THD trans is still higher than that shown in the THD cis/THD trans ratio in Table 4. Thus, the heterologous expression of ifcA in combination with that of ddr in L. fermentum INIA 584L and 832L really showed a production of THD trans between 4 to 5 times greater than THD cis, in other words, DDRC and DZR produced between 4 to 5 times more DHD (S) than DHD (R) from daidzein.

The heterologous expression of ifcA in L. fermentum 584L and L. fermentum 832L harbouring dzr^P and tdr-ddr^P showed greater equol production from daidzein than from DHD. Therefore, DDRC is mainly active in the transformation of daidzein into equol, according to the data previously shown by Ruiz de la Bastida et al. [12]. On the other hand, the low effect on equol production from DHD and the higher production of equol from daidzein compared to DHD in the engineered L. fermentum strains suggest that DDRC increases equol production mainly through facilitating the direct transformation of daidzein into DHD(S) (Fig. 3S). Moreover, the increase in the rate of DHD production with the presence of DDRC (Fig. 2) suggests that DDRC acts jointly with DZNR (Fig. 5B), favouring the production of DHD (S), followed by THD trans and finally equol.

DDRC also has a slight effect on the transformation of DHD (R) to DHD (S) (Fig. 5B and 5C), since the combination of L. lactis tdr-ddr^P and L. fermentum INIA 584L ifcA^P (Table 3) showed a small increase in equol production from DHD when the concentration of equol produced was low. Furthermore, the concentrations of THD cis and THD trans practically disappear when all the enzymes involved in equol production were present (Fig. 6). Moreover, when the TDHR was present, it was the main responsible in the transformation of THD trans in equol, and dehydroequol practically disappeared. All this justifies the high efficiency in the transformation and production of equol when DZR, DDRC, DHDR and THDR were present in L. fermentum strains (Fig. 5C). In this work, and in previous works [12], we showed that DDRC has a low effect on equol production from DHD.

How can we explain the increased activity of DHDR and DDRC in L. fermentum 584L and L. fermentum 832L? Langa et al. [13] demonstrated that the presence of DHDR and DZR in the same cells has a higher impact on equol since the reactions take place within the same cell. However, when the reactions were compartmentalized in L. fermentum INIA 584L harbouring separate DZNR and DHDR strains, i.e., daidzein is reduced by L. fermentum INIA 584L dzr^P, while DHD is transformed by L. fermentum INIA 584L tdr-ddr^P, an increase in equol production was observed. This beneficial effect of the compartmentalization of DHDR and DZR was also demonstrated previously for 5-hydroxy-equol production in recombinant E. coli [17]. These results are a consequence of DZR and DHDR requiring NADPH for their activity [13, 17, 18], while L-THDR requires neither NADPH nor NADH, and both DHDR and THDR enzymes may be working together in the same cell as has been demonstrated [12, 13]. In addition, NADPH showed an increase in equol production in L. lactis and L. rhamnosus INIA P540 harbouring genes involved in equol production (Fig. 4). The reducing power could be responsible for the increased activity of DHDR in L. fermentum INIA 584L and L. fermentum INIA 832L. On the other hand, the reducing power is not responsible for the higher activity of DDRC, since cloning dzr and ifcA in the same vector in E. coli did not demonstrate an influence on the production of 5-hydroxy-equol from genistein [17].

This study demonstrated that lactic acid bacteria can be engineered to produce bioactive compounds such as equol with high efficiency, although, it is necessary to use a suitable host. So, the higher activities of DDRC and DHDR in L. fermentum INIA 584L and L. fermentum INIA 832L are responsible for the much greater equol production by these two strains. DHDR has the ability to transform DHD into THD, equol and dehydroequol, and the reducing power could be responsible for greater activity of DHDR in these L. fermentum strains. Although the causes of the greater activity of DDRC in L. fermentum strains is unknown to date, we have demonstrated that DDRC increases the concentration of DHD(S) mainly in L. fermentum INIA 584L and L. fermentum INIA 832L, facilitating the increase in THD (trans) and after equol. The increase in DHD(S) occurs mainly as a consequence of the transformation of daidzein into DHD(S), with DDRC and DZNR working together.

Bacterial strains and culture conditions

The bacterial strains and plasmids used in this study are listed in Table 1 [16, 19–23]. Lactococcus lactis MG1363, Streptococcus thermophilus INIA 468 and their transformants were grown at 30°C in M17 broth (Scharlab, Senmanat, Spain) supplemented with 0.5% glucose (Sigma Merck KGaA, Darmstadt, Germany) (GM17) under aerobic conditions. Lactobacilli and Enterococci strains and their transformants were routinely cultivated at 37 ºC in MRS broth (BD Biosciences, Le Pont de Claix, France) under anaerobic conditions (10% H₂, 10% CO₂ and 80% N₂. Whitley DG250 Anaerobic workstation, Don Whitley Scientific Ltd., Shipley, UK). Bifidobacterium breve INIA P734 and their transformants were cultivated in MRS broth (BD; Becton, Dickinson &Co., Le Pont de Claix, France) supplemented with 0.5 g/L L-cysteine (Sigma-Aldrich, St Louis, MO), at 37°C under anaerobic conditions. A final concentration of 5 µg/mL of cloramphenicol (Sigma Merck) was used for the grown of transformed strains.

Equol production for LAB and bifidobacteria strains harboring dzr, ddr-tdr and ifcA.

The experiments carried out by Ruiz de la Bastida et al. [12] were extended with new strains. Thus, Limosilactobacillus reuteri INIA P572, Limosilactobacillus fermentum INIA P143, Lacticaseibacillus paracasei INIA P272, Bifidobacterium breve INIA P748, Streptococcus thermophilus INIA 468 and Enterococcus faecalis INIA4 were transformed with pNZ:TuR.dzr (dzr^P), pNZ:TuR.tdr-ddr (tdr-ddr^P) and pNZ:TuR.ifcA (ifcA^P) (Table 1) and incubated in BHI (BD; Becton, Dickinson &Co., Le Pont de Claix, France) medium with daidzein (50 mg/L; 196,77 µM) according with Ruiz de la Bastida et al. (2021). Strains were added at 1% (v/v) and they were incubated for 48 hours at 30ºC or 37 ºC in anaerobic conditions. Later, the same strains harbouring tdr-ddr^P and ifcA^P were incubated BHI medium supplemented with DHD (50 mg/L; 195,12 µM) in the same conditions above mentioned. In addition, L. fermentum INIA 584L, L. fermentum INIA 832L and L. lactis MG1363 harbouring dzr^P, tdr-ddr^P and ifcA^P (Ruiz de la Bastida et al., 2021) were also included in the experiments. After the incubation time, the samples were frozen at -30 ºC until their extraction and subsequent analysis.

Cloning of the dihydrodaidzein reductase and tetrahydrodaidzein reductase gene independently

The gene encoding dihydrodaidzein reductase (ddr) from Slackia isoflavoniconvertens DSM 22006T was amplified by PCR using F-DHDr (5´-TTTTCATGACACAAGAGGTTAAGGCTCCG) and R-DHDr (5´- TTTTCTAGATTAGGCGATTTCGCCCTGCATAGCGC) oligonucleotides. On the other hand, the gene encoding the tetrahydrodaidzein reductase (tdr) from S. isoflavoniconvertens DSM 22006T was amplified by PCR using F-THDr (5´- TTTTCATGACAGAATTCGACGTTGAATACGATC) and R-THDr (5´- TTTTCTAGATTACATGTTTGCAATCGCGTGGC) oligonucleotides. The forward primers introduced a BspHI site around the initiation codon of both dzr and tdr genes, and the reverse primers introduced an XbaI site downstream of the stop codon of both dzr and tdr genes. The PCR products were digested with the two restriction enzymes and ligated into vector pNZ:TuR [24]digested with NcoI and XbaI. BspHI produces NcoI compatible cohesive (sticky) ends. The ligation mixtures harbouring pNZ:TuR.dhdr and pNZ:Tu.thdr were transformed into L. lactis MG1363 by electroporation (Landete, Arqués, Peirotén, Langa, & Medina, 2014a) and transformants were selected with chloramphenicol (5 µg/ml, Sigma Aldrich) and checked by restriction mapping and sequencing of the inserted fragment.

Later, L. fermentum INIA 584 and L. fermentum INIA 832 were transformed with the pNZ:TuR.dhdr and pNZ:TuR.thdr as described by Landete et al. [25], and selected in MRS plate with chloramphenicol (5 µg/ml, Sigma Aldrich).

Effect of the heterologous expression of the ifcA in the production of equol

New assays with L. Lactis MG1363, L. fermentum INIA 584L and L. fermentum INIA 832L and their transformants were performed to understand how DDRC work in the equol production. So, L. lactis MG1363, L. fermentum INIA 584L and L. fermentum INIA 832 harbouring dzr^P, tdr-ddr^P and ifcA^P were co-incubated according to Tables 2 and 3 in BHI medium supplemented separately with daidzein (50 mg/L; 196,77 µM) (Table 2) and DHD (50 mg/L; 195,12 µM) (Table 3). Strains were added at 1% (v/v) and they were incubated for 48 hours at 30ºC in anaerobic conditions. After the incubation time, the samples were frozen at -30 ºC until their extraction and subsequent analysis.

Effect of the heterologous expression of the ifcA in the production of dihydrodaidzein

L. Lactis MG1363, L. fermentum INIA 584L and L. fermentum INIA 832L harbouring dzr^P and ifcA^P were co-incubated in BHI medium supplemented with daidzein (50 mg/L; 196,77 µM). LAB strains were added at 1% (v/v) to a they were incubated at 30 ºC ºC for 0, 4, 8, 12, 16, 24 and 36 h under anaerobic conditions. After the incubation time, the samples were frozen at -30 ºC until their extraction and subsequent analysis.

Effect of the heterologous expression of the ifcA in the production of tetrahydrodaidzein

L. Lactis MG1363, L. fermentum INIA 584L and L. fermentum INIA 832 L. harbouring dzr^P, pNZ:Tu.dhdr and ifcA^P were co-incubated according to table 4. Strains were added at 1% (v/v) to a BHI medium supplemented with daidzein (50 mg/L; 196,77 µM) and they were incubated at 30 ºC ºC for 72 h under anaerobic conditions. On the other hand, L. Lactis MG1363, L. fermentum INIA 584L and L. fermentum INIA 832L harbouring tdr-ddr^P were incubated with the strains harbouring ifcA^P according to table 4. Strains were added at 1% (v/v) to a BHI medium supplemented with dihydrodaidzein (50 mg/L; 195,12 µM) and they were incubated at 30 ºC ºC for 72 h under anaerobic conditions.

Experiments were completed with the incorporation of L. Lactis MG1363, L. fermentum INIA 584L and L. fermentum INIA 832L harboring tdr^P to study the role of heterologous expression of tdr in the equol production. So, these strains were added at 1% (v/v) to a BHI medium: A) supplemented with daidzein (50 mg/L; 196,77 µM) and strains harbouring dzr^P, pNZ:Tu.dhdr and ifcA^P (Table 4). B) Supplemented with dihydrodaidzein (50 mg/L; 195,12 µM) and strains harbouring pNZ:Tu.dhdr and ifcA^P (Table 4). Samples were incubated at 30 ºC ºC for 72 h under anaerobic conditions. After the incubation time, the samples were frozen at -30 ºC until their extraction and subsequent analysis.

Influence of NADPH on the equol production

L. lactis MG1363 and L. rhamnosus INIA P540 harbouring dz, ddr-thdr and ifcA were added at 1% (v/v) to a BHI medium supplemented with daidzein (50 mg/L; 196,77 µM) with or without NADPH (5 µM) (Sigma Merck KGaA, Darmstadt, Germany) and they were incubated at 30 ºC or 37ºC for 72 h under anaerobic conditions.

Later, L. lactis MG1363 and L. rhamnosus INIA P540 harbouring ddr-thdr and ifcA were added at 1% (v/v) to a BHI medium supplemented with DHD (50 mg/L; 195,12 µM) and with or without NADPH (5 µM) (Sigma Merck KGaA, Darmstadt, Germany) and they were incubated at 30 ºC or 37ºC for 72 h under anaerobic conditions. After the incubation time, the samples were frozen at -30 ºC until their extraction and subsequent analysis.

Extraction of isoflavones

After incubations of the transformed LAB strains in the combinations and conditions described above, isoflavones were extracted from the culture medium twice with 2 mL of diethyl ether and twice with 2 mL of ethyl acetate, according to Gaya et al. [26] and Gaya et al. [27]. The solvents were evaporated at room temperature under a N₂ stream, and the residue was dissolved in 300 µL methanol/water (50:50, v/v). Filtering, through a 0.22 µm cellulose acetate filter (Millipore, Madrid, Spain), was performed before transferring the extracts to HPLC vials and storing them at -30ºC.

Identification and quantification of isoflavones

Isoflavones were analyzed by HPLC-ESI/MS as described in Gaya et al. (2016a) and Gaya et al. (2016b). Quantification was carried out by means of external standard calibration curves of equol, DHD, daidzein (LC Laboratories, Woburn, MA, USA). Stock solutions (10 mg/L) of polyphenols were prepared in DMSO (Merck KGaA). Tetrahidrodaidzein was not available as a standard in any commercial house and therefore we only analysed the area.

Statistical analysis

Statistical analysis of the isoflavones concentration was performed using the SPSS Statistics 22.0 software (IBM Corp., Armonk, NY, USA). Data were analyzed by ANOVA using a general lineal model (GLM). Comparison of means was carried out by Tukey test, with a confidence interval of 99%.

Acknowledgements

This work was supported by PID2020-11960RB-I00 from the Spanish Ministry of Science and Innovation. A.R.d.l.B. is recipient of a Pre-doctoral contract (PRE2018-086293). We are grateful to the ICTAN (Institute of Food Science, Technology and Nutrition, Madrid, Spain) Analysis Services Unit for providing chromatography and mass spectrometry facilities.

Author statement

S.L. and J.A.C.executed most of the experiments, collected data and wrote the original version of the manuscript. A. R.d.l.B. and A.P.analyzed the data and contributed to wrote de manuscript. J.M.L. conceived the study and designed the experiments.

Declarations Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interest.

Jackson RL, Greiwe JS, Schwen RJ. Emerging evidence of the health benefits of S-equol, an estrogen receptor β agonist. Nutr Rev. 2011;69:432–448.
Choi EJ, Kim GH. The antioxidant activity of daidzein metabolites, O-desmethylangolensin and equol, in HepG2 cells. Mol Med Rep. 2014;9:328–332.
Setchell KD, Faughnan MS, Avades T, Zimmer-Nechemias L, Brown NM, Wolfe BE, Brashear WT, Desai P, Oldfield MF, Botting NP, et al. Comparing the pharmacokinetics of daidzein and genistein with the use of 13C-labeled tracers in premenopausal women. Am J Clin Nutr. 2003;77:411–419.
Alfa HH, Arroo RRJ. Over 3 decades of research on dietary flavonoid antioxidants and cancer prevention: What have we achieved? Phytochem Rev. 2019;18(4):989-1004.
Mayo B, Vázquez F, Flórez AB. Equol: A bacterial metabolite from the daidzein isoflavone and its presumed beneficial health effects. Nutrients. 2019;11:2231.
Lund TD, Munson DJ, Haldy ME, Setchell KD, Lephart ED, Handa RJ. 2004. Equol is a novel anti-androgen that inhibits prostate growth and hormone feedback. Biol Reprod 2004;70:1188–1195.
Bolca S, Possemiers S, Herregat A, Huybrechts I, Heyerick A, De Vriese S, Verbruggen M, Depypere H, De Keukeleire D, Bracke M, et al.. 2007. Microbial and dietary factors are associated with the equol producer phenotype in healthy postmenopausal women. J Nutr. 2007;137:2242–2246.
Hall MC, O’Brien B, McCormack T. 2007. Equol producer status, salivary estradiol profile and urinary excretion of isoflavones in Irish Caucasian women, following ingestion of soymilk. Steroids. 2007;72:64–70.
Peeters PHM, Slimani N, van der Schouw YT, Grace PB, Navarro C, Tjonneland A, Olsen A, Clavel-Chapelon F, Touillaud M, Boutron-Ruault MC, et al. 2007. Variations in plasma phytoestrogen concentrations in European adults. J Nutr. 2007;137:1294–1300.
He FJ, Chen JQ. 2013. Consumption of soybean, soy foods, soy isoflavones and breast cancer incidence: Differences between Chinese women and women in Western countries and possible mechanisms. Food Sci Hum Wellness. 2013;1;2(3-4):146-161.
Schröder C, Matthies A, Engst W, Blaut M, Braune A. 2013. Identification and expression of genes involved in the conversion of daidzein and genistein by the equol-forming bacterium Slackia isoflavoniconvertens. Appl Environ Microbiol. 2013;79:3494–3502.
Ruiz de la Bastida A, Peirotén A, Langa S, Arqués JL, Landete JM. Heterologous production of equol and 5-hydroxy-equol by lactic acid bacteria strains in fermented food. Int J Food Microbiol. 2021;360:109328.
Langa S, de la Bastida AR, Peirotén Á, Curiel JA, Landete JM.. Development of the first fermented soy beverages enriched in equol and 5-hydroxy-equol. LWT. 2022; 168:113899.
Shimada Y, Takahashi M, Miyazawa N, Abiru Y, Uchiyama S, Hishigaki H. Identification of a novel dihydrodaidzein racemase essential for biosynthesis of equol from daidzein in Lactococcus sp. strain 20-92. Appl Environ Microbiol. 2012;78:4902–4907.
Vázquez L, Flórez AB, Rodríguez J, Mayo B, 2021. Heterologous expression of equol biosynthesis genes from Adlercreutzia equolifaciens. FEMS Microbiol Lett. 2021; 368(13): fnab082.
Peirotén A, Gaya P, Landete JM. 2020. Application of recombinant lactic acid bacteria and bifdobacteria able to enrich soy beverage in dihydrodaidzein and dihydrogenistein. Food Res Int. 2020;134:109257.
Lee PG, Kim J, Kim EJ, Lee SH, Choi KY, Kazlauskas RJ, Kim BG. Biosynthesis of (−)-5-hydroxy-equol and 5-hydroxy-dehydroequol from soy isoflavone, genistein using microbial whole cell bioconversion. ACS Chem Biol. 2017; 12(11):2883-2890.
Shimada Y, Takahashi M, Miyazawa N, Ohtani T, Abiru Y, Uchiyama S, Hishigaki H. Identification of two novel reductases involved in equol biosynthesis in Lactococcus strain 20–92. J Mol Microbiol Biotech. 2011;21(3-4):160-172.
Gasson MJ. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J Bacteriol. 1983;154:1–9.
Langa S, Landete JM, Martín-Cabrejas I, Rodríguez E, Arqués JL, Medina M. In situ reuterin production by Lactobacillus reuteri in dairy products. Food Control. 2013; 33: 200–206.
Rodríguez E, Arqués JL, Rodríguez R, Peirotén A, Landete JM, Medina M. Antimicrobial properties of probiotic strains isolated from breast-fed infants. J Funct Foods. 2012;4:542–551.
Joosten HM, Nuñez M, Devreese B, van Beeumen J, Marugg JD. Purification and characterization of enterocin 4, a bacteriocin produced by Enterococcus faecalis INIA 4. Appl Environ Microbiol. 1996;62:4220–4223.
Garde S, Tomillo J, Gaya P, Medina M, Nuñez M. Proteolysis in hispanico cheese manufactured using a mesophilic starter, a thermophilic starter, and a bacteriocin-producing Lactococcus lactis subsp. lactis INIA 415 adjunct culture. J Agric Food Chem. 2002; 50:3479–3485.
Landete JM, Langa J, Revilla C, Margolles A, Medina M, Arqués J. 2015. Use of anaerobic green fuorescent protein versus green fluorescent protein as reporter in lactic acid bacteria. Appl Microbiol Biotechnol. 2015;99:6865–6877.
Landete JM, Arqués JL, Peirotén A, Langa S, Medina M. An improved method for the electrotransformation of lactic acid bacteria: a comparative survey. J Microbiol Meth. 2014;105:130–133.
Gaya P, Arqués JL, Medina M, Álvarez I, Landete JM. A new HPLC-PAD/HPLC-ESI-MS method for the analysis of phytoestrogens produced by bacterial metabolism. Food Anal Met. 2016;9:537-547.
Gaya P, Medina M, Sánchez-Jiménez A, Landete JM. Phytoestrogen metabolism by adult human gut microbiota. Molecules. 2016;21(8):1034.

Table 1. Bacterial strains and plasmids used in this work.

Strains		Origen	Reference

Lactococcus lactis MG1363			[19]
Limosilactobacillus fermentum INIA 584L			[16]
Limosilactobacillus fermentum INIA 832L			[16]
Limosilactobacillus fermentum INIA 143L			This work
Limosilactobacillus reuteri INIA P572			[20]
Lacticaseibacillus paracasei INIA P272			[21]
Lacticaseibacillus. rhamnosus INIA P540			[21]
Enterococcus faecalis INIA 4			[22]
Streptococcus thermophylus INIA 468			[23]
Bifidobacterium breve INIA P734			CECT8178

Plasmids	Relevant phenotype or genotype		References

pNZ:TuR	pNZ8048 with promoter of elongation factor Tu of Limosolactobacillus reuteri CECT925 replacing P_nis		[24]
pNZ:TuR.dzr (dzr^P)	pNZ:TuR harboring daidzein reductase (dzr) from S. isoﬂavoniconvertens DSM 22006T		[16]
pNZ:TuR.tdr.ddr (tdr-ddr^P)	pNZ:TuR harboring dihydrodaidzein reductase (ddr) and tetrahydrodaidzein reductase (tdr) S. isoﬂavoniconvertens DSM 22006T		[12]
pNZ:TuR.ifcA (ifcA^P)	pNZ:TuR harboring the gene encoding racemase (ifcA) from S. isoﬂavoniconvertens DSM 22006T		[12]
pNZ:TuR.ddr (ddr^P)	pNZ:TuR harboring dihydrodaidzein reductase (ddr)		This work
pNZ:TuR.tdr (tdr^P)	pNZ:TuR harboring dihydrodaidzein reductase (ddr) S. isoﬂavoniconvertens DSM 22006T		This work

Table 2. Effect of the heterologous expression of the ifcA in the production of equol from daidzein (196.77 μM) by parental and transformed LAB strains.

	Daidzein	DHD	Equol
*L. lactis* MG1363	182,03 ± 3.51^c	1.26 ± 0,66 ^a	n.d. ^a
dzr^P + tdr-ddr^P	12,45 ± 5,17^b	67,89 ± 2,67 ^b	22,83 ± 2,67 ^a
dzr^P + tdr-ddr^P + ifcA^P	14,67 ± 4,56^b	87,56 ± 5,78^c	20,76 ± 2,26^a
dzr^P + tdr-ddr^P + ifcA^P ^(584L)*	5,98 ± 4,12^a	84,17 ± 4,56^c	42,15 ± 1,67 ^c
dzr^P + tdr-ddr^P + ifcA^P^(584L)	3,17 ± 2,67 ^a	81,91 ± 7,16^c	43,25 ± 3,18 ^c

*L. fermentum* INIA 584L	169,45 ± 4.84 ^b	0,94 ± 0.36 ^a	n.d. ^a
dzr^P + tdr-ddr^P	13,43 ± 1,31 ^a	98,45 ± 5,34^d	44,34 ± 3,26 ^b
dzr^P + tdr-ddr^P + ifcA^P	10,67 ± 2,17 ^a	1,82 ± 0,87^a	172,70 ± 10,02 ^d

*L. fermentum* INIA 832L	173.33 ± 5.82^b	3.17 ± 1.96 ^a	n.d ^a
dzr^P + tdr-ddr^P	13,43 ± 4,31 ^a	102,45 ± 10,65^c	38,34 ± 6,45 ^b
dzr^P + tdr-ddr^P + ifcA^P	10,67 ± 4,12 ^a	1,82 ± 0,98^a	165,70 ± 12,41^d

*L. lactis* /L. fermentum
dzr^P 1363 + tdr-ddr^P 584	7,77 ± 4,51 ^a	59,34 ± 17,57 ^b	36,56 ± 6,34 ^a
dzr^P 1363 + tdr-ddr^P 584 + ifcA^P ^(584L)*	3,21 ± 2,76 ^a	0,98 ± 0,87 ^a	158,32 ± 13,12 ^d

*Heterologous expression of ifcA in L. fermentum INIA 584L

Table 3. Effect of the heterologous expression of the ifcA in the production of equol from DHD (195.12 μM) by parental and transformed LAB strains in culture medium.

Strains	DHD	equol
L. lactis MG1363
tdr-ddr^P	131,56 ± 12,34^a	37,67± 3,56 ^a
tdr-ddr^P + ifcA^P	133,44 ± 7,23^a	34,18± 4,52^a
tdr-ddr^P + ifcA^P^(584L)*	128,09 ± 11,35^a	46,64± 3,58 ^b

L. fermentum INIA 584L
tdr-ddr^P	60,51 ± 7,98^ab	90,23 ± 11,34 ^a
tdr-ddr^P + ifcA^P	54,33 ± 3,34^a	86,14 ± 9,00 ^a

L. fermentum INIA 832L
tdr-ddr^P	63,45 ± 6,55^b	91,00 ± 6,40^b
tdr-ddr^P + ifcA^P	52,13 ± 12,20^a	84,08 ± 11,07^a

*Heterologous expression of ifcA in L. fermentum 584L.

Table 4: Effect of heterologous expression of ifcA on the production of THD cis and THD trans from daidzein and DHD, and equol and dehydroequol production from daidzein and DHD by the LAB strains harbouring dzr^P, ddr^P, tdr^P and ifcA^P.

Strains	isoflavone	THD (cis)/THD (trans)^Ω	Equol	Dehydroequol
L. lactis MG1363
dzr^P + ddr^P	Daidzein	1,26 ± 0,08^b	n.d.	n.d.
dzr^P + ddr^P + ifcA^P	Daidzein	1,18 ± 0,06^b	n.d.	n.d.
dzr^P + ddr^P + ifcA^P ^(584L)*	Daidzein	0,77 ± 0,11^a	n.d.	n.d.
dzr^P + ddr^P + tdr^P + ifcA^P	Daidzein	No quantified	11,12 ± 3,22	n.d.
dzr^P + ddr^P + tdr^P + ifcA^P ^(584L)*	Daidzein	No quantified	23,45 ± 4,08	n.d.

L. fermentum INIA P584L
dzr^P + ddr^P	Daidzein	1,51± 0,14^b	14,02 ± 3,21^a	5,02 ± 0,62ª
dzr^P + ddr^P + ifcA^P	Daidzein	0,34 ± 0,08^a	44,13 ± 5,63^b	12,65 ± 1,80^b
dzr^P + ddr^P + tdr^P + ifcA^P	Daidzein	No quantified	141,14 ± 8,23 ^c	3,87 ± 1,02^a

L. fermentum INIA P832L
dzr^P + ddr^P	Daidzein	1,48 ± 0,21^b	13,09 ± 2,78^a	6,25 ± 2,30^a
dzr^P + ddr^P + ifcA^P	Daidzein	0,47 ± 0,05^a	45,56 ± 7,80^b	14,33 ± 1,82^b
dzr^P + ddr^P + tdr^P + ifcA^P	Daidzein	No quantified	124,27 ± 8,34^c	3,74 ± 0,98^a

L. lactis MG1363
ddr^P	DHD	0.98 ± 0,10ª	5,19 ± 2,32^a	3,67 ± 1,63ª^b
ddr^P + ifcA^P	DHD	0,95 ± 0,04ª	6,44 ± 3,09^a	3,87 ± 2,18ª^b
ddr^P + ifcA^P^(584L)	DHD	0,96 ± 0,07ª	10,02 ± 4,05^a	5,03 ± 1,07^b
ddr^P + tdr^P + ifcA^P	DHD	No quantified	22,76± 4,08^ab	1,98 ± 0,96ª
ddr^P + tdr^P + ifcA^P ^(584L)*	DHD	No quantified	30,02± 2,20^b	2,14 ± 1,12ª

L. fermentum INIA P584L
ddr^P	DHD	0,88 ± 0,10^a	32,18 ± 3,35^a	8,18 ± 2,45^b
ddr^P + ifcA^P	DHD	0,89 ± 0,08^a	36,41 ± 6,54^a	8,93 ± 0,87^b
ddr^P + tdr^P + ifcA^P	DHD	No quantified	81,43 ± 5,45^b	4,32± 1,22^a

L. fermentum INIA P832L
ddr^P	DHD	0,93 ± 0,12^a	29,92 ± 5,76^a	9,06 ± 1,85^b
ddr^P + ifcA^P	DHD	0,91 ± 0,08^a	35,56 ± 5,43^a	7,25 ± 2,65^b
ddr^P + tdr^P + ifcA^P	DHD	No quantified	76,12 ± 4,56^b	3,25 ± 0,95ª

^Ω The ratio of the THD cis and THD trans areas.

*Heterologous expression of ifcA in L. fermentum 584L

Fig. 1S is not available with this version.

No competing interests reported.

Fig3s.png

The importance of the dihydrodaidzein racemase and dihydrodaidzein reductase activities and the host microorganism to achieve an efficient equol production by engineered lactic acid bacteria

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Conclusions

Material and methods

Bacterial strains and culture conditions

Cloning of the dihydrodaidzein reductase and tetrahydrodaidzein reductase gene independently

Influence of NADPH on the equol production

Extraction of isoflavones

Identification and quantification of isoflavones

Statistical analysis

Declarations

References

Tables

Supplementary Figure 1

Additional Declarations

Supplementary Files

Status:

Version 1