Introgression of genes associated with yield enhancement and resistance against bacterial leaf blight and blast diseases into an elite rice variety, ‘Jaya’ through marker assisted backcrossing

doi:10.21203/rs.3.rs-3648037/v1

Background

Bacterial leaf blight (BLB) and blast diseases are the major biotic threats responsible for significant yield loss in rice production across all the rice growing regions. Development of high yielding lines along with resistance to major rice disease is more relevant solution for sustainable yields in paddy. ‘Jaya’ the most popular, stable mega rice variety, notified and cultivated in nineteen states across India and is susceptible to bacterial leaf blight and blast diseases and has an average yielding ability (4.5 t/ha). Present study targeting introgression of bacterial leaf blight, blast resistance genes along with yield improvement genes is the most felicitous strategy for a panoramic genetic enhancement to develop high yielding disease resistant rice cultivars.

Results

In the current investigation, efforts have been made to transfer ‘Xa21’ gene which provide resistance to bacterial leaf blight caused by Xanthomonas oryzae pv oryzae, ‘Pi54’ gene which governs blast resistance caused by Magnoporthe oryzae and yield enhancing gene ‘Gn1a’ which governs the higher grain number per panicle thereby ultimately increasing the yield of the concerned genotype. Using marker assisted backcross breeding approach twenty elite BC₂F₂ lines with two biotic stress resistance genes (Xa21 and Pi54) and a yield enhancement gene (Gn1a) were developed and evaluated for their disease resistance, yield and agronomic performance under field and controlled condition in BC₂F₃ generation. The background genome recovery analysis of twenty elite BC₂F₂ lines was carried out using 1K-RiCA SNP genotyping and it ranged from 85.41 to 96.28 per cent. The selected backcross derived lines showed higher resistant to BLB and blast along with significant yield increase over recurrent parent.

Conclusions

The strategy of marker assisted backcross selection found to be promising technique in identifying superior backcross introgressed lines. Among the twenty improved backcross derived lines, IJ-4 and IJ-107 were found to be more promising lines by having the highest recurrent parent genome recovery along with increased resistance to BLB and blast with superior yielding ability than recurrent parent Jaya.

Rice

Bacterial leaf blight

Blast

Yield

Marker-assisted backcross breeding

foreground selection

background selection

Rice is one of the most significant staple crops in the world, it provides sustenance for billions of people and is essential for ensuring food security. In 2023, rice will continue to play a crucial role in the world's food system. In nations like India, where it is a nutritional mainstay for the great majority of the population, its role will be especially important. It is a vital crop in the country, with rice cultivation accounting for a significant portion of the agricultural land. Rice not only provides crucial nutrients but also supports the livelihoods of millions of farmers and agricultural workers across the country. In 2021-22, the world rice production was 756.7 million tons, of which China and India share 52 per cent of this total rice production. India has production of 129.4 million tons from an area of 46.3 million hectares with an average yield of 2.80 t/ha, feeding the mouths of more than 75 per cent of the population (https://www.indiastat.com, 2021-22). According to recent market trends, the Indian rice industry is the dominant worldwide rice producer (Hori and Shenton, 2022). To meet the escalating demand of nearly 5.0 billion consumers, annual average population growth of ~1.5 per cent and estimated per capita consumption of about 250 g of rice per day, the exigency for rice is anticipated to increase by 40 per cent by 2030 (Khush, 2005). Further, this demand can be met only if there is an increase in production and productivity. However, rice production is being reduced severely by two factors viz., biotic and abiotic factors. Amongst biotic factors, blast disease and bacterial leaf blight are the highly devastating diseases of rice, affecting grain production by 20-50 per cent (Fiyaz et al. 2016).

The deployment of host plant resistance is the preferred strategy for managing bacterial leaf blight and blast disease compared to other methods, including the chemical control method. Breeding for targeted disease resistance among the popular varieties remains the most economical and effective way in controlling the BLB and blast of rice (Fiyaz et al. 2022). Bacterial leaf blight (BLB) caused by Xanthomonas oryzae pv. oryzae, a gram-negative proteo-bacterium, is one of rice's important and oldest known vascular disease causing yield losses by 6 to 60 per cent and potentially threatening rice cultivation (Srinivasan et al. 1959; Singh et al. 2011). As on date 46 BLB genes have been identified, among these 11 genes have been cloned and characterized. Xa21 is the most significant and broad spectrum resistant gene, hence it is more utilized under resistance breeding program (Fiyaz et al. 2022). Rice blast, caused by the fungus Magnaporthe grisea, belongs to the Ascomycota phylum and Magnaporthaceae family. It is found to be the most devastating rice disease and is widely prevalent in at least 85 countries globally, often results in a substantial yield losses up to 70-80 per cent during an epidemic (Ou, 1985). As on date 109 significant genes for leaf blast resistance have been discovered, of which 25 genes have been molecularly characterized with Pi9 being the first cloned R gene. The vast majorities of these genes are allelic or closely linked genes that encode disease-resistant NBS-LRR proteins and Zinc finger domains (Annegowda et al. 2021). The ‘Pi54’ locus confers broad-spectrum resistance to various M. oryzae isolates. This gene is found to be highly effective against several isolates of M. oryzae from India, and hence, this is the ideal choice to introgress into popular rice varieties through marker-assisted breeding.

Rice grain production is a multifaceted attribute. Numerous additional characteristics, including plant architecture, heading date, and the level of biotic/abiotic stress resistance, have a direct or indirect impact on it. Rice grain productivity is intimately correlated with four key characteristics; the grain size, grain filling capacity, grain numbers per panicle, and tiller numbers per hill. Nevertheless, these characteristics are quantitative and complicated in nature. In rice, about 20 major effect genes were found to affect yield significantly. Gn1a (OsCKX2) is the first gene to be isolated that controls the rice grain yield by regulating cytokinin and the number of spikelets. Reduced expression of Gn1a causes cytokinin accumulation in the inflorescence meristems and, consequently, increases the number of spikelet’s (Ashikari et al. 2005; Yeh et al. 2015).

The backcross breeding is mainly used to transfer favourable traits from a donor parent into popular recurrent i.e. genotypes which lack any one or two essential traits. Markers used in the context of marker-assisted backcrossing (MABC) help to select the target gene (foreground selection), accelerate the reconstruction of the recurrent parent genotype (background selection) and for selecting the large QTLs through the use of flanking markers (recombinant selection). Hence, the planned research aims at marker-assisted introgression of the genes associated with yield enhancement by increasing grain number per panicle (Gn1a), resistance to bacterial leaf blight (Xa21) and blast (Pi54) diseases into an elite rice variety, ‘Jaya’.

The experimental material consisted of two Indica rice varieties, ‘Jaya’ as the recurrent parent and ‘Isogenic line of MTU 1010’ as donor parents. Jaya was the first variety developed after the initiation of the All India Coordinated Rice Improvement Programme (AICRIP) through systematic breeding efforts by a famous rice breeder Dr. S.V.S. Shastry and team using TN1/T141 as parents, at ICAR- Indian Institute of Rice Research (Formerly, Directorate of Rice Research). The variety ‘Jaya’ was released in 1968 and is well suited to high altitudes, wet and upland cultivation. It is medium duration, semi-dwarf rice and produces long bold grains. This variety has been notified and released for cultivation in 19 states across India. Owing to its wide adaptability and desirable agronomic traits, 'Jaya' has been extensively used in the pedigree of many high yielding cultivars released in the country. Despite its desirable agronomic traits, it is susceptible to BLB and blast disease and has an average yielding ability. Therefore, the present study improved Jaya by introgressing yield enhancing gene ‘Gn1a’, BLB resistance gene ‘Xa21’ and blast resistant gene ‘Pi54’ into the genetic background of variety 'Jaya' through marker assisted backcross breeding approach. The donor parent is an isogenic line of a popular variety MTU 1010, a high yielding, bacterial leaf blight and blast resistant line, developed through Marker Assisted Backcross Breeding at ICAR-Indian Institute of Rice Research, Hyderabad.

Validation of targeted molecular markers among the parental lines

Validation of molecular marker with trait phenotype was carried out on randomly selected individual plants from donor (MTU1010 with Xa21+Pi54+Gn1a) and recurrent parent (Jaya) plant population grown in field during 2020-Kharif (June to October). Molecular markers specific to these traits were already identified viz., Xa21 (pTA248), Pi54 (PikhMAS) and Gn1a (Gn1a Indel-3) and these were utilized for validation of our parental lines. The selected parental plants were validated for the confirmation of all the three genes (Xa21, Pi54 and Gn1a) in donor parent.

Trait introgression, foreground, phenotypic and background selection of backcross progenies

A crossing program was carried out to introgress the bacterial leaf blight (Xa21), blast (Pi54) and yield enhancing (Gn1a) genes into the recurrent parent through marker-assisted backcross breeding strategy. In the initial cross, Jaya was used as female, and isogenic line of MTU1010 (with Xa21+Pi54+Gn1a) as male. True hybridity of F₁ plants was confirmed using the Pta248 marker. In the subsequent backcross generations, until BC₂F₁, the respective recurrent parent was used as the female parent (Fig. 1).

Foreground selection

The foreground markers Pta248, PikhMas and Gn1a Indel-3 were already validated among the parents and the same were used for the foreground selection of the BC₁F₁, BC₂F₁and BC₂F₂ plants. Details of the foreground markers were mentioned in Table 1.

Table 1: Details of gene specific markers used in the present study

Molecular Markers	Linked gene	Annealing temperature	Primer sequence	Chr. No.	Amplicon product size (bp)		Reference
					Positive	Negative
pTA248	Xa21	58 ˚C	F: AGACGCGGGAAGGGTGGTTCCCGGA	11	950	650	Ronold et al. (1992)
			R: AGACGCGGGTAATCGAAAGATGAAA
PikhMas	Pi54	55 ˚C	F: CCCATGCGTTTAACTATTCT	11	216	359	Sharma et al. (2005)
			R: CGTTCCATCGATCCGTATGG
Gn1a-indel3	Gn1a	55 ˚C	F: GATCTAGATGCTCCAAAGTCC	1	275	205	Kim et al. (2016)
			R: CTGTACGTACGTGCACGTAG

Phenotypic selection

After each foreground selection, phenotypic screening was carried out for BLB and for agronomical and yield related traits among the three gene positive backcrossed lines. Due to large sample size in BC₂F₂ generation, primarily phenotypic selection was employed to reduce the population size keeping BLB resistance (In-field artificial inoculation and selection) and grain number per panicle as components of selection index. Finally selected selfed progeny of BC₂F₂ plants were used to screen for blast resistance in uniform blast nursery for two consecutive seasons.

Background selection

To identify plants with maximum recovery of recurrent parent genome, a set of 862 SSR markers and 1K-RiCA SNP’s spread over the entire rice genome were used to check parental polymorphism among the recurrent and donor parents, obtained polymorphic markers were used to estimate background genome recovery. Background selection was applied from the BC₁F₁ generation and the plants showing the highest recurrent parent genome recovery percentage (RPGR) were backcrossed to Jaya to produce the subsequent backcross generations up to BC₂F₁. The selected BC₂F₁ plants with higher RPGR% were self-pollinated to produce BC₂F₂ seeds. Details of the primer sequences of the SSR markers were obtained from Gramene SSR marker resources (www.gramene.org). RPGR was estimated using polymorphic SSR markers until BC₂F₁ generation.

Assessment of the background genome recovery using 1K- Rice Custom Amplicons (1K-RiCA)

Background genome recovery was estimated using polymorphic SSR markers until BC₂F₁ generation. Later in foreground selected BC₂F₂generation 1K-RiCA was used to estimate background recovery. 1K-RiCA sequencing is a robust mid density genotyping platform with the amplicon panel containing approximately 1094 SNPs. These SNPs are designed for distribution across the chromosomes considering uniform distance (1.5 cM apart) in the rice genome. To assess the background genome recovery of the recurrent parent, introgressed lines were compared with recurrent parent Jaya using 1K-RiCA SNP chip. Parental polymorphism and background recovery percentages of the genotypes were called using the PhenoGram software package. SNPs with low call rates across all samples were drawn out from the dataset and high-performing SNPs with a development quality check (DQC) score of >0.85 and call rates of >95.0 per cent were used for further analyses as described by Arbelaez et al. (2019). Introgression lines which were having the highest recurrent parent genome recovery were graphically represented using PhenoGram software from Ritchie lab, Penn. State University, Pennsylvania, USA (http:// visua lization. ritch ielab. psu. edu/ phenograms/plot).

Background genome recovery was studied using the formula recommend by Sundaram et al. (2008). G = [(X + 1/2Y) /100]/N

N = Total unit of parental polymorphic markers screened

X = Number of markers declaring homozygosity for recurrent parent allele

Y = Number of markers declaring heterozygosity for parental alleles

DNA isolation and Polymerase Chain Reaction

A mini preparation procedure was used to isolate genomic DNA from the collected leaf samples using Cetyl Tri Methyl Ammonium Bromide (CTAB) method (Doyle and Doyle, 1987). DNA quality and quantity was assessed by using Nanodrop spectrophotometry. The quantity of DNA in different samples varied from 50-1200 ng/μl. After quantification, all the samples were diluted to 50 ng/μl and were used for PCR reactions. PCR was used to selectively amplify in-vitro a specific segment of the DNA to a billion-fold (Mullis et al. 1986). The essential requirement of PCR is the availability of a pair of short (typically 20-25 nucleotides) primers having a sequence complementary to either end of the target DNA segment (called template DNA). PCR was accomplished out in a total volume of 10 μl containing 30-50 ng of template, gene-linked primers (0.5 μl each), 1X PCR buffer, 0.5 mm dNTP mix, and 1unit of Taq DNA polymerase (Bangalore Genei, India). The PCR mix was centrifuged at 1000 rpm for 1 minute and loaded in a 96 wells thermal cycler of PCR (Eppendorf). The PCR cycle settings for the primers pTA248, were as follows: initial denaturation at 95˚C for 5 min, followed by 35 cycles of denaturation at 95˚C for 1 min, primer annealing at 58˚C for 60 sec and extension at 72˚C for 1 min and a final extension at 72˚C for 10 min, cooling at 4^˚C. For PikhMas, and Gn1a-Indel3 primers annealing temperature was kept at 55˚C for 30 seconds keeping the other steps constant.

Screening for BLB resistance

BLB isolates of the pathogen IX-020, Xanthomonas oryzae pv. oryzae (Xoo) collected from ICAR-Indian Institute of Rice Research, Hyderabad, Telangana was used to screen all the backcross generation and selfed lines viz., BC₂F₂, BC₂F₃ introgressed lines of Jaya (possessing the gene combinations Xa21+Pi54+Gn1a) along with the donor parent/resistant check (IL of MTU1010) and recurrent parent/susceptible check (Jaya) were critically evaluated under field conditions for their resistance/susceptibility against BLB. The bacterial culture of the pathogen was maintained, harvested and diluted as described by Preece et al. (1982). Inoculation was done during the cooler’s hours of the day when the crop was at the maximum tillering stage following the leaf clip method of Kauffman et al. (1973). Symptoms were measured 14 days after inoculation based on the screening protocols given by Chen et al. (2000). The mean lesion length on three inoculated leaves per plant was considered for giving the disease score.

Screening for blast resistance

Blast screening was carried out at Uniform Blast Nursery (UBN) available at division of plant pathology ICAR- Indian Institute of Rice Research, Hyderbad, India. The bed size of 10 m × 1 m was prepared for sowing. The border row was prepared to sow susceptible check HR12 and the middle rows were prepared perpendicular to the border rows for test material. Test entries were sown along with donor parent (MTU1010 IL) and recurrent parent Jaya by repeating resistant check Tetep after every five test entries. Seeds were covered with fine soil superficially and sprinkled with water onto the beds frequently. Spore suspension (IIRR local isolate-SPI 40) of the blast pathogen Magnaporthe oryzae was prepared from 10-day old slants of mycelia, dispensed in 5ml of distilled water, plated onto Mathur's medium (MgSO₄.7H₂O-1.23g, KH₂PO₄-2.72 g, Neopeptone-2 g, agar-20 g, distilled water-1000 ml) and incubated at 25 to 28°C for about one week to 10 days. Spore suspension (10 ml) was prepared from the mycelia on the petri plates with distilled water and placed in a rotary shaker to detach conidia from the conidiophores of the mycelia. The spore suspension was then filtered through cheese cloth and the concentration was adjusted to 10⁵ spores/ml approximately. 15 days old seedlings were then inoculated by spraying spore suspension with the help of a hand operated low volume plastic sprayer. Inoculation was done during evening hours, left overnight undisturbed and water was sprayed frequently (about 3-4 times a day) and beds were concealed with transparent polythene cover to maintain high levels of humidity. After 15 days of inoculation, when it is observed that HR12 (susceptible check) has completely dried, test entries were scored comparatively to susceptible and resistant checks as per 0-9 scale of IRRI, 2013.

Agronomic Evaluations

Twenty plants which were selected in BC₂F₂generation were evaluated in BC₂F₃generation for their performance for yield and its related characters along with the recurrent parent in field trials to check the yield superiority of backcross derived lines of Jaya. Field plots were organized in randomized blocks with two replicates among BC₂F₃ populations.

Statistical Analysis

Analysis of variance (ANOVA) of the replicated agronomic data was performed using SAS version 9.3 software and background genome recovery estimation was carried out using Phenogram software as described by Arbelaez et al. (2019). Parental polymorphism was represented using Map maker 4.0 software.

Validation of molecular markers with trait phenotype

Validation exercise was conducted to test the effectiveness of a marker in determining phenotypes among the parental lines by keeping positive and negative checks for each trait. Molecular markers for BLB, blast resistance and for high grain number per panicle were already identified viz., Xa21 (pTA248), Pi54 (PikhMAS) and Gn1a (Gn1a Indel-3) were utilized for validation among the parental lines. Results confirmed the presence of positive alleles for all the three genes (Xa21, Pi54 and Gn1a) in donor parent and the same were proven to be negative in the recurrent parent (Fig. 2). Phenotypic evaluation also carried out under field and glass house condition for the concerned disease (BLB and blast) resistance and the results reflected the resistance of the donor parent and susceptibility of the recurrent parent. To confirm the yielding ability of the parental lines number of grains per panicles were counted and the results indicated the superiority of donor parent over recurrent parent for the concerned traits.

Marker assisted introgression of target traits

After validation of molecular markers, crosses were attempted between the recurrent and donor parent to introgress targeted genes into the genetic background of recurrent parent. Meanwhile parental polymorphism was carried out using 862 SSR markers covering all the 12 chromosomes, of which 118 markers found to be polymorphic (Fig. 3) (Table 2). True F₁ hybridity confirmation was done using one of the foreground markers i.e., pTA248. Results have indicated that out of 25 plants, 21 are true hybrids and 4 were selfed (Fig. S1.). These true hybrids were used as pollen parents to generate BC₁F₁ plants. A total of one hundred twenty BC₁F₁ seeds weregenerated and sown during Kharif-2021 in the month of June. After sowing, one hundred sixteen strong and healthy seedlings were produced and they were transplanted to main field. Foreground selection was carried out using the gene specific markers pTA248 for Xa21 gene, PikhMas for Pi54 gene and Gn1a Indel-3 for Gn1a gene. Among the one hundred sixteen BC₁F₁plants, 5 plants were spotted to be heterozygous for all the three targeted loci (Table 3) (Fig. S2.). Background genome recovery analysis was carried out among all five positive plants and average recurrent parent genome recovery was 76.77 with the highest of 79.66% (Table 3). Among five triple gene positive heterozygote plants, plant which carried higher recurrent parent genome was selected i.e. BC₁F₁-2 (79.66%) and utilized in crossing program to produce BC₂F₁ plants.

Crosses were attempted during Kharif-2021 between selected BC₁F₁ plant and Jaya to generate BC₂F₁ seeds. Total of 120 BC₂F₁ seeds were produced, out of them 92 healthy and strong BC₂F₁ seedlings were raised and transplanted in the main field during Rabi-2021. Foreground selection was carried out using gene specific markers. Among the 92 plants, total of 30 three gene positive heterozygote plants were obtained (Fig. S3.). Background genome recovery analysis was carried out among all thirty BC₂F₁positive plants and recovery percentage ranged from 85.41 to 91.52 per cent with the average of 89.91% (Table 3).

Table 2. Details of polymorphic markers used in the study

Chr. No.	No. of markers used for analysis	No. of polymorphic markers	Name of the polymorphic primers
1	74	9	RM1247, RM10109, RM583, WR1.1, RM8004, RM212, RM1067, RM3362, RM6831
2	54	17	RM7451, RM423, RM3703, RM5812, RM12729 RM71, RM6375, RM424, RM27, RM13170, RM13581, RM13641, RM1920, RM3763, RM573, RM5460, RM207
3	46	8	RM3131, RM4996, RM3400, RM251, RM3646 RM16, RM15630, RM168
4	98	8	RM16294, RM16338, RM16404, RM16717 RM16943, RM303, RM17377, RM3534
5	64	9	RM501, RM17836, RM18079, RM5140 JGT05-18.3, RM163, RM440, RM18704, RM334
6	88	16	RM3805, RM19417, RM204, RM584, RM225, RM19620, RM402, RM7488, RM19680, RM539, RM19771, RM527, RM19819, RM541, RM20377, RM20678
7	108	4	RM3394, RM8007, RM21941, RM248
8	90	10	RM337, RM407, RM6925, RM544, RM22529, RM22565, RM3443, RM23502, RM3480, RM4153
9	56	10	RM23736, RM105, RM24382, RM7175, HRM24481 RM410, RM257, RM5519, RM107, RM201
10	48	9	RM5095, RM25031, RM25421, RM258, RM25610 RM3510, RM171, CHR10-19.7, HRM25796
11	82	11	RM2459, RM26105, RM332, RM224, RM7120, RM26652, RM26832, JGT11-19.5, RM21, RMES11485, RM330
12	54	7	RM1036, RM1047, RM28039, RM519, JGT12-20.24, RM2854, RM28827
Total	862	118

Table 3. Genotyping of backcross progenies for two QTLs and recovery of recipient parent’s genome in the foreground positive backcross progenies.

Generation	No. of Plants Scored	No. of Progenies Heterozygotes/homozygotes for 3 Target QTLs	Expected recurrent parent genome recovery of the targeted plants	Average recurrent parent genome recovery of the targeted plants	Obtained maximum RP genome of selected plants
BC₁F₁	116	5	75	76.77	79.66
BC₂F₁	92	30	87.5	89.91	91.52
BC₂F₂	150	20	93.75	91.37	96.28

During Kharif -2022, five BC₂F₁ plants which were found to have high grain number per panicle, BLB and blast resistance along with higher background genome recovery were selected to generate 1000 BC₂F₂ plants following the plant to progeny row fashion. Because of large population, initial selection was carried out based on artificial BLB screening and by considering good agronomic and yield related traits. This strategy of combining phenotyping with genotyping for BLB resistance has been previously described by Hari et al. (2013), wherein stringent phenotypic screening initially followed by selective genotyping of resistant plants has been reported to save time and resources. Firstly, all the thousand BC₂F₂plants were tested for BLB screening with a local isolate of Xoo, IIX0-20 at maximum tillering stage. Based on disease reaction 648 resistant plants were tagged out of 1000 plants in field. Second stage of selection was carried out during grain filling stage, where out of 648 BLB resistant plants, 150 high yielding plants which are phenotypically similar to recurrent parent having same grain type and more number of grains per panicle were selected.

Foreground selection

Leaf samples from those 150 tagged BC₂F₂ plants were collected and foreground selection was carried out for the targeted traits. Out of 150 plants, 20 triple gene positive homozygous plants (Xa21, Pi54, and Gn1a) were obtained (Fig. S4.). Based on the foreground selection results, twenty plants were selected and are as follows; IJ-1, IJ-2, IJ-4, IJ-9, IJ-21, IJ-29, IJ-41, IJ-52, IJ-60, IJ-62, IJ-64, IJ-66, IJ-74, IJ-75, IJ-83, IJ-97, IJ-103, IJ-105, IJ-106 and IJ-107. These plants were further subjected for background genome recovery estimation using 1k-RiCA SNP chip to select best plant/s with higher recurrent parent genome recovery.

Background selection

Background selection was carried out among the 20-triple homozygote positive plants to select best plant/s with higher recurrent parent genome recovery. Selected plants were compared using 1K-RiCA SNP chip having 1094 SNPs with the average distance of ~ 1.524 cM between two adjacent SNP’s. Analysis was carried out using PhenoGram software as described in materials and methods. Out of 1094 SNP’s analyzed, 377 polymorphic SNPs were identified between the donor and recurrent parent (Table 4). Results indicated that recurrent parent genome recovery ranged from 85.41 per cent (IJ-105) to 96.28 per cent (IJ-4) among the twenty selected BC₂F₂ plants. IJ-4 (96.28 %) found to have highest background recovery among all the BC₂F₂lines (Fig. 4).

Table 4. Details of SNP based background genome recovery analysis among selected BC₂F₂ plants.

Sl. No.	Genotypes	No calls	Call rate (%)	Total number of polymorphic SNP’s	Total number of SNP’s analyzed	Total number of recurrent parent allele (Including hetero SNP’s)	Background genome recovery (%)
1	IJ-1	32	97.07	377	1094	346	91.77
2	IJ-2	37	96.61			343	90.98
3	IJ-4	30	97.25			363	96.28
4	IJ-9	30	97.25			342	90.71
5	IJ-21	35	96.80			340	90.18
6	IJ-29	33	96.98			327	86.73
7	IJ-41	32	97.07			330	87.53
8	IJ-52	33	96.98			342	90.71
9	IJ-60	31	97.16			339	89.92
10	IJ-62	35	96.80			329	87.26
11	IJ-64	30	97.25			322	85.41
12	IJ-66	31	97.16			329	87.26
13	IJ-74	30	97.25			327	86.73
14	IJ-75	32	97.07			341	90.45
15	IJ-83	32	97.07			335	88.85
16	IJ-97	30	97.25			350	92.83
17	IJ-103	38	96.52			324	85.94
18	IJ-105	31	97.16			322	85.41
19	IJ-106	32	97.07			323	85.67
20	IJ-107	37	96.61			354	93.89
Average	32.8	34.5	96.8	-	346.7	344.5	91.37931

Evaluation of the marker assisted backcross derived lines for bacterial leaf blight and blast resistance as well as for yield contributing traits

Evaluation of improved lines of Jaya against bacterial leaf blight disease

The BC₂F₂and BC₂F₃ isogenic plants derived from the cross Jaya/MTU1010 (IL) were evaluated for their resistance against bacterial leaf blight in Kharif and Rabi 2022 for two seasons along with the donor and recurrent parents. Inoculation was done using hyper virulent isolate, IXO-20 of Xanthomonas oryzae pv. oryzae, as described in material and methods (Chen et al. 2000). Fourteen days after inoculation, these backcross introgression lines were evaluated for their resistance against BLB. All the BC₂F₂ and BC₂F₃plants were found to be resistant to bacterial blight with the observed average lesion length of <2 cm (Fig. 5) (Table 5). The recurrent parent, Jaya showed susceptibility, while the donor parent MTU1010 isogenic line was resistant.

Table 5: Disease reaction (bacterial blight and blast) of backcross derived lines.

Genotypes	BLB lesion length (cm)		Blast score
Genotypes	2022 Kharif	2022 Rabi	2022 Rabi	2023 Kharif
IJ-1	1.2 (R)	1.1 (R)	2(R)	2(R)
IJ-2	1.5 (R)	1.3 (R)	1(R)	2(R)
IJ-4	1.1 (R)	1.1 (R)	1(R)	1(R)
IJ-9	1.4 (R)	1.1 (R)	1(R)	1(R)
IJ-21	1.6 (R)	1.4 (R)	2(R)	2(R)
IJ-29	1.5 (R)	1.4 (R)	1(R)	1(R)
IJ-41	1.7 (R)	1.5 (R)	1(R)	1(R)
IJ-52	1.4 (R)	1.2 (R)	1(R)	2(R)
IJ-60	1.7 (R)	1.3 (R)	1(R)	2(R)
IJ-62	1.3 (R)	1.3 (R)	2(R)	2(R)
IJ-64	1.4 (R)	1.2 (R)	1(R)	1(R)
IJ-66	1.6 (R)	1.3 (R)	1(R)	2(R)
IJ-74	1.5 (R)	1.2 (R)	1(R)	1(R)
IJ-75	1.1 (R)	1.1 (R)	1(R)	1(R)
IJ-83	1.0 (R)	1.2 (R)	2(R)	2(R)
IJ-97	1.5 (R)	1.3 (R)	1(R)	1(R)
IJ-103	1.6 (R)	1.4 (R)	2(R)	2(R)
IJ-105	1.6 (R)	1.4 (R)	1(R)	1(R)
IJ-106	1.5 (R)	1.2 (R)	1(R)	2(R)
IJ-107	1.5 (R)	1.4 (R)	1(R)	1(R)
Jaya	10 (S)	9.0 (S)	7(S)	7(S)
MTU1010 IL	1.1 (R)	1.0 (R)	1(R)	1(R)

S: Susceptible; R: Resistant

Evaluation of improved lines of Jaya for blast disease

Backcross derived lines viz., BC₂F₃ and BC₂F₄ isogenic plants derived from the cross Jaya/MTU1010 (IL) were screened for their resistance against blast disease along with the donor and recurrent parents, during Rabi-2022 and Kahrif-2023 in uniform blast nursery (UBN) at ICAR- Indian Institute of Rice Research, Hyderabad, India, as described in materials and methods. All the 20 BC₂F₂ plants were found highly resistant to blast with score ranging from 1-2. Among these, lines with the resistance score of 1 did not show any observable lesions on the leaves, lines with the resistance score of 2 showed tiny roundish to slightly extended necrotic grey spots of about 1-2 mm in diameter (Fig. 6) (Table-5). The recurrent parent, Jaya showed susceptibility to the disease with the typical blast lesions infection 26-50 per cent of the leaf area hence got the disease score of 7, while the donor parent MTU1010 (IL) showed resistance without any lesions with a disease score of 1.

Agro-morphological evaluation of twenty BC₂F₃ lines

All the backcross introgression lines were evaluated for agro-morphological traits in BC₂F₃ generation keeping recurrent parent Jaya as a check in randomized complete block design. All the introgression lines showed significantly early flowering, which is desirable in crop improvement and are significantly taller compared to recurrent parent (Fig. 7), more importantly all the introgression lines showed significant increase in single plant yield and grain number per panicle in comparison to recurrent parent Jaya (Fig. 8 and 9). Test weight and grain type all the BC₂F₃ lines were found similar to recurrent parent without any significant difference (Fig. 10) (Table 6).

Table 6. Agro-morphological characters, of selected BC₂F₃ lines

Genotypes	DFF	PH	NT	NPT	FG	UF	PL	PW	TW	SPY
Genotypes	Mean	Mean	Mean	Mean	Mean	Mean	Mean	Mean	Mean	Mean
Jaya (RP)	112.5±0.5	104.3±1.15	11±1	10.5±0.5	141±2	23±2	21.9±0.15	3.61±0.1	22.44±0.01	30.44±0.3
IJ-1	101±0	110.4±0.1	10.5±0.5	9±0	319±1	14.5±0.5	27.4±0.1	8.58±0.07	22.44±0.010	52.40±0.1
IJ-2	102.5±0.5	106.7±0.54	10.5±0.5	9.5±0.5	273.5±3.5	20±1	25.5±0.5	6.05±0.04	22.44±0.021	49.42±0.47
IJ-4	102±0	111±1.2	11±0	9.5±0.5	249.5±9.5	44.5±10.5	28±0.2	6±0.1	22.44±0.01	44.87±0.4
IJ-9	103±0	114.3±1.2	13±0	11±0	193.5±4.5	23.5±0.5	23.3±0.15	4.56±0.07	22.44±0.025	41.14±0.7
IJ-21	99.5±0.5	111.8±1.35	12.5±0.5	10±0	217±1	24±1	25.4±0.05	4.59±0.01	22.44±0	42.68±0.07
IJ-29	99.5±0.5	109±0.14	12±1	9.5±0.5	327±3	23.5±1.5	27.1±0.2	8.55±0.04	22.44±0.03	56.49±0.02
IJ-41	100.5±0.5	111.3±1.05	12.5±0.5	11.5±0.5	169.5±2.5	11.5±1.5	22.8±0.3	4.02±0.005	22.435±0	35.57±0.45
IJ-52	101±0	113.5±1.05	10.5±0.5	10±0	206.5±2.5	23±1	25.3±1.15	4.26±0.015	22.44±0.01	42±0.047
IJ-60	103.5±0.5	115.7±0.6	12.5±0.5	11.5±0.5	217.5±0.5	14.5±0.5	25.9±0.2	4.60±0.015	22.44±0	46.3±0.4
IJ-62	104.5±0.5	111.1±1.4	13.5±0.5	11±0	224.5±3.5	34 ±3	24.6±0.1	5.6±0.01	22.44±0.03	47.28±0.08
IJ-64	103.5±0.5	108.1±0.35	15.5±0.5	13.5±0.5	247.5±1.5	34.5±0.5	25.5±0.2	5.92±0.03	22.44±0.02	57.79±0.4
IJ-66	103±0	110±0.25	13.5±0.5	12.5±0.5	215.5±2.5	29±2	24.8±0.35	4.55±0.045	22.44±0	46.75±0.6
IJ-74	103±0	102±0.3	11±1	9.5±0.5	345±3	20.5±0.5	27.6±0.15	8.73±0.02	22.45±0	58.2±0.047
IJ-75	103.5±0.5	110.8±0.39	13.5±0.5	11±0	225.5±2.5	22±2	25.5±0.3	5.61±005	22.44±0	46.96±0.2
IJ-83	102±0	106.1±0.95	13.5±0.5	11.5±0.5	246±6	27.5±2.5	25.2±0.05	5.97±0.075	22.43±0.01	54.99±0.5
IJ-97	99.5±0.5	104.7±0.55	13±0	12±0	183±2	14±2	23.4±0.1	4.31±0.080	22.44±0.01	39.53±0.2
IJ-103	101±0	113.9±0.45	12.5±0.5	11.5±0.5	166±4	16±6	23±0.2	3.94±0.095	22.44±0.01	34.51±0.4
IJ-105	105±0	108.7±0.8	12±1	11.5±0.5	205±3	14.5±0.5	25.3±0.15	4.25±0.020	22.44±0	43.27±0.6
IJ-106	104±0	109.5±1.35	14.5±0.5	12.5±0.5	167.5±2.5	17±6	23.3±0.15	4.060	22.43±0	37.07±0.4
IJ-107	103±0	113.1±0.6	14.5±0.5	13.5±0.5	189.5±1.5	12±2	23.1±0.4	4.5±0.03	22.44±0	42.82±0.3
F value	66.59 ^***	17.67^***	5.76^***	11.21^***	250.81^***	1.53(NS)	27.48^***	912.52^***	0.114(NS)	381.48^***
SE(d)	0.481	1.193	0.841	0.554	4.868	9.580	0.460	0.073	0.018	0.560
C.D.	1.010	2.506	1.766	1.164	10.226	N/A	0.967	0.154	N/A	1.176

Jaya is a mid-early, high yielding, long bold rice variety released in the year 1968 and adopted by majority of the Indian states because it is well suited to high altitudes, wet and upland cultivation with its stable performances. Improving Jaya for BLB, blast resistance, and yield will always help the needy farmers to reduce the use of pesticides thereby reducing expenditure on the input costs and also to yield higher with normal cultivation practices. In the present study, we followed marker assisted backcrossing (MABC) to combine two biotic stress resistance genes and one yield enhancing gene into Jaya. Several high yielding, most consumer preferred rice varieties are being rejected by farmers due to lack of biotic and abiotic stress resistance/tolerance or average yields. In this context explicit introgression of beneficial genes/QTLs which provides resistance to multiple biotic stresses with good yield leads to farmers acceptance. In the past few years, several popular elite high yielding rice varieties were developed by incorporating blast and BLB genes together through marker assisted selection (MAS) utilizing foreground and background selection (Pinta et al. 2013; Jamaloddin et al. 2020). These reports provide evidence for the usefulness of MAS for development of disease resistance among rice varieties.

Most of the BLB resistance genes are dominant in nature, Xa21 is one among them. While some are recessive. Among the BLB resistance genes identified so far, Xa21 is one of the major and broadly acting resistant gene against many virulent isolates of the pathogen existing in India. Which was originally introgressed from Oryza longistaminata (Song et al. 1995). Many earlier studies have shown that through marker-assisted breeding, Xa21 can be successfully introgressed into elite rice varieties (Hari et al. 2013; Sundaram et al. 2008; Janaki Ramayya et al. 2021). Among the major blast resistance genes, Pi-kh, which has been recently renamed as Pi54 (Sharma et al. 2010) exhibits resistance to predominant races of the pathogen in India (Sharma et al. 2002) and hence could be an important target for introgression into blast susceptible elite rice cultivars. In rice, about 20 major effect genes were found to affect yield significantly. Even though 20 yield-related genes have been found in rice, only a small number of yield-positive alleles have been evaluated and used in rice breeding. The cytokinin oxidase/dehydrogenase2 (OsCKX2) gene (Gn1a), encodes cytokinin oxidase/dehydrogenase2 (OsCKX2), which transforms the biologically active cytokinin to its inert form. Gn1a, is the first map-based grain number QTL cloned from Habataki utilizing near-isogenic lines (NIL) (Feng et al. 2017) and is associated with the reduced cytokinin dehydrogenase activity. Reduced CKX2 expression causes cytokinin accumulation in the inflorescence meristem, which in turn increases both grain number as well as branches, thereby enhancing grain yield (Feng et al. 2017; Yeh et al. 2015). There are reports supporting the increased grain numbers through the introgression of Gn1a and other yield associated genes (Feng et al. 2017; Sung et al. 2018; Gouda et al. 2019; Reyes et al. 2021).

The scope of marker-assisted breeding for targeted introgression of BLB resistance genes Hajira et al. 2014; Pradhan et al. 2015; Sundaram et al. 2009; Balachiranjeevi et al. 2018) blast resistance genes (Hittalmani et al. 2000; Kiran et al. 2020; Rathour et al. 2022) demonstrated individually. Some of the studies targeting refinement of mega rice varieties for both BLB and blast resistance together (Mi et al. 2018; Swathi et al. 2019; Ramalingam et al. 2020). In all these studies, either BLB or blast resistance genes or BLB and blast together were introgressed into commercial varieties. As per the recent scientific publications, there is no report on simultaneous introgression of bacterial blight, blast resistance genes along with yield enhancing genes in commercial varieties. The PCR-based DNA markers used in the present study (i.e. pTA248, PikhMas and Gn1a Indel-3) are tightly linked to Xa21, Pi54 and Gn1a genes discretely, and hence, we were able to identify the triple-positive plants precisely without any false positives at any stage of MABC breeding.

Evaluation of BC₂F₂ and BC₂F₃ lines for targeted BLB resistance and BC₂F₃ and BC₂F₄ lines for blast resistance at ICAR- Indian Institute of Rice Research, indicated the effectiveness of the Xa21 and Pi54 in imparting resistance to backcross derived lines for BLB and blast respectively. All the 20 backcross derived lines with Xa21 gene showed resistance with a lesion length of < 2 cm and the recurrent parent, Jaya, showed susceptibility to the disease with a lesion length of > 10 cm in both the seasons. There are similar pattern of dominant and broad spectrum resistance were observed with other reports upon introgression of Xa21 alone into the susceptible rice variety (Nguyen et al. 2018; Biswas et al. 2021) Studies also highlighted the major effect of Xa21 gene in imparting resistance against various isolates of Xoo in gene pyramiding approach for BLB resistance in combination with other BLB genes (Pradhan et al. 2016; Biswas et al. 2021; Fiyaz et al. 2022).

Similarly, all the 20 BC₂F₃ and BC₂F₄ plants derived from the cross Jaya/MTU1010 (IL) were screened for their resistance against blast along with the donor and recurrent parents during Rabi-2022 and Kharif-2023 at uniform blast nursery (ICAR- Indian Institute of Rice Research, Hyderabad, India). Among these twenty BC₂F₃ and BC₂F₄ plants, majority of the lines showed resistance score of 1 without any observable lesions on the leaves. Few lines recorded a resistance score of 2 with small roundish to slightly elongated necrotic grey spots, about 1–2 mm in diameter. Varied response of genotypes with similar gene introgression is due to epistatic interactions or genetic background of that particular genotype in which we have transferred (Yadav et al. 2019). The recurrent parent, Jaya, showed susceptibility to the disease with the typical blast lesions infection 26–50 percent of the affected leaf area with a disease score of 7, while the donor parent MTU1010 isogenic line showed resistance without any lesions with a disease score of 1in both the seasons. Similar type of broad spectrum resistance was observed after introgressing Pi54 in previous studies (Zhang et al. 2018; Kiran et al. 2020) indicating effectiveness of Pi54 in imparting the resistance against blast pathogen.

All the 20 selected BC₂F₂ plants were forwarded to BC₂F₃ generation and evaluated for their agro morphological and yield contributing traits in randomized complete block design, during Rabi-2022. The evaluation was carried out for, days to fifty per cent flowering, plant height, the total number of tillers per plant, number of productive tillers per plant, panicle length, panicle weight, number of filled grains per panicle, number of unfilled grains per panicle, test weight, grain type and for single plant yield (Table 6). All the BC₂F₃ introgression lines differed significantly and showed earliness with respect to days to fifty per cent flowering as compared to the recurrent parent Jaya, earliness one of the most preferred trait in rice, hence the obtained introgression lines will best preferred by farmers compared to original recurrent parent. All the BC₂F₃ plants significantly out-yielded the recurrent parent with respect to single plant yield and grain number per panicle indicating the effectiveness of Gn1a introgression into the recurrent parent Jaya. Number of filled grains per panicle of the backcross derived lines with Gn1a were found increased significantly when compared to recurrent parent in both the generations and there were many similar results obtained when introgressed with Gn1a gene in different varieties (Ashikari et al. 2005; Ohsumi et al. 2011; Reyes et al. 2021). Plant height found to be increased significantly when compared to recurrent parent among all the twenty back cross derived lines but had strong culm, and this is because of the genetic influence of donor parent. As plant height and days to flowering influenced by additive gene action, even with stringent background genome recovery these traits were significantly differing with recurrent parents, similar results have been reported by many other researchers (Wang et al. 2021; Yazid et al. 2021). As compared to the earlier successful reports (Sruthi et al. 2016, Singh et al. 2022; Sundaram et al. 2008; Basavaraj et al. 2010). We have screened higher number of parental polymorphic markers (i.e. 862 SSR markers) and obtained great number of polymorphic markers (i.e. 118) across the chromosomes with a better coverage per chromosome (~ 9.8 polymorphic markers per chromosome) for genetic background selection in BC₁F₁ and BC₂F₁ generations. In addition to SSR, 1K-RiCA (1094 SNP’s) analysis also carried out between the parents and obtained 377 polymorphic SNP’s and these were used for estimation of background genome recovery in backcross derived lines in BC₂F₂ generation. Nine out of twenty BC₂F₂ lines were found to have a background recovery of more than 90 per cent, with an average of 91.97 per cent. IJ-4 (96.28%), IJ-107 (93.89%) and IJ-97 (92.83%) were found to have the highest background recovery with higher genotypic similarities to recurrent parent among all the BC₂F₂ lines. All the backcross-derived BC₂F₃ plants were almost phenotypically identical to the recurrent parent for most of the agronomical characters studied. Backcross-derived improved lines were observed to be superior with respect to bacterial leaf blight, blast resistance and in terms of yield. Introgression lines, IJ-4 and IJ-107 were considered as outstanding lines with all the desirable combinations of characters from both the donor and recurrent parent, coupled with maximum recurrent parent genome recovery.

Current study aims for the improvement of Jaya for targeted traits generated improved versions of Jaya with higher yield (Gn1a) coupled with BLB (Xa21) and blast (Pi54) resistance. The strategy of simultaneous foreground, background and phenotypic selection found to be promising technique in identifying perfect backcross introgressed lines which are superior to recurrent parent for the targeted traits while retaining the genetic background of elite recurrent parent. Among these twenty lines two lines which possess higher similarities with the recurrent parents (IJ-4 and IJ-107) will be tested for their superiority over recurrent parent in multi-location trails under AICRPR testing system. All the backcross derived lines can be used as novel donor source in crossing programs.

BLB : Bacterial Leaf Blight

bp : Base pair

D : Donor parent

ha : Hectare (s)

HR12 : Himmatsagar Rice-12

ICAR : Indian Council of Agricultural Research

IIRR : Indian Institute of Rice Research

IJ : Improved Jaya

IL : Isogenic Line

InDel : Insertion – Deletion

ISM : Improved Samba Mahsuri

J : Jaya

MABB : Marker Assisted Backcross Breeding

MABC : Marker Assisted Backcross

MAS : Marker Assisted Selection

PCR : Polymerase Chain Reaction

QTL : Quantitative Trait Loci

R : Recurrent Parent

RiCA : Rice Custom Amplicon

SES : Standard Evaluation System

SM : Samba Mahsuri

SNP : Single Nucleotide Polymorphism

SSR : Simple Sequence Repeat

Acknowledgments

Investigator would like to acknowledge ICAR- Indian Institute of Rice Research, for providing research materials and other necessary facilities. Authors also like to acknowledge Mahatma Phule Krishi Vidyapeeth, Rahuri for extending technical support for research activities.

Author Contributions

Conceptualization and methodology, AFR, KPV, RKS and DKGD; Validation, AFR; Formal analysis, KC, SM, SB and RPVS; Investigation, DKGD, PP, KMBVN and BK; Resources, SRM, SRLV and BK; Data curation, AFR, CVP and SD; Writing—original draft preparation, DKGD; Writing-review and editing, DKGD, KC and AFR; Supervision, AFR, LGS and AKJ; Project administration, AFR and SRM; Funding acquisition, AFR and SRM. All authors have read and agreed to the publication of the manuscript.

Funding: This research was supported by Department of Biotechnology (DST-SERB), grant number CRG/2020/004953, Government of India.

Availability of Data and Materials: All the supporting data of the findings are available in the main manuscript and the supplementary files. The developed backcross derived lines can be obtained from IIRR with proper material-transfer agreement (MTA).

Ethics approval and consent to participate: Not applicable.

Consent for Publication: The manuscript has been approved by all authors.

Conflicts of Interest: The authors declare no conflict of interest.

Annegowda DC, Prasannakumar MK, Mahesh HB, Siddabasappa CB, Devanna P, Banakar SN, Prasad SR (2021) Rice blast disease in India: present status and future challenges. Int Adv Rice Res 157-197.
Arbelaez JD, Dwiyanti MS, Tandayu E, Llantada K, Jarana A, Ignacio JC, Platten JD, Cobb J, Rutkoski JE, Thomson MJ, Kretzschmar T (2019) 1k-RiCA (1K-Rice Custom Amplicon) a novel genotyping amplicon-based SNP assay for genetics and breeding applications in rice Rice. 12(1):1-5.
Ashikari M, Sakakibara H, Lin S, Yamamoto T, Takashi T, Nishimura A, Angeles ER, Qian Q, Kitano H, Matsuoka M (2005) Cytokinin oxidase regulates rice grain production. Science 309(5735):741-5.
Balachiranjeevi C, Naik B, Kumar A, Harika G, Hajira S, Kumar D, Anila M, Kale R, Yugender A, Pranathi K, Koushik M (2018) Marker-assisted pyramiding of two major broad-spectrum bacterial blight resistance genes, Xa21 and Xa33 into an elite maintainer line of rice, DRR17B. PLoS One 13(10): e0201271.
Basavaraj SH, Singh VK, Singh A, Singh A, Singh A, Anand D, Yadav S, Ellur RK, Singh D, Gopala Krishnan S, Nagarajan M (2010) Marker-assisted improvement of bacterial blight resistance in parental lines of Pusa RH10, a superfine grain aromatic rice hybrid. Molecular breeding. 26:293-305.
Biswas PL, Nath UK, Ghosal S, Goswami G, Uddin MS, Ali OM, Latef AA, Laing AM, Gao YM, Hossain A (2021) Introgression of Bacterial Blight Resistance Genes in the Rice Cultivar Ciherang: Response against Xanthomonas oryzae pv. oryzae in the F₆ Generation. Plants 10(10):2048.
Chen S, Lin XH, Xu CG, Zhang Q (2000) Improvement of bacterial blight resistance of ‘Minghui 63’, an elite restorer line of hybrid rice, by molecular marker‐assisted selection. Crop Science. 40(1):239-44.
Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical bulletin 19:11-15.
Feng X, Wang C, Nan J, Zhang X, Wang R, Jiang G, Yuan Q, Lin S (2017). Updating the elite rice variety Kongyu 131 by improving the Gn1a locus. Rice 10(1):1-1
Fiyaz RA, Yadav AK, Krishnan GS, Ellur RK, Bashyal BM, Grover N, Bhowmick PK, Nagarajan M, Vinod KK, Singh NK, Prabhu KV, Singh AK (2016) Mapping quantitative trait loci responsible for resistance to Bakanae disease in rice. Rice 9(1): 45.
Fiyaz RA, Shivani D, Chaithanya K, Mounika K, Chiranjeevi M, Laha GS, Viraktamath BC, Rao LS, Sundaram RM (2022) Genetic improvement of rice for bacterial blight resistance: Present status and future prospects. Rice Science 29(2):118-32.
Gouda G, Parida M, Donde R, Kumar M, Gupta J. K, Mohanty S, Panda RS, Dash SK, Pradhan SK, Mohapatra T, Behera L (2019) Identification of high grain number genes and assessment of genetic diversity in high and low grain number rice genotypes useful for marker-assisted selection breeding programs. Ann. Plant Soil Res 21(4):301-311.
Hajira SK, Yugander A, Balachiranjeevi CH, Pranathi K, Anila M, Mahadevaswamy H. K (2014). Development of Durable Bacterial Blight Resistant Lines of Samba Mahsuri possesing Xa33, Xa21, xa13 and xa5. Progress Res J 9:1224-1227.
Hari Y, Srinivasarao K, Viraktamath BC, Hari Prasad AS, Laha GS, Ahmed M, Natarajkumar P, Sujatha K, Srinivas Prasad M, Pandey M, Ramesha MS (2013) Marker‐assisted introgression of bacterial blight and blast resistance into IR 58025B, an elite maintainer line of rice. Pl Breed 132(6):586-94.
Hittalmani S, Parco TV, Mew RS, Zeigler Huang N (2000) Fine mapping and DNA marker-assisted pyramiding of the three major genes for blast resistance in rice. Theor Appl Genet 100: 1121-1128.
Hori K and Shenton M (2022) Current Advances and Future Prospects for Molecular Research for Agronomically Important Traits in Rice. Int J Mol Sci 23(14): 7531.
Jamaloddin M, Durga Rani CV, Swathi G, Anuradha C, Vanisri S, Rajan CP, Krishnam Raju S, Bhuvaneshwari V, Jagadeeswar R, Laha GS, Prasad MS (2020) Marker Assisted Gene Pyramiding (MAGP) for bacterial blight and blast resistance into mega rice variety “Tellahamsa”. PloS one 15(6):e0234088.
Janaki Ramayya P, Vinukonda VP, Singh UM, Alam S, Venkateshwarlu C, Vipparla AK, Dixit S, Yadav S, Abbai R, Badri J, Phani Padmakumari A (2021) Marker-assisted forward and backcross breeding for improvement of elite Indian rice variety Naveen for multiple biotic and abiotic stress tolerance. PLoS One 16(9):e0256721.
Kauffman HE, Reddy APK, Hsieh SPY, Merca SD (1973) An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis Rep 57(6):537-541.
Kim SR, Ramos J, Ashikari M, Virk PS, Torres EA, Nissila E, Hechanova SL, Mauleon R, Jena KK (2016) Development and validation of allele-specific SNP/indel markers for eight yield-enhancing genes using whole-genome sequencing strategy to increase yield potential of rice, Oryza sativa L. Rice 9(1):1-17.
Kim SR, Ramos JM, Hizon RJ, Ashikari M, Virk PS, Torres EA, Nissila E, Jena KK (2018) Introgression of a functional epigenetic OsSPL 14 WFP allele into elite indica rice genomes greatly improved panicle traits and grain yield. Scientific reports 8(1):3833.
Kiran U, Sharma M, Salgotra RK, Singh B, Singh A (2020) Introgression of Pi54 gene through marker assisted backcross breeding for development of blast resistant genetic stocks in rice. J pharmacogn Phytochem 9(6):1034-40.
Mi J, Yang D, Chen Y, Jiang J, Mou H, Huang J, Ouyang Y, Mou T (2018) Accelerated molecular breeding of a novel P/TGMS line with broad-spectrum resistance to rice blast and bacterial blight in two-line hybrid rice. Rice 11:11-17.
Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H (1986) Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. In Cold Spring Harbor Symposia on Quantitative Biology 51:263-273.
Nguyen HT, Vu QH, Van Mai T, Nguyen TT, Vu LD, Nguyen TT, Nguyen LV, Vu HT, Nong HT, Dinh TN, Toshitsugu N (2018) Marker-Assisted Selection of Xa21 conferring resistance to bacterial leaf blight in indica rice cultivar LT2. Rice Sci 25(1):52-56.
Ohsumi A, Takai T, Ida M, Yamamoto T, Arai-Sanoh Y, Yano M, Ando T, Kondo M. (2011) Evaluation of yield performance in rice near-isogenic lines with increased spikelet number. Field Crops Res 120(1):68-75.
Pinta W, Toojinda T, Thummabenjapone P, Sanitchon J (2013) Pyramiding of blast and bacterial leaf blight resistance genes into rice cultivar RD6 using marker assisted selection. Afr J Biotechnol 12:4432-4438.
Pradhan SK, Nayak DK, Mohanty S, Behera L, Barik SR, Pandit E, Lenka S, Anandan A (2015) Pyramiding of three bacterial blight resistance genes for broad-spectrum resistance in deepwater rice variety, Jalmagna Rice. 8(1):1-14.
Pradhan SK, Nayak DK, Pandit E, Behera L, Anandan A, Mukherjee AK, Lenka S, Barik DP (2016). Incorporation of bacterial blight resistance genes into lowland rice cultivar through marker-assisted backcross breeding. Phytopathol 106(7):710-718.
Preece TF, Rhodes ME, Skinner FA (1982) Progression of bacterial disease within plants. Bacteria and plants, eds Acadamic Press London, pp:71-83.
Ramalingam J, Raveendra C, Savitha P, Vidya V, Chaithra TL, Velprabakaran S, Saraswathi R, Ramanathan A, Arumugam Pillai MP, Arumugachamy S, Vanniarajan C (2020) Gene pyramiding for achieving enhanced resistance to bacterial blight, blast, and sheath blight diseases in rice. Front Plant Sci 16:62-72.
Rathour R, Kumar R, Thakur K, Pote TD (2022) Genetic improvement for blast resistance in high-yielding cold-tolerant rice (Oryza sativa L.) cultivar Himalaya 741 by marker-assisted backcross breeding. Biotechnol 12(8): 1-12.
Reyes VP, Angeles-Shim RB, Mendioro MS, Manuel MCC, Lapis RS, Shim J, Sunohara H, Nishiuchi S, Kikuta M, Makihara D, Jena KK (2021) Marker-assisted introgression and stacking of major QTLs controlling grain number (Gn1a) and number of primary branching (WFP) to NERICA cultivars. Plants 10(5):844.
Ronald PC, Albano B, Tabien R, Abenes L, Wu K, Mc Couch SR, Tanksley SD (1992) Genetic and physical analysis of the rice bacterial blight disease resistance locus, Xa21. Mol Genet Genom 236:113-120.
Sharma TR, Chauhan RS, Singh BM, Paul R, Sagar V, Rathore R (2002) RAPD and pathotype analysis of Magnaporthe grisea population from North-Western Himalayan region of India. J Phytopathol 150:649-656.
Sharma TR, Madhav MS, Singh BK, Shanker P, Jana TK, Dalal V, Pandit A, Singh A, Gaikwad K, Upreti HC, Singh NK (2005) High-resolution mapping, cloning and molecular characterization of the Pikh gene of rice, which confers resistance to Magnaporthe grisea. Mol Genet Genom 274:14-26.
Sharma TR, Rai AK, Gupta SK. Singh NK (2010) Broad-spectrum blast resistance gene Pi-kh cloned from rice line Tetep designated as Pi54. J Plant Biochem Biotechnol 19:87-89.
Singh SK, Majhi PK, Anandan A, Korada M, Habde SV, Khaire AR, Singh DK, Jayasudha S, Singh A, Bhagvan AP (2022) Microsatellites based parental polymorphism survey for moisture stress in Rice (Oryza sativa L.) between the parental genotypes HUR-1309 and CR Dhan 801. Emergent Life Sci Res 8:248-258.
Singh UD, Gogoi R, Mondal KK (2011) Molecular approach for augmenting disease resistance in cereals: rice and maize. In: Plant pathology in India: vision 2030. New Delhi, India: Indian Phytopathological Society pp: 230-294.
Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu LH, Fauquet C (1995) A receptor kinaselike protein encoded by the rice disease resistance gene, Xa21. Sci 270:1804-1806.
Srinivasan MC, Thirumalachar MJ, Patel MK (1959) Bacterial blight disease of rice. Curr Sci 959:28-46.
Sruthi K, Eswari KB, Kemparaju KB, Jayaramulu K, Madhav MS (2016) SSR marker aided parental polymorphism survey for stigma exsertion in maintainer lines of hybrid rice. Green Farming int j 7(4):1-9.
Sundaram RM, Vishnupriya MR, Biradar SK, Laha GS, Reddy AG, Rani NS, Sarma NP, Sonti RV (2008) Marker assisted introgression of bacterial blight resistance in Samba Mahsuri, an elite indica rice variety. Euphytica, 160:411–22.
Sundaram RM, Vishnupriya MR, Laha GS (2009) Introduction of bacterial blight resistance into Triguna, a high yielding, mid-early duration rice variety. Biotechnol J 4: 400-407.
Sung KR, Ramos JM, Hizon RJM, Ashikari M, Virk PS, Torres EA (2018) Introgression of a functional epigenetic OsSPL14WFP allele into elite indica rice genomes greatly improved panicle traits and grain yield. Sci Rep 8(1):1-12.
Swathi G, Durga Rani CV, Md J, Madhav MS, Vanisree S, Anuradha C, Kumar NR, Kumar NA, Kumari KA, Bhogadhi SC, Ramprasad E (2019) Marker-assisted introgression of the major bacterial blight resistance genes, Xa21 and xa13, and blast resistance gene, Pi54, into the popular rice variety, JGL-1798. Mol Breed 39(4):1-2.
Wang X, Guo X, Ma X, Luo L, Fang Y, Zhao N, Li R (2021) Development of new rice (Oryza sativa L.) breeding lines through marker-assisted introgression and pyramiding of brown plant hopper, blast, bacterial leaf blight resistance, and aroma genes. Agron 11(12): 2525.
Yadav S, Sandhu N, Majumder RR, Dixit S, Kumar S, Singh SP, Mandal NP, Das SP, Yadaw RB, Singh VK, Sinha P (2019) Epistatic interactions of major effect drought QTLs with genetic background loci determine grain yield of rice under drought stress. Sci Rep 9(1):2616.
Yazid SN, Ahmad K, Razak MS, Rahman ZA, Ramachandran K, Mohamad SN, Ghaffar MA (2021) Introgression of bacterial leaf blight (BLB) resistant gene, Xa7 into MARDI elite variety, MR219 by marker assisted backcrossing (MABC) approach. Braz J Biol 84: 225-237.
Yeh SY, Chen HW, Ng CY, Lin CY, Tseng TH, Li WH, Ku MS (2015) Down-regulation of cytokinin oxidase 2 expression increases tiller number and improves rice yield. Rice 8(1):1-13.
Zhang L, Nakagomi Y, Endo T, Teranishi M, Hidema J, Sato S, Higashitani A (2018) Divergent evolution of rice blast resistance Pi54 locus in the genus Oryza. Rice 11:1-13.

No competing interests reported.

Supplementaryfile.docx
Supplementary Materials Supplementary Figure 1: Confirmation of true F₁s of a cross between MTU1010 IL and Jaya using pTA248 marker. (DOCX). Supplementary Figure 2: Foreground selection of BC₁F₁ plants for Xa21, Pi54 and Gn1a genes using gene linked markers. (A) Foreground selection for Xa21 gene using pTA248 marker (B) Foreground selection for Pi54 gene using PikhMas marker (C) Foreground selection for Gn1a gene using Gn1a Indel-3 marker. D-Donor parent, MTU1010; R-Recurrent parent, Jaya; 1-16: BC₁F₁ plants. Plant number 2, 4, 6, 7 and 11 are positive for all the 3 targeted genes. Red color arrows indicate a single positive plant for the targeted trait. (DOCX). Supplementary Figure 3. (A): Foreground selection of BC₂F₁ plants for Xa21 gene using pTA248 marker, (B): Foreground selection of BC₂F₁ plants for Gn1a gene using Gn1a Indel-3 marker, (C): Foreground selection of BC₂F₁ plants for Pi54 gene using PikhMas marker (DOCX). Supplementary Figure 4. (A): Foreground selection of BC₂F₂ plants for Xa21 gene using pTA248 marker, (B): Foreground selection of BC₂F₂ plants for Gn1a gene using Gn1a Indel-3 marker, Foreground selection of BC₂F₂ plants for Pi54 using PikhMas marker (DOCX).

Introgression of genes associated with yield enhancement and resistance against bacterial leaf blight and blast diseases into an elite rice variety, ‘Jaya’ through marker assisted backcrossing

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1