Study area and sand flies collections
The study was carried out in Amapala municipality (N13 15.618, W87 37.463), Valle department, with an area of 80.7 km2. The municipality comprises two islands, Zacate Grande and El Tigre, located in the Gulf of Fonseca in the southern Honduras. Sand flies were sampled for five consecutive nights in May 2018 on five localities (Las Pelonas, Punta Honda, Tigüilotada, Islitas and Playa Grande). Samplings was carried out to 18:00 at 6:00 h, using automatic CDC miniature light traps (model 512; John W. Hock Co., Gainesville, FL, USA) in neighborhoods selected by the presence of active cases of Non-ulcerative or atypical cutaneous leishmaniosis (NUCL). The traps were installed in peri-domiciliary environment, mainly near of decomposing organic matter, or next to the latrines. The specimens were separated and processed the day after the capture.
Taxonomic identification of Sand fly species
The phlebotomine sand flies were mounted for morphological identification, following the procedures outlined by Mejía et al., 2018 [6]. The sand fly species were identified according to Young and Duncan, 1994 [5], and the genera and species classification is presented according Galati´s key, 2017 [11].
Genomic material extraction and polymerase chain reaction (PCR)
Genomic DNA was extracted only from the bowel dissection of individual female sand flies using Chelex® 100 (Bio-Rad Lab Inc., Hercules, California, USA). As an internal control of the extraction of DNA, the cacophony IVS6 gene present in the genome of sand flies was amplified [12]. For the detection of genus Leishmania we use the primers Leish1: 5′- AACTTTTCTCTGGTCCTCCGGGTAG-3′ and Leish2: 5′-ACCCCCAGTTTCCCGCC-3 ′ in order to amplify a ≈120-base-pair fragment of the Leishmania kinetoplast DNA minicircle [13]. Amplifications were performed using a commercial kit (Master Mix 2X -Promega). Each reaction was performed by adding 4 µL of target DNA and 0.6 µmol/L of each primer in a final volume of 20 µL. The PCR reactions were done in a Applied Biosystem 2770 Thermal Cycler (ThermoFisher Scientific/USA), under the following conditions initial denaturation cycle at 94°C for 5 minutes, followed by 35 cycles alt 94°C for 15s, 60°C for 20s and 72°C for 60s, and final extension of 72°C for 10 min. The amplification products were analyzed by electrophoresis in a 1.5% agarose gel.
To characterize the Leishmania species, PCR-RFLP was performed which amplifies a specific region of the hsp70 gene [14] . Primers used were hsp70 sense (5 'GACGGTGCCTGCCTACTTCAA 3') and hsp70 antisense (5 'CCGCCCATGCTCTGGTACATC 3'). Reaction mixture was prepared in a final volume of 50 µL with 25 µL of Master Mix 2X (Promega), 5 µL of target DNA and 0.6 µmol/L of each primer. The PCR reactions were done under the following conditions initial denaturation at 94°C for 5 min, followed by 37 cycles at 94°C for 30 s, 61°C for 1 min and 72°C for 3 min, and a final extension cycle at 72°C for 10 min. The amplification products were analyzed by electrophoresis in a 2% agarose gel. To perform the restriction of PCR products, the enzyme Hae III (Promega) was used, adding 5 µL of amplified DNA to the reaction and incubated at 37ºC for 3 h. The profiles of each species were observed using a 2% agarose gel subjected to electrophoresis as described by Montalvo [15].