An Experimental Animal Model of Mechanical Loading
Male Sprague–Dawley rats 6–8 weeks of age (Weitong Lihua Experimental Animal Center, Beijing, China) were used in this study. The animal experimental protocols were approved by the Institutional Animal Care and Use Committee of Peking University (LA2013-92). To establish an experimental animal model of mechanical loading, nickel-titanium coil springs (0.2 mm thickness, 1 mm diameter, 4 mm length; Smart Technology, Beijing, China) were ligated between the right maxillary first molar and the incisors (Fig. S1). Each coil spring can provide a constant force of ~ 0.6 N to move teeth [11, 18, 19]. The contralateral first molar served as the control. After 3 and 7 days of treatment (F 3d, F 7d), the rats (n = 6) were sacrificed by overdose of pentobarbital sodium, and the maxillae were harvested, fixed in 4% paraformaldehyde (PFA), and scanned by Micro-computed tomography (micro-CT, Skyscan1174, Bruker, Belgium) at a resolution of 10 µm. The acquired axial images were imported into a NRecon and CTvox software for 3-D reconstruction. Another 12 rats on day 7 were sacrificed by excessive anesthesia and the maxillary first molars of both sides were separated for the culture of primary cells. An occlusal view of the maxillae was obtained using a stereomicroscope (SWZ1000, Nikon). The distance of tooth movement induced by the mechanical loading was measured using a modified method described previously [19]. Briefly, the distance between two easily located points (the midpoint of the distal-marginal ridge of the first molar and the midpoint of the mesial-marginal ridge of the second molar) was measured by two trained researchers, who were blinded to the group assignment. The average of two measurements was calculated as the tooth movement distance.
Hematoxylin and Eosin and Tartrate-Resistant Acid Phosphatase Staining
The fixed maxillae were demineralized in 15% ethylenediaminetetraacetic acid and embedded in paraffin. Consecutive 4-µm-thick transverse sections were obtained from the corresponding group and stained with hematoxylin and eosin (H&E) and tartrate-resistant acid phosphatase (TRAP) staining. TRAP staining was performed using an acid phosphatase kit (387A-1KT; Sigma) according to the manufacturer’s instructions. TRAP-positive, multinucleated (> 3 nuclei) cells attached to the alveolar bone surface were counted (n = 5) [20].
Immunofluorescence Staining
Immunofluorescence staining was performed as described previously [21]. Tissue sections were double-stained with anti-CD146 (1:200, ab-75769, Abcam) and anti-Ki67 (1:200, ab8191; Abcam) or anti-TRPV4 (1:200, ab39260; Abcam) antibodies. Other sections were stained with anti-interleukin (IL)-6 (1:200, ab9324; Abcam) and anti-IL-1β (1:200, ab9722, Abcam) antibodies. Next, the sections were incubated with fluorescein isothiocyanate-conjugated or tetramethylrhodamine isothiocyanate-conjugated secondary antibodies (1:200; Jackson ImmunoResearch Laboratories). Nuclei were counterstained with 4′,6-diamidino-2-phenylindole. Confocal microscopic images were processed with LSM 5 Release 4.2 software following acquisition with a laser-scanning microscope (LSM 510; Zeiss).
Isolation, Culture, and Treatment of PDLSCs
To obtain rat PDLSCs (rPDLSCs) subjected to in vivo mechanical loading (F-PDLSCs), periodontal tissues from the rat maxillary force-induced first molar were lightly separated, minced, and digested in a fresh enzyme mixture, comprising 3 mg/mL collagenase type I (Worthington Biochemical) and 4 mg/mL dispase II (Roche Diagnostics) for 60 min at 37 °C. After passing through a 70-µm strainer, single-cell suspensions were cultured in α-modified Eagle’s medium supplemented with 15% fetal bovine serum, 2 mM L-glutamine, and 100 U/mL penicillin/streptomycin. rPDLSCs isolated from normal periodontal tissues (N-PDLSCs) in the contralateral first molar served as the control. To remove the nonadherent cells, the cultures were washed twice with phosphate-buffered saline (PBS). The attached primary cells were cultured for 10 days and then were subcultured. rPDLSCs at passage 2 were used in this study. To inhibit expression of TRPV4 in force-induced rPDLSCs, a pharmacological antagonist (GSK2193874, Selleck) was added to the culture medium with the final concentration of 10 µM.
Human PDLSCs (hPDLSCs) were isolated from extracted teeth and cultured as described previously [10]. Permission to obtain extracted teeth was provided by the Ethics Committee of Peking University (PKUSSIRB-201311103). hPDLSCs isolated from 3 different individuals were pooled together and cells at passages 2–3 were used in this study. Static compressive force was applied to the hPDLSCs as described previously [13]. Briefly, a layer of glass and additional metal balls were placed on a 70–80% confluent cell layer in six-well plates. hPDLSCs were subjected to static compressive forces of 0–1.5 g/cm2 for 12 h.
To inhibit the activation of TRPV4 in hPDLSCs, GSK2193874 (10 µM) was added to the medium for 1 h prior to compressive force stimulation (1.5 g/cm2, 12 h). To activate the TRPV4, hPDLSCs were treated by a pharmacological agonist (GSK1016790A, Selleck) with the final concentration of 10 nM for 1 h. For the control group, dimethyl sulfoxide (DMSO) of the same volume was added.
Cell Proliferation and Colony Forming Units-fibroblastic Assay
Cell proliferation was monitored using a CCK-8 kit (Sigma) according to the manufacturer’s instructions. Rat PDLSCs isolated ex vivo were incubated with CCK-8 reagent at 37 °C for 2 h. Next, the absorbance at 450 nm was measured using a microplate reader (Bio-Rad, Japan).
Cells (500 per well) were seeded and incubated in six-well plates for 14 days in growth medium and fixed with 4% PFA (Sigma). Next, 0.1% crystal violet was used to stain the cells. Colonies of more than 50 cells were defined as single colony clusters, and the number of clusters was counted.
Multipotent Differentiation of PDLSCs Ex Vivo
We evaluated the multi-differentiation potential of rPDLSCs isolated ex vivo with or without force loading toward osteogenesis and adipogenesis as reported previously [10]. To induce osteogenesis, the medium was changed to osteogenic medium (growth medium with 10 nM dexamethasone, 100 µM ascorbic acid 2-phosphate, and 10 mM β-glycerophosphate). After culture in osteogenic medium for 21 days, the cells were fixed in 4% PFA and stained with 1% Alizarin Red S (Sigma) at room temperature. The Alizarin Red-positive area was measured using ImageJ software and is expressed as the percentage of Alizarin Red-positive area over the total area. For adipogenic induction, cells were cultured in adipogenic medium (growth medium with 500 µM isobutyl-methylxanthine, 60 µM indomethacin, 0.5 µM hydrocortisone, and 10 µM insulin) for 3 weeks. After fixing in 60% isopropanol, the cells were stained with 0.3% Oil Red O (Sigma) and the number of Oil Red O-positive droplet-containing cells was counted.
Co-culture of PDLSCs and RAW264.7 Macrophages
Transwell Migration System
To investigate their chemoattractive activity, rPDLSCs isolated ex vivo with or without force loading were seeded into six-well plates, and RAW264.7 macrophages were added to the upper chamber of the Transwell migration system at 1 × 105/well. RAW264.7 macrophages were co-cultured with rPDLSCs isolated ex vivo for 24 h, and cells remaining in the upper chamber were gently removed using cotton swabs. After washed twice with PBS, the Transwell chambers were fixed in 4% PFA and stained with 0.1% crystal violet for 15 min. Cells stained by crystal violet on the bottom surface served as the migrated cells and were counted under an inverted microscope.
Direct Cell-to-Cell Contact System
To investigate their osteoclastogenesis, rPDLSCs isolated ex vivo with or without force loading were seeded into 12-well plates at 5 × 103/well and RAW264.7 macrophages were added at 5 × 105/well. To induce osteoclast differentiation, soluble receptor activator of nuclear factor-κB ligand (sRANKL) (50 ng/mL) was added to the medium [22]. After co-culturing for 7 days, the cells were fixed and stained with an acid phosphatase kit (387A-1KT; Sigma) for TRAP staining. TRAP-positive, multinucleated (two or more nuclei) osteoclasts were counted in five visual fields per well (n = 3). The final result was the average of three experiments.
Quantitative Reverse-Transcription Polymerase Chain Reaction
Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Reverse-transcription and real-time PCR were performed following protocols described in detail previously. The primers (designed using Primer Premier 5.0 software) were as follows: for rat β-actin, sense/antisense: 5′-TGACAGGATGCAGAAGGAGA-3′/5′-TAGAGCCACCAATCCACACA-3′; IL-1β, sense/antisense: 5′-CACCTCTCAAGCAGAGCACAG-3′/5′-GGGTTCCATGGTGAAGTCAAC-3′; tumor necrosis factor (TNF)-α, sense/antisense: 5′-CCAGGTTCTCTTCAAGGGACAA-3′/5′-CTCCTGGTATGAAATGGCAAATC-3′; IL-6, sense/antisense: 5′-CCAAGACCATCCAACTCATCTTG-3′/5′-CACAGTGAGGAATGTCCACAAAC; monocyte chemoattractant protein (MCP)-1, sense/antisense: 5′-CAGCCAGATGCAATCAATGCC-3′/5′-TGGAATCCTGAACCCACTTCT-3′; TPRV1, sense/antisense: 5′- GCCGCTGAACCGACTC-3′/5′-CCCATCTGCTGGAAAC-3′; TPRV2, sense/antisense: 5′-CGCCATTGAGAAGAGGAGTC-3′/5′-GCTTACCACATCCCACTGCT-3′; TPRV3, sense/antisense: 5′-GCGTGGAGGAGTTGGTAGAG-3′/5′-CTCTGTGTACTCGGCGTTGA-3′; and TPRV4, sense/antisense: 5′-CAGGTGGGGAGGCTTTT-3′/5′-GCGGCTGCTTCTCTATG-3′. For human GAPDH, sense/antisense: 5′-ATGGGGAAGGTGAAGGTCG-3′/5′- GGGGTCATTGATGGCAACAATA; TNF-α, sense/antisense: 5′- CCTCTCTCTAATCAGCCCTCTG-3′/5′- GAGGACCTGGGAGTAGATGAG-3′; IL-6, sense/antisense: 5′- CGGTCCAGTTGCCTTCT-3′/5′- GCCAGTGCCTCTTTGCT; The efficiency of the newly designed primers was confirmed by sequencing the products of conventional PCR.
Western Blot Analysis
Cells were lysed with RIPA buffer mixed with protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific, USA). Total protein (25 µg) was separated by 10% SDS-polyacrylamide gel and then transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, USA). After being blocked in 5% nonfat milk in Tris-buffered saline containing 0.1% Tween-20 for 1 h at room temperature, the membranes were incubated overnight at 4 °C with primary antibodies as following: anti-TRPV4 (ab39260; Abcam), anti-Ki67 (ab8191; Abcam), anti-IL-6 (ab9324; Abcam), anti-RANKL (ab45039, Abcam), anti-osteoprotegerin (OPG) (ab11994, Abcam), anti-phospho-p44/42 MAPK (ERK1/2) (Thr202/Tyr204) (4370, Cell Signaling Technology), anti-p44/42 MAPK (ERK1/2) (4695, Cell Signaling Technology), and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (3683S, Cell Signaling Technology). Then the membranes were incubated with a horseradish peroxidase-conjugated mouse or rabbit lgG (1:5000; Zhongshanjinqiao, China), and protein bands were detected by enhanced with a SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific, USA). The relative density of three comparable results was measured using ImageJ software. Each experiment was repeated three times.
Statistical Analysis
Statistical Package for the Social Sciences 19.0 software was used to perform statistical analysis. Data were presented as means ± standard deviation (SD). The normal distribution of the raw data were confirmed by a one-sample Kolmogorov-Smirnov test, and assessed for significance by two-tailed independent Student’s t-test or one-way analysis of variance (ANOVA). Tukey’s multiple-comparison test was used for the post-hoc comparison of ANOVA. Differences with P < 0.05 were considered statistically significant.