Trial design and participants’ characteristics
This was designed as a retrospective cohort study. We have retrospectively reviewed the clinical data of all young patients with DOR, who underwent their first in vitro fertilization (IVF) cycle at Yantai Yuhuangding Hospital from June 1st 2015 to March 31st 2019. The study protocol was approved by the Ethical Committee of Yantai Yuhuangding Hospital. The study conformed to the ‘‘Declaration of Helsinki for Medical Research involving Human Subjects’’. Patients’ characteristics and cycle parameters were obtained from patient medical records.
It included young patients age <40 years with DOR eligible for IVF. Currently, there is no uniform definition for DOR. In this study, the definition of DOR is as following : (i) woman with any of the risk factors for POR and/or (ii) an abnormal ovarian reserve test (i.e., AFC < 7 follicles or anti mullerian hormone (AMH) <1.2 ng/ml) [12, 22]. Exclusion criteria included patients with severe uterine malformation, severe uterine adhesions, chromosomal abnormality, hydrosalpinx (if not surgically removed or ligated), antiphospholipid syndrome, thyroid or adrenal dysfunction, and severe impairment of renal or hepatic function.
Procedure of IVF
As shown in Fig.1, all patients undergoing IVF cycles received long-acting GnRH agonist long protocol in follicular phase, mild ovarian stimulation or GnRH antagonist protocol. In long-acting GnRH agonist long protocol in follicular phase, a long-acting GnRHa triptorelin acetate (3.75mg, 1.88mg or 1.25mg) was used as a single dose to make pituitary desensitization on day 2-3 of menstrual cycle if the vaginal B-scan ultrasonography shows no cysts and follicles>10mm. 28 days after the injection, ultrasound scan, serum estradiol (E2), luteinizing hormone (LH), follicle-stimulating hormone (FSH) and progesterone (P) were examined to evaluate pituitary down-regulation. If it reaches the down-regulation criteria (follicle diameter<5mm, E2<50 pg/mL, LH<5 IU/L, endometrium<5 mm), gonadotrophins will be started according to the patients’ age, AMH, body mass index (BMI), AFC and medical history.
In GnRH antagonist protocol, gonadotropins were used on the third day of the menstrual cycle. GnRH antagonist ganirelix was used when the dominant follicle reached 12 mm in diameter, E2 concentrations were>150 pg/ml and/or LH concentrations were>10 IU/L.
In mild ovarian stimulation protocol, clomiphene and human menopausal gonadotropin (HMG) were administered from the third day of the menstrual cycle to the day of human chorionic gonadotropin (hCG) trigger injection.
During gonadotrophin stimulation, E2, P, LH, follicle size measurements, and endometrial thickness were monitored until the day of hCG trigger injection. When one leading follicle reached a mean diameter of 18 mm or two leading follicles reached 17mm, hCG was given to trigger ovulation. After 34-36 h, oocytes were retrieved transvaginally. Conventional insemination was performed as indicated. Ultrasound-guided fresh embryo transfer was performed on the third day after oocyte retrieval. The number of embryos transferred was one or two depending on the number of available embryos. The excess viable embryos were cryopreserved or cultured to blastocyst stage and then cryopreserved for subsequent frozen embryo transfer (FET) cycles. Fresh embryo transfer was cancelled if the embryo and endometrium were not synchronous or women had some factors seriously affecting embryo implantation. Cleavage stage embryos were graded using a standardized system [23]. The high-quality embryos included embryos of grade 1 or 2. The luteal phase was supported from the day of oocyte retrieval. 200mg progesterone (Utrogest™ 200, Besins-Iscovesco, France) were vaginal administered three times daily until the early pregnancy test. A quantitative early pregnancy test was performed on the 14th day after embryo transfer. Clinical pregnancy was confirmed if the fetal heartbeat was observed by transvaginal ultrasound after 34 days from embryo transfer. Ongoing pregnancy was defined as a live fetus on ultrasound beyond three months of gestation.
Study design
All patients were assigned to three groups depending on the ovarian stimulation protocols. The demographic and reproductive characteristics were calculated by descriptive statistics. We evaluated the clinical outcomes of IVF cycle while adjusting for potential confounding factors between the three groups. Endometrial tissues were obtained on Day 5 after oocyte recovery from the three group infertile women with tubal factor. Then we evaluated the morphology and coverage of pinopode and expression of HOXA10 between three groups.
Endometrial tissue
Endometrial tissues were collected from 24 women under their written informed consent following the protocol approved by the Institutional Review Board of Yantai Yuhuangding Hospital. The samples were obtained on Day 5 after oocyte recovery from women who rejected fresh embryo transfer because of personal reasons. Eight cases were selected in each group. The tissue sample of each woman was divided into two parts. One part was kept frozen at -80℃ for subsequent qRT-PCR. The other was fixed with 2.5% glutaraldehyde for scanning electron microscope analysis.
Scanning electron microscopy
The morphology and coverage of pinopode in endometrium was evaluated by scanning election microscopy. The endometrial samples were fixed in 2.5% glutaraldehyde for 4 hours. Followed by rinsing three times in 0.1 mol/l phosphate-buffered saline (PBS) for 10 minutes, the samples were dehydrated in graded alcohols and then dried in a critical point drier. Subsequently, samples were coated with palladium gold and examined by a scanning electron microscope. Pinopode development and coverage scoring was assessed as previously described.
qRT-PCR of mRNA expression
Total RNA was extracted from endometrial tissues with Trizol reagent (Invitrogen, Carlsbad, CA) and reversely transcribed using QuantiTect Reverse Transcription Kit (Qiagen GmbH, Hilden, Germany) following the manufacturer's instructions. QuantiNova SYBR Green PCR Kit was used to detect the HOXA10 mRNA expression. The primers were listed as follows: HOXA10 forward, 5'GCCCTTCCGAGAGCAGCAAAG 3' and reverse, 5' AGGTGGACGCTGCGGCTAATCTCTA3'; β-actin forward, 5’-CTGGACTTCGAGCAAGAGATG-3’ and reverse, 5’-GAGTTGAAGGTAGTTTCGTGGA-3’. The reaction was performed as bellow: 95℃for 2 minutes, followed by 40 cycles of 95℃ for 5 seconds and 60℃ for 10 seconds.
Main outcome measures
The primary outcome was clinical pregnancy rate. Secondary outcomes were implantation rate, ongoing pregnancy rate, high quality embryo rate, blastocyst formation rate, endometrial thickness on HCG day, abnormal endometrium rate, embryo transfer cancellation rate, serum LH level on gonadotrophins initiation and HCG day, serum E2 level on gonadotrophins initiation and HCG day, duration of stimulation and total dose of gonadotrophins.
Statistical methods
Descriptive statistics were carried out to describe the baseline characteristics of the patients. Continuous variables with normal distribution were expressed as mean ± standard deviation (SD), non-normal continuous variables as median (interquartile range, IQR). Categorical variables were presented in terms of frequency and percentages. The Mann-Whitney U test or Kruskal-Wallis test was performed to compare continuous variables, followed by a Dunn-Bonferroni test for post hoc comparisons. The chi-square test was employed to compare the difference of categorical variables, and the Bonferroni‐corrected P‐value was used for multiple comparisons. Univariate and multivariate Logistic regression models were performed to generate crude and adjusted Odd ratio (OR) for exploring the effects of different treatment on clinical outcomes. The selection of variables was performed using a backward stepwise process with the Akaike information criterion.
All statistical tests were performed using R software (version 3.5.2, http://www.r-project.org/). All tests were two-sided, and P<0.05 was considered statistically significant.