Ethical approval
The current study was approved from the ethical committee of the University of Balochistan and all procedures were performed as per local and national ethical guidelines.
Samples collection
A total of 500 samples were collected from different regions of Balochistan from commercial layer chicken suspected of infectious coryza. Swab samples were collected from different sites including infra-orbital sinuses, nasal cavities, trachea, lungs and air sacs etc. of infected or recently dead birds with history of respiratory distress. Samples were transported in 30% G-PBS (glycerol phosphate buffer saline) to CASVAB.
Culturing and isolation
All samples were inoculated into brain heart infusion chocolate agar (BHICA), brain heart infusion blood agar (BHIBA) and brain heart infusion agar with 0.01% (w/v) NAD (nicotinamide adenine diphosphate) and incubated at 37 oC supplemented with 5% CO2. All media were purchased from Oxoid (UK).
Identification of A. paragallinarum
The isolated organisms were predicted on the basis of colony appearance and gram staining as described earlier by Cheesbrough, [10]. Phenotypically and biochemically confirmed presumable colonies [11,12] were further subjected to PCR based identification as described earlier by Chen et al., [13]. For this purpose, genomic DNA was extracted using genomic DNA purification kit (Promega, USA) and HPG2-gene specific primers [F1 (TGAGGGTAGTCTTGCACGCGAA T) R1 (CAAGGTATCGATCGTCTCTCT ACT)] in a PCR reaction resulting a 500 bp amplicon. The PCR reaction was performed in a total of 25 µl reaction mixture with a total of 25 cycles of 94oC for 1min, 65oC for 1min and 72oC 30 Sec followed by a final extension for 10 min as reported earlier by Chen et al., [13].
Effect of temperature and pH on the growth of Avibacterium paragallinarum
Clinical isolates of A. paragallinarum were grown at different temperatures and pH to determine optimal temperature and pH [14].
PCR base serotyping of Avibacterium paragallinarum
HTM gene specific set of primers were used to serotypes A, B and C types respectively [13]. The planning of primers was F 5’GGCTCACAGCTTTATGCAACGAA-3 common for all serotypes, R: 5’-CGCGGGATTGTTGATTTTGTT-3’, R: 5’-GGTGAATTTCACCACACCAC-3 and R: 5’TAATTTTCTTATTCCCAGCATCAATACCAT-3’ were specific for serotypes A, B and C respectively. For serotyping PCR conditions were same for all serotypes as practiced in molecular detection/confirmation of Avibacteriumparagallinarum except annealing temperature which was reduced to 55 °C for 1 min [13]. All PCR products were subjected to 1.5% agarose gel electrophoresis and visualized through a BioRad gel doc system.
Antibiotic sensitivity test
Antibiotic sensitivity test (AST) was performed using Mueller Hinton agar (supplemented with NAD) following Kirby Bauer disc diffusion method. For AST, inoculum was prepared from fresh overnight culture after adjusting to 0.5 McFarland Turbidity Standard as per clinical and laboratory standard institute (CLSI). Results were interpreted as per CLSI M31-A3 (2014) recommendation. Escherichia coli ATCC 25922 was used as quality control strain. Interpretation of the result to classify isolates into resistant and susceptible was based either on findings reported by Chukiatsiri and his colleagues or as per manufacturer (Oxoid, UK) instructions [15]. In brief, for isolates with zone of inhibition ≤7mm were declared resistant, while, ≥17mm were declared sensitive.
Pathogenicity of isolated bacteria in healthy bird
To test the pathogenicity of clinical isolates, three (3) groups, A, B and C, each of twenty (20) birds were used in experimental trail. Group A was used as control, group B was vaccinated against coryza, while group C was inoculated with isolates of A. paragallinarum. A 0.5ml of the isolated A. paragallinarum growth suspension comprising 1×109 CFU/ml was inoculated into infra-orbital sinus of birds of all groups. Birds of all groups were monitored. Birds that got sick with severe respiratory distress signs were then slaughtered for post mortem examination [16].