Acupuncture ameliorates experimental autoimmune encephalomyelitis via inhibiting the antigen presentation function of astrocytes

doi:10.21203/rs.3.rs-3713044/v1

Download PDF

Research Article

Acupuncture ameliorates experimental autoimmune encephalomyelitis via inhibiting the antigen presentation function of astrocytes

https://doi.org/10.21203/rs.3.rs-3713044/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Multiple sclerosis (MS) is a chronic inflammatory disease occurring in the central nervous system (CNS). Literature suggests that acupuncture may play a role in the treatment of MS, although its mechanism remains unclear. In this study, we observed that acupuncture significantly alleviates central lesions and delays the progression of experimental autoimmune encephalomyelitis (EAE, an animal model of MS). Conducting a proteomics analysis of murine brain, we found that acupuncture notably suppresses the expression of certain proteins associated with astrocyte functions, including their activation, antigen processing and presentation, as well as myelination. Additionally, we observed a significant increase in POMC expression in the acupuncture group. POMC is the precursor of β-endorphin, which can influences the activation and antigen presentation function of astrocytes. Therefore, our study indicates that acupuncture, by modulating the expression of POMC, influences the activation and antigen presentation function of astrocytes, thereby alleviating inflammation in the CNS. These findings contribute to a deeper understanding of the immunomodulatory mechanisms through which acupuncture acts on MS.

acupuncture

experimental autoimmune encephalomyelitis

astrocytes

antigen presentation

proteomics

Multiple sclerosis (MS) is an immune-mediated disease characterized by inflammatory demyelination of the central nervous system (CNS), which mainly involves white matter[1]. It is characterized by extensive demyelination accompanied by oligodendrocyte damage, and some of them can cause axonal degeneration and neurocyte necrosis[2]. The etiology is not clear, which may be related to many factors such as heredity, environment, and virus infection[3, 4]. At present, the treatment strategies for MS mainly include acute treatment and remission treatment, and the commonly used drugs include glucocorticoid, immunoglobulin, interferon-β, glatiramer acetate, fingolimod and natalizumab, etc[5]. However, the above treatment methods not only cannot cure MS, but are also often accompanied by a series of side effects, so it is still very important to find more effective treatment methods.

As an important part of traditional Chinese medicine, acupuncture has been used in various diseases[6–9]. Some studies have proven that acupuncture can play an important role in regulating immune response. For instance, a recent review has summarized its anti-inflammatory effects, including regulation of inflammation-related signaling pathways (MAPK/TLR4/NF-Kb/NLRP3/CX3CL1) and genes’ expression[10]. Furthermore, Lee et al. and Liu et al. found that acupuncture can alleviate experimental autoimmune encephalomyelitis (EAE) via balancing the proportion of Th1/Th2/Th17/Treg[11, 12]. In addition, the use of acupuncture in clinical treatment of MS has also been internationally recognized by patients and clinicians. Compared with other means, acupuncture not only has a positive effect on treating MS, but also has the merits of being safe, economical, simple, and easy[13, 14].

However, the research on the acupuncture intervention in MS/ EAE is generally less. The existing research has many defects, and its intervention mechanism is still not very clear. Therefore, in this study, we made a proteomic analysis of murine brain by high-throughput sequencing to explore the effect of acupuncture on CNS, in order to reveal the specific mechanism of acupuncture in relieving EAE. Through the above proteomic analysis of brain, we found that acupuncture can down-regulate the expression of some proteins, H2-Ab1/Gbp2/Irgm1/Ctss, which were highly expressed in EAE. These proteins play an important regulatory role in astrocytes activation, antigen processing and presentation, and myelination. We know that the CD4⁺T cell is the main inflammatory cell in EAE, and those who infiltrated the CNS from peripheral immune organs should be re-activated by antigen presentation cells in CNS[15, 16]. During this process, astrocyte is an important antigen presentation cell.

Here, we confirmed that acupuncture alleviate EAE mainly by inhibiting the antigen presenting function of astrocyte in the CNS and then inhibiting the reactivation of CD4⁺T cells. In addition, we also found the significantly increasing of POMC expression in acupuncture group. POMC is the precursor of β-endorphin, which was proven to inhibit the activation and function of astrocytes. Subsequently, we confirmed that acupuncture mainly inhibit the antigen presentation function of actrocytes through increasing the expression of POMC via in vivo and in vitro experiments. Previously, people mainly focused on the effects of acupuncture on peripheral immune response, and few researchers studied the central immune response. Hence, the results of this study will provide a new idea for the mechanism of acupuncture intervention in EAE.

2.1. Animals

C57BL/6 mice (female, 6-8weeks, 16-18g) were purchased from Beijing Huafukang Biotechnology Co., Ltd. The feeding conditions were room temperature (23–25℃) and SPF grade. Mice were given free food and water, and the light and dark period was 12 hours. The experiment was conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals (HMUIRB20120005) issued by China Institute of Health, and the protocol was approved by the Institutional Review Committee of Harbin Medical University.

2.2. Induction of EAE

rMOG (2mg/ml) was emulsified with an equal volume of complete Freund's adjuvant (CFA, 4mg/mL, Sigma, F5506). EAE animal model was induced by subcutaneous injection of the above emulsion into the back. 300ng pertussis toxin (List Biological Laboratories, 180228A1) was injected into the tail vein on the day of immunization and the second day after immunization. Female mice under the same conditions were used as control, and CFA was injected subcutaneously. The mice in each group were weighed every day and the clinical symptoms of EAE were monitored. The clinical scoring criteria of EAE are as follows: 0, no clinical symptoms; 1, tail paralysis; 2, paralysis of one hind limb or weakness of both hind limbs; 3, bilateral hind limb paralysis; 4, complete hind limb paralysis and partial forelimb paralysis; 5, moribund or dead.

2.3. Acupuncture

Mice in EAC group received acupuncture treatment from the first day after immunization, and Zusanli acupoint (ST36) was selected. The position is in the muscle space 3mm below the knee joint, and the depth is 3–4 mm. 30 minutes each time, once a day until the end of the experiment. Mice in EAE group were received subcutaneous needling.

2.4. Drug blocking experiment

Mice were randomly divided into 3 groups: EAE, EAC, EAC + Naloxone. All mice were treated with rMOG to induced EAE model as above. Mice in EAE group were received subcutaneous needling. The mice in EAC and EAC + Naloxone group were received acupuncture treatment from the first day after immunization. Besides, the mice in EAC + Naloxone group were treated with Naloxone (i.p., 4mg/kg, Absin, abs812795) every other day.

2.5. Histopathology

Mice were euthanized at the peak of EAE and the spinal cord was obtained. Frozen sections were prepared from the thick lumbar segment of spinal cord with a thickness of 10um. Then we used HE staining to observe inflammatory infiltration and myelin immunofluorescence staining to observe demyelination. Image J software was used to make quantitative analysis.

2.6. Proteomics

We used iTRAQ technique to identify and relatively quantitatively analyze proteins in brain during the peak period of EAE (Hoogen biotech). Then GO annotation and KEGG pathway annotation were performed on the target protein sets using R software (R version 4.2.3, http://www.r-project.org), and the corresponding enrichment analysis was carried out. Finally, we utilized the information of STRING database (http://string-db.org/) to analyze the interaction of target proteins.

2.7. qPCR

Total RNA was extracted from tissues using TRIzol kit (Takara, 9109), and the concentration was determined using NanoDrop (Thermo Fisher Scientific Inc.). The 260/280 ratio of all samples were controlled between 1.8 and 2.0. Then reverse transcription kit (Transcriptor First Strand cDNA Synthesis Kit, Roche, 0489686601) was used to reverse transcribe RNA into cDNA. qPCR was carried out according to the instructions, and relative quantitative analysis was carried out by ΔΔCt method. The primers used in this experiment are shown in Table 1.

Table 1

Sequences of primers used in qPCR.
Genes	Primer sequences
Gbp2	F: CTGCACTATGTGACGGAGCTA
Gbp2	R: CGGAATCGTCTACCCCACTC
Irgm1	F: CATCAATGCACTTCGAGTCATCG
Irgm1	R: AATCCAGGTAAGTCCCACAGC
Ctss	F: CCATTGGGATCTCTGGAAGAAAA
Ctss	R: TCATGCCCACTTGGTAGGTAT
Ctsc	F: AAGTTGGATACTGCCTACGACG
Ctsc	R: CAATCTCGAAGCCTTGGTTGTAA
H2-Ab1	F: AAGGCATTTCGTGTACCAGTTC
H2-Ab1	R: CCTCCCGGTTGTAGATGTATCTG
Actin	F: TGGAATCCTGTGGCATCCATGAAAC
Actin	R: TAAAACGCAGCTCAGTAACAGTCC

2.8. Western blotting

The total protein was extracted from fresh tissues by RIPA (Beyotime, P0013) containing protease and phosphatase inhibitor (Thermo Fisher, 78442). After the concentration of protein was determined by the BCA kit (Beyotime, P0012), 50ug protein samples were loaded on SDS-PAGE for separating and transferred to the PVDF membrane. Then the membranes were blocked with 5% skim milk for 1–2 hours and incubated with the following primary antibodies overnight at 4℃: Gbp2 (proteintech, 11854-1-AP), Irgm1 (Cell Signaling Technology, 14979S), MHC-II (eBioscience, 14-5321-82), Ctss (Santa Cruz Biotechnology, sc-271619), Ctsc (Santa Cruz Biotechnology, sc-74590), GAPDH (Cell Signaling Technology, 5174S). Subsequently, suitable secondary antibodies were used to incubate the membranes for 1 hour at room temperature. Finally, the protein bands were visualized using ECL chromogenic solution followed by quantitative analysis via image J software.

2.9. Astrocytes culture

2.9.1 Isolation and purification of primary astrocytes

The cortex of newborn mice (C57BL/6, 1-3d) were collected into F12 medium aseptically, and the meninges were stripped. After blowing with a pipette, put F12 medium containing cortex on ice for 2min, then extract the supernatant and filter it into a sterile centrifuge tube. Repeat the above steps until there was no visible brain tissue in the centrifuge tube. Then the cell suspension was centrifuged and resuspended with astrocyte medium containing 10% FBS, 100U/ml penicillin, 100ug/ml streptomycin, and 1mM sodium pyruvate. The medium was changed every three days, and subsequent experiments might be carried out after 9–10 days of cultivation.

2.9.2 Astrocytes stimulation

After 9–10 days of culture, the cells were digested into 6-well or 24-well plates by trypsin. After 2 days of culture, the cells were divided into three groups and cultured with different stimulants for 48h. The following stimulants were used in this experiment: DMSO (mpbiochina, mp196055), β-endorphin (10^− 6M, MCE, HY-P1502), and Naloxone (10^− 5M, Absin, abs812795). Then the cells were collected for FACS or immunofluorescence.

2.10. Immunofluorescence

2.10.1 Tissue immunofluorescence

The frozen sections were fixed in cold acetone at 4℃ for 10min, and blocked with 5% horse serum at 37℃ for 30min. Then the sections were incubated with the following primary antibodies overnight at 4℃: GFAP (abcam, ab7260), MHC-II (abcam, ab139365), POMC (sigma, SAB2500826), MOR (sigma, AB5511). Recommended secondary antibodies were used to incubate the sections for 1 hour at room temperature, and DAPI (abcam, ab228549) was used to visualize the nucleus. Subsequently, the fluoromount-G (Solarbio, S2100) was used to sealed the sections. Finally, the sections were visualized using fluorescence microscope followed by quantitative analysis by Image J software.

2.10.2 Cellular immunofluorescence

The cells in 24-well plate were fixed with 3%PFA at RT for 15min, and washed with 1M glycine for 15min. 5% horse serum was used to block the nonspecific protein at 37℃ for 30min. Then the cells were incubated with the following primary antibodies overnight at 4℃: GFAP (abcam, ab7260), MHC-II (abcam, ab139365). Recommended secondary antibodies were used to incubate the cells for 1 hour at room temperature, and DAPI (abcam, ab228549) was used to visualize the nucleus. Subsequently, the fluoromount-G (Solarbio, S2100) was used to sealed the cell slides. Finally, the slides were visualized using fluorescence microscope followed by quantitative analysis by Image J software.

2.11. FACS

The collected brain and spinal cord were ground to homogenate, and then density gradient centrifugation was performed using 30% Percoll (Cytiva, 17089109-1) to obtain mononuclear cells. The cells were first incubated with Fixable Viability Dye eFluor™ 780 (eBioscience, 65-0865-18) for 30 minutes at 4℃. Then the following surface antibodies were used to stain the cells for 30 minutes at 4℃: CD86-APC (Biolegend, 105012), CD86-PE/CY7 (Biolegend, 105014), CD45-percp (BD, 557235), CD4-FITC (BD, 100510), GFAP-PE (BD, 561483), GFAP-FITC (eBioscience, 53-9892-82), CD80-FITC (eBioscience, 11-0801-81), CD80-percp (Biolegend, 104721), MHC-Ⅱ-PE/CY7 (eBioscience, 25-5321-82), CD11b-APC (eBioscience, 17-0112-82), MHC-Ⅱ-PE (eBioscience, 12-5320-82). For intracellular staining, the cell stimulation cocktail (eBioscience, 00-4975-93) was used to stimulate the cells for 4–6 hours (37℃, 5% CO₂), and the cells were then permeablized with BD Fixation/Permeablization Kit (BD, 554714) for 20 minutes at 4℃. The intracellular antibodies were as follows: IFN-γ-PE/CY7 (Biolegend, 505826), IL-17-APC (Biolegend, 506916). Finally, BD FACSVerse was used for detection, and the data was analyzed by FlowJo V10 software.

2.12. Statistics

In order to identify the difference of clinical score and body weight between different groups, we used two-way ANOVA. For the comparison of multiple groups, we used one-way ANOVA with Tukey multiple comparisons. While for the comparison of only two groups, we use unpaired Student’ s t test. GraphPad Prism 9 was used for statistical analysis, and P < 0.05 was defined as statistically significant.

3.1. Acupuncture can delay the progress of EAE

Firstly, in order to determine the therapeutic effect of acupuncture at ST36, we set up three groups (CFA/EAE/EAC) for observation. Mice in EAE/EAC group were used rMOG to induce EAE disease, while CFA group was the control group. Mice in EAC group began to receive acupuncture treatment on the first day after immunization and continued until the end of the experiment (Fig. 1a). Through the record of clinical score, we can see that the mice in EAE group began to have symptoms on the 6th day after immunization, reached the peak on the 13th day, and then gradually recovered, which was also in line with the disease characteristics of EAE (Fig. 1b). At the same time, the weight changes of the three groups also showed a trend consistent with the clinical score (Figure S1). The onset time of mice in EAC group was on the 13th day after immunization, which was significantly later than that in EAE group (Fig. 1c).

At the same time, we also compared the disease severity of mice in EAE/EAC group, and the EAC group was also significantly milder than the EAE group (Fig. 1d). In addition, we evaluated the degree of spinal cord lesions in each group by HE and immunofluorescence staining. As shown in Figs. 1e and 1f, the number of inflammatory cells in spinal cord in EAE group was the largest. EAC group was similar to CFA group, and there was no obvious infiltration. Consistent with the pathological trend, the spinal cord demyelination was the most obvious in EAE group, only slight demyelination in EAC group and no demyelination in CFA group (Fig. 1g-h).

3.2. Acupuncture leads to changes in protein expression in CNS

To detect the specific effect of acupuncture on brain, we made a proteomic analysis of brain by high-throughput sequencing. The sequencing results showed that acupuncture could change the protein expression in brain. We identified the differentially expressed proteins by fold change (FC) > 1.2, FC < 0.83, p < 0.05. As shown in Table 2, the expression levels of 452 proteins in EAE group were significantly different from those in CFA group. Among these proteins, the expression level of 282 proteins was increased and that of 170 proteins was decreased. Compared with EAE, acupuncture down-regulated the expression of 117 proteins and up-regulated the expression of 70 proteins. Further analysis showed that acupuncture inhibited the expression of 63 proteins which were significantly up-regulated in EAE group (Fig. 2a, 2b). Meanwhile, acupuncture promoted the expression of 18 proteins which were significantly down-regulated in the EAE group (Figure S2). Subsequently, in order to verify the sequencing results, we randomly selected five proteins (Gbp2/Irmg1/Ctss/Ctsc/MHC-II) which are significantly related to EAE diseases, and the results of qPCR and western blot were consistent with the sequencing results (Fig. 2c-i). The above results suggest that acupuncture may play a role in the treatment of EAE by affecting the expression of related proteins in CNS.

Table 2

Quantitative statistical results of differentially expressed proteins in each group (FC > 1.2 and FC<0.83, p value < 0.5).
Comparisons	Up	Down	All
EAE vs CFA	282	170	452
EAC vs EAE	70	117	187

3.3. Functional analysis of differentially expressed proteins in brain

Compared with CFA, acupuncture inhibited 63 proteins up-regulated in the EAE group and promoted the expression of 18 proteins down-regulated in the EAE group. These differentially expressed proteins were closely related to the mechanism of acupuncture delaying EAE. Therefore, in order to explore the signaling pathway through which the differentially expressed proteins in acupuncture group works, we performed GO function enrichment analysis and KEGG pathway enrichment analysis on these proteins. The results shown that among the three parts of biological process (BP) /cell component (CC) /molecular function (MF), differentially expressed proteins were significantly related to antigen processing and presentation functions. Separately, the BP related to antigen processing and presentation/astrocyte development; CC included MHC class I peptide loading complex/MHC protein complex; MF included TAP binding/peptide antigen binding (Fig. 3a). Next, we listed the top 20 most significantly enriched KEGG pathways, among which the processing and presentation of antigens related to diseases were also the most significant (Fig. 3b). In order to further explore the main target protein of acupuncture, we demonstrated the relationship between differentially expressed proteins through protein interaction network. Protein interactive network nodes represent differential expression proteins and other proteins which can directly interact with differential expression proteins and are included in the interactive network database. It is known from the figure that the differentially expressed proteins related to astrocyte activation (Gbp2), microglia activation (Irgm1), antigen processing and presentation (Tap1, β2m, H2-Ab1) and myelination (Ctss) have the greatest connectivity, which is the key to maintaining the balance and stability of the interaction network, and they are the candidate proteins (Fig. 3c). Subsequently, we screened out the top nine proteins with the most significant differences through stricter standards (FC > 2, p < 0.05), as well as the additional proteins significantly related to astrocyte activation, and retrieved their functions. The results were shown in Table 3. Firstly, we found that these proteins are significantly up-regulated in EAE and can be significantly inhibited by acupuncture. Secondly, their functions are closely related to astrocyte activation, microglia activation, antigen processing and presentation, myelination and so on, which is also consistent with our previous functional enrichment results. We know that CD4⁺T cells entering CNS from the periphery will be reactivated by antigen presenting cells during the onset of EAE, and more immune cells will be recruited into CNS to cause inflammatory lesions[17]. In this process, astrocytes and microglia cells play an important role as the main antigen presenting cells in CNS. Therefore, it is concluded that the mechanism of acupuncture in treating EAE is probably that it inhibits the antigen presentation process in CNS and then inhibits the secondary activation of immune cells in CNS, and plays a certain role in inhibiting the demyelination process also.

Table 3. Significantly differentially expressed proteins and related functional descriptions.

Proteins	EAE/CFA	EAC/EAE	Main functions
Gbp2	4.262	0.279	The marker of A1 astrocytes, pro-inflammatory.
Igtp	3.254	0.295	Enables GTPase activity. Acts upstream of or within cellular response to interferon-beta.
H2-Ab1	3.384	0.320	Antigen processing and presentation.
Lyz2	2.633	0.331	Enables lysozyme activity. Involved in defense response to Gram-negative bacterium and defense response to Gram-positive bacterium.
Iigp1	2.888	0.414	Enables GTPase activity. Involved in defense response to Gram-negative bacterium; defense response to protozoan; and regulation of autophagy.
Tap1	2.848	0.435	Antigen processing and presentation.
Irgm1	2.334	0.444	The marker of M1 microglia, pro-inflammatory.
β2m	3.260	0.450	Antigen processing and presentation.
Ctss	3.347	0.479	An enzyme that has previously been shown to mediate MBP degradation, pro-inflammatory.
Serping 1	1.332	0.881	The marker of A1 astrocytes, pro-inflammatory.
Gfap	1.305	0.733	A marker of activated astrocytes.
Map2	1.372	0.969	A neuronal phosphoprotein that regulates neuronal morphogenesis and organelle transport in axons and dendritic cells.

The first 9 proteins were identified by FC > 2, p value < 0.5, and the last 3 were significantly related to the activation of astrocytes.

3.4. Acupuncture inhibits antigen presentation in CNS by inhibiting the activation of astrocytes

Astrocytes and microglia participate in immune response in various forms in the pathological process of MS. Glial fibrillary acidic protein (GFAP) is a marker of astrocytes, and studies have shown that its immune response is enhanced at the peak of EAE [18]. In the early stage of EAE, microglia promote the infiltration of inflammatory cells by secreting a variety of proinflammatory factors and chemokines, leading to demyelination and tissue damage [19, 20]. In addition, astrocytes and microglia cells express MHC class II molecules after activation, which can help T cells infiltrating CNS to complete antigen presentation and activation [21, 22]. Through the above proteomic analysis, we found that astrocytes and microglia played an important role in acupuncture treatment of EAE, and astrocytes may occupy a larger proportion. In order to further verify this conclusion, we firstly detected the propotions of astrocytes and microglia cells in CNS through flow cytometry. Compared with CFA group, the proportion of activated astrocytes in the EAE group was significantly increased, and acupuncture could significantly reduce its proportion (Fig. 4a-b). While there was no significant difference in the propotion of resident microglia, which also play a role in antigen presentation (Figure S3). Synthesize the above results, we determined that astrocytes play a more important role in the treatment of acupuncture. Sunsequently, in order to further confirm whether acupuncture has inhibited the antigen presentation functions of astrocytes, we detected the expression levels of molecules related to antigen presentation in astrocytes by flow cytometry. Results as shown in Fig. 4c-h, acupuncture significantly inhibited the expression levels of antigen presenting molecules CD80/MHC-II/CD86 on the surface of astrocytes. Besides, we also stained MHC-II on the surface of astrocytes in brain by immunofluorescence (Fig. 4i). The results were consistent with the flow cytometry, and we can clearly see that the proportion of astrocytes expressing MHC-II in the acupuncture group was significantly less than that in the EAE group. Finally, in order to prove our conjecture, acupuncture inhibits the secondary activation of CD4⁺T cells in CNS by inhibiting the antigen presentation process. We detected the ratio of Th1/Th17 cells in the CNS by flow cytometry. The results showed that the ratio of CD4⁺T cells in the acupuncture group was significantly lower than that in the EAE group, and the ratio of Th1/Th17 in the acupuncture group also showed a downward trend (Fig. 4j-k). That is, acupuncture did inhibit the secondary activation of CD4⁺T cells in CNS.

3.5. Acupuncture inhibits the functionin of astrocytes by upregulating the expression of POMC in the CNS

Through the above results, we get to know that acupuncture inhibits the antigen presentation of astrocytes in the CNS during the treatment of EAE. As to the way in which acupuncture inhibits the function of astrocytes is still unclear. To cope with this doubt, we further analyzed the protemic results. We found that acupuncture significantly up-regulate the relative expression level of POMC, which was decerased in EAE group (Fig. 5a). Then we did immunofluorescence staining of POMC in arcuate nucleus to verify the result of protemic analysis. The results shown that acupuncture did up-regulate the expression level of POMC in arcuate nucleus (Fig. 5b-c). According to previous literature, POMC is the precursor of β-endorphin and acupuncture can increase the release of β-endorphin. Furthermore, β-endorphin can significantly inhibits the activation of lymphocytes and astrocytes in vitro [23]. Therefore, we suspected that acupuncture inhibits the function of astrocytes mainly by promoting the releasing of β-endorphin. We know that β-endorphin mainly acts via binding with the u opioid receptor (MOR) [24]. Hence, we detected the expression level of MOR in astrocytes, and we found that acupuncture can significantly up-regulate the expression level of MOR in astrocytes (Fig. 5d-e). Besides, we designed the follow experiment to determine the role of β-endorphin in acupuncture. Mice were randomly divided into 3 groups: EAE, EAC, EAC + Naloxone, and we tried to investigate whether naloxone (opioid receptor antagonist) can counteract the therapeutic effect of acupuncture [25]. The results shown that naloxone does partially offset the disease relieving effect of acupuncture, and the severity of the disease in EAC + Naloxone group was between EAE and EAC (Fig. 5f-h, Figure S4a). In addition, naloxone also counteracts the inhibitory effect of acupuncture on antigen presentation function of astrocytes (Fig. 5i-j). Above all, acupuncture mainly inhibits the function of astrocyte by up-regulating the expression of POMC and the subsequent release of β-endorphin.

3.6. β-endorphin can significantly inhibit the antigen presentation function of astrocytes in vitro

Finally, we further determined the effects of β-endorphin on astrocytes in vitro. We collected primary astrocytes through general methods, and added β-endorphin or Naloxone into the medium. Then the flow cytometry was used to detected the expression levels of CD80/CD86/MHC-II in astrocytes. The result was as follows, β-endorphin can significantly inhibits the propotions of CD80/CD86/MHC-II in astrocytes, while Naloxone effectively counteracted this function (Fig. 6a-f). Moreover, we used immunofluorescence staining to visualize the expression level of MHC-II in astrocytes. The result was consistent with the flow cytometry (Fig. 6g, Figure S4b).

MS is the most common idiopathic inflammatory demyelinating disease, with temporal and spatial multiplicity[26, 27]. At present, there is no cure, which seriously affects the quality of life of patients and their families[28]. Due to a series of side effects caused by drug therapy, patients and doctors began to look for some alternative methods[29]. As an important part of traditional Chinese medicine, acupuncture has been widely used in many diseases, including rheumatoid arthritis, chronic pain, stroke and so on[30–32]. Importantly, its application in MS is gradually accepted and recognized[13]. This study also confirmed that acupuncture at ST36 can definitely delay the onset time of EAE and reduce the severity of the disease. However, there are few related studies on its specific therapeutic mechanism. Previous studies paid more attention to the regulation of acupuncture on peripheral T cell subsets in the process of treating MS[11, 33]. We know that acupuncture transmits signals to CNS by stimulating local sensory nerves, and then the CNS sends out signals again to regulate the peripheral immune response [34]. In this process, it is not clear what has happened in the CNS. Therefore, in this study, we analyzed the effect of acupuncture on protein expression in the CNS during the treatment of EAE by proteomics, and provided new ideas for clarifying the mechanism of acupuncture.

Through sequencing results, we found that acupuncture can cause changes in protein expression level in the brain: compared with the CFA group, some proteins in the EAE group were up-regulated, and acupuncture can down-regulate these proteins. Through a series of screening, we found some proteins which are significantly related to EAE diseases, including GFAP/Gbp2/Irgm1/H2-Ab1/Ctss. Moreover, the above proteins were significantly up-regulated in the EAE group, while acupuncture could significantly down-regulate their expression. GFAP is the skeleton protein of astrocytes, and its expression level changes when astrocytes are stimulated and react, which is considered as a sign of astrocyte activation[35]. The expression of GFAP in the brain is less in a physiological state, and the expression level of GFAP is up-regulated when CNS is injured[36]. Gbp2 is a marker of A1 astrocyte, and A1 astrocyte is significantly increased in MS, and it mainly mediates the death of neurons and oligodendrocytes in neurodegenerative diseases[37, 38]. Irgm1 is expressed in M1 macrophages. In the early stage of EAE disease, M1 macrophages can mediate the pro-inflammatory effect by promoting the differentiation of Th1/Th17 cells, and the pro-inflammatory function of M1 cells needs Irgm1[39]. H2-Ab1 is a characteristic gene of MHC-II, which is mainly involved in the process of antigen processing and presentation[40].

We know that CD4⁺T cells, the main pathogenic cells of EAE, enter CNS through the damaged blood-brain barrier after peripheral activation, are locally reactivated by antigen presenting cells, and recruit more immune cells such as T cells and macrophages into the CNS to cause inflammatory lesions[17, 41, 42]. Therefore, the secondary activation of CD4⁺T cells in CNS is very important for the pathological injury of EAE. At the same time, astrocytes and microglia, as the main antigen presenting cells in CNS, plays an important role in this process [22, 43, 44]. In our proteomic analysis, it was found that acupuncture not only inhibited the expression of pro-inflammatory markers of astrocytes/microglia in the CNS, but also significantly inhibited the expression of H2-Ab1, a key protein for antigen presentation [45]. Of course, this is also consistent with the results of our functional enrichment analysis of differential proteins. That is, the top 20 most significantly enriched KEGG pathways, among which the processing and presentation of antigens are related to diseases, and the differences are also the most significant. In addition, we found another key protein, Ctss, which was significantly down-regulated by acupuncture, an enzyme that was previously proved to mediate MBP degradation [46]. It plays an important role in the pathogenesis of EAE, and the secretion of Ctss by immune cells that penetrate the blood-brain barrier may contribute to the extracellular demyelination process. This is also consistent with our results, that is, the pathological results of the spinal cord show that the degree of demyelination in the acupuncture group was significantly less than that in the EAE group.

Through the above proteomic analysis of CNS, we found that acupuncture inhibited the expression of some proteins closely related to EAE. Most of these changed proteins are related to the function of astrocyte, and less to microglia. Meanwhile, the results of flow cytometry shown that there was no significant difference in the proportion of resident microglia, which also play a role in antigen presentation [47]. Therefore, we focus our follow-up research on astrocytes. Firstly, we used flow cytometry to investigate the effect of acupuncture on astrocytes. The results were consistent with the protemic analysis, that is acupuncture significantly inhibits the activation of astrocytes and its antigen presentation function. In addition, by immunofluorescence staining, we can clearly see that the expression of MHC-II on astrocytes decreased significantly after acupuncture. We know that activated astrocytes promote the secondary activation of CD4⁺T cells in the CNS through antigen presentation. Subsequently, we examined the propotions of infiltrated CD4⁺T/Th1/Th17 cells in the CNS, and the proportions of these cells were all significantly decreased in the acupuncture group. Thus, the mechanism of acupuncture relieving EAE may be that it inhibits the activation of astrocytes in CNS and its antigen presentation function, and then inhibits the secondary activation of CD4⁺T cells in CNS, thus alleviating the inflammation.

Nevertheless, we still have a question, that is, the way of acupuncture inhibiting the function of astrocytes is still unclear. To answer this question, we further analyzed the protemic results. We found that acupuncture significantly up-regulate the relative expression level of POMC, which was decerased in EAE group. We also re-verified this results through immunofluorescence staining. According to literatures, POMC is the precursor of β-endorphin, which is the most dominant endogenous opioid peptide and sereted by the pituitary gland [48]. A variety of studies have shown that β-endorphin has great immunomodulatory effects, and it mainly mediates immunosuppression [49]. For instance, β-endorphin can inhibit the proliferation of T cells, inhibit the production of pro-inflammatory cytokines (IL-1β/IL-2/TNF-α/IFN-γ) and promote the production of anti-inflammatory cytokines (IL-4) [50, 51]. In addition, Hansson, E et al. found that β-endorphin can regulate the function of astrocytes by binding with MOR [52]. Furthermore, previous study have demonstrated that electroacupuncture can inhibit the function of lymphocytes in EAE model by promoting the release of β-endorphin [23]. Therefore, we suspected that acupuncture mainly suppress the function of astrocytes via up-regulating the expression of POMC and subsequent production of β-endorphin. In the following experiments, we demonstrated that acupuncture can significantly up-regulating the expression of MOR in astrocytes. Besides, the using of Naloxone effectively counteracted the relieving effects of acupuncture. Finally, we used in vivo and in vitro experiments clarified that acupuncture suppressed the antigen presentation function of astrocytes via β-endorphin.

In summary, this study demonstrated that acupuncture at ST36 exerted an inhibitory effect on EAE. The underlying mechanism involves the up-regulation of POMC and subsequent production of β-endorphin. Elevated β-endorphin effectively suppresses the antigen presentation function of astrocytes by binding with MOR, thereby attenuating inflammation in the CNS. Our study provides new insights into the potential mechanisms behind the therapeutic effects of acupuncture in EAE/MS. By elucidating the impact of acupuncture on central protein expression and astrocyte function, we have enhanced our understanding of acupuncture's immunomodulatory effects. These findings contribute to further exploration of the neuroimmunological mechanisms of acupuncture and provide potential therapeutic strategies for MS treatment.

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Ethics approval

The experiment was conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals (HMUIRB20120005) issued by China Institute of Health, and the protocol was approved by the Institutional Review Committee of Harbin Medical University.

Funding

This work was supported by [the National Natural Science Foundation of China] (Grant numbers [82271845] and [82371821]), [the HMU Marshal Institutive Funding] (Grant number [HMUMIF-21019]), [the Fund of Key Laboratory of Myocardial Ischemia, Ministry of Education] (Grant numbers [KF202205] and [KF202004]), and [the Natural Science Foundation of Heilongjiang Province of China] (Grant number [LH2022H004]).

Author Contribution

All authors contributed to the study conception and design. Conceptualisation: J. W., Y. L. and B. S.. Methodology and investigation: J. W., Y. L., F. Z., J. Y. and X. H.. Analysis of data: C. Y., P. Z., Y. H. and M. H.. Writing: J. W. and Y. L.. Supervision: Y. L. and X. L.. Funding acquisition: H. L., B. S., X. L., J. W. and Y. L.. All authors read and approved the final manuscript.

Doshi A, Chataway J. 2016. Multiple sclerosis, a treatable disease. Clin Med (Lond) 16(Suppl 6): s53-s9.
Koch-Henriksen N, Magyari M. 2021. Apparent changes in the epidemiology and severity of multiple sclerosis. Nat Rev Neurol 17(11): 676–88.
Marcus R. 2022. What Is Multiple Sclerosis? Jama 328(20): 2078.
Soldan SS, Lieberman PM. 2023. Epstein-Barr virus and multiple sclerosis. Nat Rev Microbiol 21(1): 51–64.
Travers BS, Tsang BK, Barton JL. 2022. Multiple sclerosis: Diagnosis, disease-modifying therapy and prognosis. Aust J Gen Pract 51(4): 199–206.
Yang NN, Yang JW, Ye Y, Huang J, Wang L, Wang Y, et al. 2021. Electroacupuncture ameliorates intestinal inflammation by activating α7nAChR-mediated JAK2/STAT3 signaling pathway in postoperative ileus. Theranostics 11(9): 4078–89.
Lee HY, Kwon OJ, Kim JE, Kim M, Kim AR, Park HJ, et al. 2018. Efficacy and safety of acupuncture for functional constipation: a randomised, sham-controlled pilot trial. BMC Complement Altern Med 18(1): 186.
Chiu HY, Hsieh YJ, Tsai PS. 2017. Systematic review and meta-analysis of acupuncture to reduce cancer-related pain. Eur J Cancer Care (Engl) 26(2).
Lu HL, Chang CM, Hsieh PC, Wang JC, Kung YY. 2022. The effects of acupuncture and related techniques on patients with rheumatoid arthritis: A systematic review and meta-analysis. J Chin Med Assoc 85(3): 388–400.
Oh JE, Kim SN. 2021. Anti-Inflammatory Effects of Acupuncture at ST36 Point: A Literature Review in Animal Studies. Front Immunol 12: 813748.
Lee MJ, Jang M, Choi J, Lee G, Min HJ, Chung WS, et al. 2016. Bee Venom Acupuncture Alleviates Experimental Autoimmune Encephalomyelitis by Upregulating Regulatory T Cells and Suppressing Th1 and Th17 Responses. Mol Neurobiol 53(3): 1419–45.
Liu YM, Liu XJ, Bai SS, Mu LL, Kong QF, Sun B, et al. 2010. The effect of electroacupuncture on T cell responses in rats with experimental autoimmune encephalitis. J Neuroimmunol 220(1–2): 25–33.
Khodaie F, Abbasi N, Kazemi Motlagh AH, Zhao B, Naser Moghadasi A. 2022. Acupuncture for multiple sclerosis: A literature review. Mult Scler Relat Disord 60: 103715.
Kochs L, Wegener S, Sühnel A, Voigt K, Zettl UK. 2014. The use of complementary and alternative medicine in patients with multiple sclerosis: a longitudinal study. Complement Ther Med 22(1): 166–72.
Sosa RA, Forsthuber TG. 2011. The critical role of antigen-presentation-induced cytokine crosstalk in the central nervous system in multiple sclerosis and experimental autoimmune encephalomyelitis. J Interferon Cytokine Res 31(10): 753–68.
Waisman A, Johann L. 2018. Antigen-presenting cell diversity for T cell reactivation in central nervous system autoimmunity. J Mol Med (Berl) 96(12): 1279–92.
Baecher-Allan C, Kaskow BJ, Weiner HL. 2018. Multiple Sclerosis: Mechanisms and Immunotherapy. Neuron 97(4): 742–68.
Beutler B. 2004. Inferences, questions and possibilities in Toll-like receptor signalling. Nature 430(6996): 257–63.
Álvarez-Sánchez N, Cruz-Chamorro I, Álvarez-López AI, López-González A, Lacalle Remigio JR, Lardone PJ, et al. 2020. Seasonal Variations in Macrophages/Microglia Underlie Changes in the Mouse Model of Multiple Sclerosis Severity. Mol Neurobiol 57(10): 4082–9.
Guerrero BL, Sicotte NL. 2020. Microglia in Multiple Sclerosis: Friend or Foe? Front Immunol 11: 374.
Masuda T, Sankowski R, Staszewski O, Böttcher C, Amann L, Sagar, et al. 2019. Spatial and temporal heterogeneity of mouse and human microglia at single-cell resolution. Nature 566(7744): 388–92.
Cornet A, Bettelli E, Oukka M, Cambouris C, Avellana-Adalid V, Kosmatopoulos K, et al. 2000. Role of astrocytes in antigen presentation and naive T-cell activation. J Neuroimmunol 106(1–2): 69–77.
Liu Y, Wang H, Wang X, Mu L, Kong Q, Wang D, et al. 2013. The mechanism of effective electroacupuncture on T cell response in rats with experimental autoimmune encephalomyelitis. PLoS One 8(1): e51573.
Molina-Martínez LM, Juárez J. 2021. Deficit of β-endorphin neurons in the hypothalamus and high expression of MOR in mesolimbic structures are related to high alcohol consumption in outbred rats. Alcohol 95: 1–6.
Shokri-Kojori E, Wang GJ, Volkow ND. 2021. Naloxone precipitated withdrawal increases dopamine release in the dorsal striatum of opioid dependent men. Transl Psychiatry 11(1): 445.
Rodríguez Murúa S, Farez MF, Quintana FJ. 2022. The Immune Response in Multiple Sclerosis. Annu Rev Pathol 17: 121–39.
Wang J, Sun H, Guo R, Guo J, Tian X, Wang J, et al. 2023. Exosomal miR-23b-3p from bone mesenchymal stem cells alleviates experimental autoimmune encephalomyelitis by inhibiting microglial pyroptosis. Exp Neurol 363: 114374.
Yong HYF, Yong VW. 2022. Mechanism-based criteria to improve therapeutic outcomes in progressive multiple sclerosis. Nat Rev Neurol 18(1): 40–55.
Axisa PP, Hafler DA. 2016. Multiple sclerosis: genetics, biomarkers, treatments. Curr Opin Neurol 29(3): 345–53.
Xu Y, Hong S, Zhao X, Wang S, Xu Z, Ding S, et al. 2018. Acupuncture Alleviates Rheumatoid Arthritis by Immune-Network Modulation. Am J Chin Med 46(5): 997–1019.
Vickers AJ, Vertosick EA, Lewith G, MacPherson H, Foster NE, Sherman KJ, et al. 2018. Acupuncture for Chronic Pain: Update of an Individual Patient Data Meta-Analysis. J Pain 19(5): 455–74.
Zhang SH, Wang YL, Zhang CX, Zhang CP, Xiao P, Li QF, et al. 2022. Effect of Interactive Dynamic Scalp Acupuncture on Post-Stroke Cognitive Function, Depression, and Anxiety: A Multicenter, Randomized, Controlled Trial. Chin J Integr Med 28(2): 106–15.
Zhao P, Chen X, Han X, Wang Y, Shi Y, Ji J, et al. 2021. Involvement of microRNA-155 in the mechanism of electroacupuncture treatment effects on experimental autoimmune encephalomyelitis. Int Immunopharmacol 97: 107811.
Wang J, Zhu F, Huang W, Chen Z, Zhao P, Lei Y, et al. 2022. Therapeutic Effect and Mechanism of Acupuncture in Autoimmune Diseases. Am J Chin Med 50(3): 639–52.
Min SK, Kim CR, Jung SM, Shin HS. 2013. Astrocyte behavior and GFAP expression on Spirulina extract-incorporated PCL nanofiber. J Biomed Mater Res A 101(12): 3467–73.
Amalia L. 2021. Glial Fibrillary Acidic Protein (GFAP): Neuroinflammation Biomarker in Acute Ischemic Stroke. J Inflamm Res 14: 7501–6.
Liddelow SA, Guttenplan KA, Clarke LE, Bennett FC, Bohlen CJ, Schirmer L, et al. 2017. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 541(7638): 481–7.
El Baassiri MG, Rahal SS, Fulton WB, Sodhi CP, Hackam DJ, Nasr IW. 2023. Pharmacologic TLR4 Inhibition Skews Toward a Favorable A1/A2 Astrocytic Ratio Improving Neurocognitive Outcomes following Traumatic Brain Injury. J Trauma Acute Care Surg.
Xu Y, He Z, Li Z, Fang S, Zhang Y, Wan C, et al. 2017. Irgm1 is required for the inflammatory function of M1 macrophage in early experimental autoimmune encephalomyelitis. J Leukoc Biol 101(2): 507–17.
Duke-Cohan JS, Akitsu A, Mallis RJ, Messier CM, Lizotte PH, Aster JC, et al. 2023. Pre-T cell receptor self-MHC sampling restricts thymocyte dedifferentiation. Nature 613(7944): 565–74.
Allan ER, Yates RM. 2015. Redundancy between Cysteine Cathepsins in Murine Experimental Autoimmune Encephalomyelitis. PLoS One 10(6): e0128945.
Ansari MA, Nadeem A, Alshammari MA, Attia SM, Bakheet SA, Khan MR, et al. 2022. Cathepsin B inhibitor alleviates Th1, Th17, and Th22 transcription factor signaling dysregulation in experimental autoimmune encephalomyelitis. Exp Neurol 351: 113997.
Stüve O, Youssef S, Slavin AJ, King CL, Patarroyo JC, Hirschberg DL, et al. 2002. The role of the MHC class II transactivator in class II expression and antigen presentation by astrocytes and in susceptibility to central nervous system autoimmune disease. J Immunol 169(12): 6720–32.
Almolda B, Gonzalez B, Castellano B. 2011. Antigen presentation in EAE: role of microglia, macrophages and dendritic cells. Front Biosci (Landmark Ed) 16(3): 1157–71.
Falcão AM, van Bruggen D, Marques S, Meijer M, Jäkel S, Agirre E, et al. 2018. Disease-specific oligodendrocyte lineage cells arise in multiple sclerosis. Nat Med 24(12): 1837–44.
Beck H, Schwarz G, Schröter CJ, Deeg M, Baier D, Stevanovic S, et al. 2001. Cathepsin S and an asparagine-specific endoprotease dominate the proteolytic processing of human myelin basic protein in vitro. Eur J Immunol 31(12): 3726–36.
Das R, Chinnathambi S. 2019. Microglial priming of antigen presentation and adaptive stimulation in Alzheimer's disease. Cell Mol Life Sci 76(19): 3681–94.
Kido K, Shindo Y, Toda S, Masaki E. 2019. Expression of β-endorphin in peripheral tissues after systemic administration of lipopolysaccharide as a model of endotoxic shock in mice. Ann Endocrinol (Paris) 80(2): 117–21.
Pilozzi A, Carro C, Huang X. 2020. Roles of β-Endorphin in Stress, Behavior, Neuroinflammation, and Brain Energy Metabolism. Int J Mol Sci 22(1).
Ninković J, Roy S. 2013. Role of the mu-opioid receptor in opioid modulation of immune function. Amino Acids 45(1): 9–24.
Opal SM, DePalo VA. 2000. Anti-inflammatory cytokines. Chest 117(4): 1162–72.
Hansson E, Westerlund A, Björklund U, Olsson T. 2008. mu-Opioid agonists inhibit the enhanced intracellular Ca(2+) responses in inflammatory activated astrocytes co-cultured with brain endothelial cells. Neuroscience 155(4): 1237–49.

No competing interests reported.

Supplementaryfile.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Acupuncture ameliorates experimental autoimmune encephalomyelitis via inhibiting the antigen presentation function of astrocytes

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1. Animals

2.2. Induction of EAE

2.3. Acupuncture

2.4. Drug blocking experiment

2.5. Histopathology

2.6. Proteomics

2.7. qPCR

2.8. Western blotting

2.9. Astrocytes culture

2.9.1 Isolation and purification of primary astrocytes

2.9.2 Astrocytes stimulation

2.10. Immunofluorescence

2.10.1 Tissue immunofluorescence

2.10.2 Cellular immunofluorescence

2.11. FACS

2.12. Statistics

3. Results

3.1. Acupuncture can delay the progress of EAE

3.2. Acupuncture leads to changes in protein expression in CNS

3.3. Functional analysis of differentially expressed proteins in brain

3.4. Acupuncture inhibits antigen presentation in CNS by inhibiting the activation of astrocytes

3.5. Acupuncture inhibits the functionin of astrocytes by upregulating the expression of POMC in the CNS

3.6. β-endorphin can significantly inhibit the antigen presentation function of astrocytes in vitro

4. Discussion

5. Conclusions

Declarations

Competing Interests

Ethics approval

Funding

Author Contribution

References

Additional Declarations

Supplementary Files

Status:

Version 1