Plant materials
Huhan 1S, a WDR two-line male sterile line, was the recipient (male-sterile gene was derived from Y58S), while Huhan 1B (Pi9) and Huhan 91 (Pikh and pi5) were the donor parents of the resistance gene. Restorer lines (Huazhan, Chenghui 727, Hanhui No.3, Hanhui 808, Hanhui 8228) were used to identify the heterosis and evaluate the resistance of the novel male sterile line hybrids. The blast susceptible control was Lijiang Heituan Xingu, drought resistance control was Hanyou 73, drought-sensitive control was IR36, while the heterosis identification control was Fengliangyou No.4. All materials were provided by Shanghai Agrobiological Gene Center (SAGC).
DNA extraction and molecular marker detection
The genomic DNA of leaves was extracted from fresh young leaves at the peak tillering stage using the Cetyltrimethylammonium Bromide (CTAB) method (Murray and Thompson, 1980). The molecular marker Pi9-Pro closely linked to the target gene Pi9 (Tian et al, 2016) (F: 5’- TGATTATGTTTTTTATGTGGGG-3’; R: 5 '- ATTAGTGAGATCCATTGTTCC-3’), the molecular marker FM143 closely linked to the target gene Pikh (Wang et al, 2014) (F: 5 '- CCCAACATTGGTAGTAGTGC-3'; R: 5'- TCCTTCATACGCAACAATCT- 3'), and the molecular marker M-Pi5 closely linked to the target gene Pi5 (Gao et al, 2010) (F: 5 '- ATAGATCATGCGCCCTCTTG; R: 5’- TCATACCCCATTCGGTCATT -3’) were used for MAS. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The PCR was performed in a 20-µl reaction volume, including 2μl of genomic DNA (10ng/μl), 10 uL of Taq PCR mastermix (Tiangen BioTech (Beijing) Co., Ltd.), 0.5 uL of each primer (10 uM), and 7µl of dd H2O. The PCR procedure involved; pre-denaturation at 95 ℃ for 5 min, then 30 cycles at 95 ℃ for 30 s, 55 ℃ for 30 s, and 72 ℃ for 1 min, and extension at 72 ℃ for 5 min. Acrylamide gel electrophoresis of 6% was performed for PCR products, and silver staining detection was conducted based on previous methods (Creste et al, 2001).
Evaluation of rice blast resistance
In total, 14 main pathogenic strains (ZA1, ZA33, ZA49, ZB1, ZB5, ZB13, ZB15, ZC13, ZD1, ZD3, ZE1, ZE3, ZF1, and ZG1) in China were artificially inoculated and identified for blast resistance spectrum analysis. The strains were cultured in oat medium (oatmeal 30 g/L, tomato juice 150 mL/L, agar powder 20 g/L, pH 6.5) for 3-5 days at 28°C in the dark. Thereafter, they were cultured under constant light at 26 ℃ for 5-6 days to form conidia. The mature conidia were washed with sterile water to prepare an inoculum with a concentration of about 1 × 105 cfu/ml. The seedlings were inoculated with the prepared spore solution by artificial spray during the 3 leaves and 1 heart period. The inoculated strains were placed in a dark room at 25°C and 90% humidity for 24 h, then transferred into the growth chamber, to grow for 6 days at 25-28℃ and 90% humidity under 12/12h (bright/ dark) photoperiod. The disease was investigated after 7d of inoculation. The natural disease nursery of rice blast was selected at Jinggangshan identification nursery in Jiangxi Province. The disease was graded based on the 0-9 grading standard of the International Rice Research Institute (IRRI) (IRRI 2002).
Evaluation of drought resistance
The experiment was conducted in the winter of 2017 at the experimental field of the Shanghai Agrobiological Gene Center in Lingshui County, Hainan Province. A total of two treatments, i.e., drought and control, were set for drought resistance evaluation. The test materials were repeated three times; nine rows were planted in each plot with nine plants in each row, i.e., a row spacing of 20 cm × 23 cm. From seeding to stage II of panicle differentiation, intermittent irrigation was used to keep the field moist, without leaving any water layer. The panicles were treated with drought stress at stage II of differentiation. For drought-sensitive rice control varieties, the stress was halted when all leaf curling failed to recover for more than five days or the leaf dead rate reached 50% in the morning. Thereafter, the field water management was restored. The control treatment was set up in the adjacent paddy field, and the whole growth period was as per conventional paddy field cultivation and management. The yield of plots was measured at the maturity stage and the drought resistance index was calculated (Makara et al, 2006).
Field fertility survey
The planting was executed in stages during the summer of 2017 at the Zhuanghang Experimental Station of the Shanghai Academy of Agricultural Sciences. From April 20th, the planting was conducted at intervals of every ten days, where 7 stages were planted. Single seedlings were planted in three rows, with a spacing of 20 cm × 16.7 cm between rows. In each row, 12 plants were planted. This experiment applied the conventional field water and fertilizer management. From the earliest panicle of the test materials, samples were collected after every 1 d for pollen microscopic examination to observe the pollen fertility and record the pollen sterility data and temperature. For each material, five panicles were collected. While selecting the spikelets for pollen microscopic examination, randomly bag an unflowered panicle of rice with a sulfuric acid paper bag on each plant to investigate the degree of self-sterility.
Agronomic traits and rice quality
The agronomic traits of the newly bred PTGMS line were investigated during the summer and winter of 2017 at Shanghai, and Hainan respectively. In the sterile phase at Shanghai, this study investigated duration (from sowing to heading), plant height, number of panicles per plant, panicle length, number of spikelets per panicle, and stigma exsertion percentage. Two traits, the seed setting rate and 1000-grain weight were investigated in the fertile phase at Hainan. After storing the harvested and dried rice at room temperature for 3 months, the rice quality parameters were evaluated, including brown rice percentage, milled rice percentage, head rice percentage, chalky rice percentage, chalkiness degree (%), grain length (Mm), grain length/width ratio, alkali spreading value, amylose content (%) and gel consistency (Mm). The detection of various indicators was executed based on the Determination of Rice Quality (NYT83-2017).
Characterization of the newly bred PTGMS line for fertility-sterility alternation in growth chambers
In the summer of 2018, the newly bred PTGMS line was sown at the experimental field of Huazhong Agricultural University. Neat and healthy rice seedlings at the 5-leaf stage (about 25 days after sowing) were selected for transplantation, five plants were planted in each pot, and plastic labels were labeled to each plant. Five plant growth chambers (model: ZSX1500GS, Shanghai Jing Wins and Scientific Equipment Co., Ltd., China) were adjusted for trial operation a week before the actual use in the experiment. All the five plant growth chambers had 14 hours of light, a relative humidity level of 75%, and average daily temperatures of 21°C, 22°C, 23°C, 24°C, and 25°C. The rice material was placed in the plant growth chamber for 12 days of temperature treatment in the panicle differentiation stage III then moved to under natural conditions. The pollen grains of the first 5 spikelets of each plant that headed 5-16 days after the end of the treatment were observed under a microscope. Based on pollen morphological classification, the pollen grains were stained with I2-KI, and the degree of pollen sterility per panicle was recorded (Virmani et al, 2003). Lines with an average pollen sterility rate above 99.5% were completely sterile.
Evaluation of derived hybrids
The novel PTGMS line was detected and matched with the restorer lines (Huazhan, Chenghui 727, Hanhui No.3, Hanhui 808, and Hanhui 8228). Meanwhile, the matched combination and the control Fengliangyou No.4 were detected in the summer of 2018 at the Zhuanghang Experimental Station of Shanghai Academy of Agricultural Sciences. The comparison experiment was arranged in random groups and repeated three times. Each plot was planted in 5 rows, with 12 plants in each row, and the row spacing of 20.0 cm × 16.7 cm. The entire growth period was recorded. After maturation, the middle 5 plants were collected to investigate the plant height, panicle length, number of panicles per plant, number of grains per panicle, seed setting rate, and 1000-grain weight. The plots were manually harvested and calculated in actual yield.