Improved Effect of a Mitochondria-Targeted Antioxidant on Hydrogen Peroxide-Induced Oxidative Stress in Human Retinal Pigment Epithelium Cells

doi:10.21203/rs.3.rs-37398/v1

Download PDF

Research article

Improved Effect of a Mitochondria-Targeted Antioxidant on Hydrogen Peroxide-Induced Oxidative Stress in Human Retinal Pigment Epithelium Cells

https://doi.org/10.21203/rs.3.rs-37398/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 20 Jan, 2021

Read the published version in BMC Pharmacology and Toxicology →

You are reading this older preprint version

Read the latest preprint version →

Background: Oxidative damage in retinal pigmented epithelium (RPE) cells contributes to the development of age-related macular degeneration, which is among the leading causes of visual loss in elderly people. In the present study, we evaluated the protective role of TPP-Niacin against the hydrogen peroxide (H₂O₂)-induced oxidative stress to RPE cells.

Methods: The cellular viability, lactate dehydrogenase, reactive oxygen species (ROS), and mitochondrial function were determined in the retinal ARPE-19 cells under the treatment with H₂O₂ or pre-treatment with TPP-Niacin. The expression level of mitochondrial related genes and some transcription factors were assessed using real-time polymerase chain reaction (RT-PCR).

Results: TPP-Niacin significantly improved cell viability reduction, reduced ROS generation and increased the antioxidant enzymes in H₂O₂-treated ARPE-19 cells. Mitochondrial dysfunction from H₂O₂-induced oxidative stress was also significantly diminished by the TPP-Niacin treatment, reduced generation of ROS, an ameliorated reduction of mitochondrial membrane potential (MMP) and an upregulated mitochondrial associated gene. In addition, TPP-Niacin markedly enhanced the expression of transcription factors (PGC-1α and NRF2) and antioxidant associated genes (especially, HO-1 and NQO-1).

Conclusion: We proved the protective effect of TPP-Niacin against H₂O₂-induced oxidative stress in RPE cells. TPP-Niacin is believed to have played a protective role against mitochondrial dysfunction by up-regulating antioxidant-related genes such as PGC-1α, NRF2, HO-1 and NQO-1 in RPE cells.

Pharmacodynamics

Pharmacokinetics

Clinical Pharmacology

Toxicology

age-related macular degeneration

retinal pigment epithelium

mitochondrial function

antioxidants

The Age-related macular degeneration (AMD) is one of the most common causes of irreversible blindness in the elderly population in developed countries. There are two major forms of AMD: the non-neovascular dry form of AMD affecting approximately 85–90% of patients and the neovascular exudative wet form affecting the remaining 10–15% of patients [1, 2]. The dry AMD (atrophy AMD) originates from changes in the pigmentation of the retinal pigmented epithelial (RPE) cells and sub-retinal deposits due to lipid and protein accumulation between the RPE cells and Bruch’s membrane, a condition termed as drusen. These processes finally result in RPE cell death, photoreceptor dysfunction, and loss of vision [1–3]. At present, the treatment of anti-vascular endothelial growth factor therapy (anti-VEGF therapy) has led to extraordinary improvements in wet AMD; however, effective treatment for dry AMD is unfortunately not yet available [4, 5]

Despite being a condition of unknown etiology, oxidative stress has been considered as a major influence on RPE cells in AMD pathophysiology [5–7]. RPE cells have high metabolic rates with enriched mitochondrial population, and the oxidative phosphorylation process produces the cellular energy source adenosine triphosphate (ATP), indicating the making of high amounts of reactive oxygen species (ROS) [8]. Thus, RPE cells exist in an environment of abundant endogenous ROS, while long-term accumulation of such oxidative damage leads to dysfunctions in the RPE cells and raises their susceptibility to oxidative stress. Meanwhile, the ROS predominantly target the mitochondria, destroying their membrane integrity, causing dissipations of the mitochondrial membrane potential (ΔΨm, MMP), and resulting in mitochondrial dysfunction as well as governing cell survival. Indeed, intramitochondrial oxidative stress is connected with processes ruling cell survival, such as mitochondrial flexibility, apoptosis, and autophagy in AMD [9]. Therefore, defending the RPE cells from oxidative damage is considered to be a noteworthy option for preventing the occurrence or weakening of AMD.

To improve the therapeutic effects and diminish the side effects of the chemicals, a number of researchers have investigated strategies for subcellular targeting, especially mitochondria-targeting. The selective targeting of antioxidants toward mitochondria by covalent conjugation to the lipophilic triphenylphosphonium (TPP) cation is a widely used method [10–12]. TPP, which is a well-known mitochondrial targeting moiety, is a membrane-permeant lipophilic cation that is quickly gathered by a factor of several folds within the mitochondria in vivo and is controlled by the large MMP [13]. Since the development of mitochondrial target compounds, there have been several reported mitochondria-targeted antioxidants, including MitoQ [14], MitoC [15], MitoE [16], and TPP-IOA [17]. Most of these studies employed traditional antioxidants such as vitamin C, vitamin E, and oleic acid to obtain TPP-conjugates. Among these vitamins, vitamin B3 (niacin or nicotinic acid) is widely recognized as a potent antioxidant that also exerts powerful lipid-lowering effects with high concentration [18–21]. However, according to our literature search, no one has been shown that not only the synthesis of TPP-conjugated niacin (TPP-Niacin) for mitochondrial-targeting but also the antioxidant effect of TPP conjugated niacin. Therefore, in this study, we synthesized TPP conjugated niacin and investigated whether TPP-Niacin could protect RPE cells from hydrogen peroxide (H₂O₂)-induced damage. We also evaluated the molecular actions underlying the effects of TPP-niacin on H₂O₂ stimulated ARPE-19. In brief, we confirmed that TPP-Niacin exerted a protective role against H₂O₂-induced cytotoxicity and mitochondrial dysfunction via upregulated the antioxidant-associated genes in RPE cells.

Materials and Reagents

The human retinal pigment epithelial ARPE-19 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Dulbecco’s modified Eagle’s medium: Nutrient Mixture F-12 media (DMEM/F12), fetal bovine serum (FBS), penicillin/streptomycin, 2,7-dichlorofluorescein diacetate (H₂DCF-DA) were purchased from Thermo Fisher Scientific (Wilmington, DE, USA). Hydrogen peroxide, dihydroethidium (DHE), JC-10 assay kit, N-acetyl-cysteine (NAC) and carbonyl cyanide m-chlorophenyl hydrazone (CCCP) were purchased from Sigma-Aldrich (St. Louis, MO, USA, owned by Merck KGA). TPP-Niacin was chemically synthesized with reference to a previous report and patent application, and Niacin was used as reference control [12, 14, 22, 23]. Cell Counting Kit-8 (CCK-8) and Lactate dehydrogenase (LDH) assay were purchased from Dojindo Molecular Technologies (Japan). The kits used to determine the superoxide dismutase 1 and 2 (SOD1 and 2), catalase and Glutathione peroxidase activities, Tetramethylrhodamine, ethyl ester (TMRE) reagent were obtained from Abcam (UK).

Cell Culture

The human retinal pigment epithelia ARPE-19 cells were routinely maintained in DMEM/F12 (Thermo Fisher Scientific) supplemented with 10% FBS and 1% penicillin/streptomycin (Thermo Fisher Scientific. The cells were incubated at 37°C in an atmosphere conditioning 5% CO_2.

Cell Viability Assay

The ARPE-19 cells were plated in 96-well plates of 5x10³ cells per well and incubated for 24 h. The next day, the cells were exposed to different concentrations of TPP-Niacin for 24, 48, and 72 h. The cell viability was assessed using Cell Counting Kit-8 (CCK) assay (Dojindo Molecular Technologies). In brief, 10 μL of the CCK reagent was added and incubated for one hour. Then, absorbance was measured at 450 nm using a microplate reader (Bio-Tek, Winooski, VT, USA). To evaluate suitable H₂O₂ concentration for oxidative damage and cytotoxic induction, the cells were seeded in 96-well plates for 24 h and incubated with variouse concentrations of hydrogen peroxide (H₂O₂, Sigma-Aldrich) for another 24 h. Then, cell viability was evaluated by CCK-8 by the same method as before. To examine the protective effect of TPP-Niacin against H₂O₂-induced oxidative damage, cells were seeded in 96-well plates and pre-treated with different concentrations of TPP-Niacin for 2 h, and followed by exposure to 300μM H₂O_2, for an additional 24 h. Then, cell viability was evaluated by CCK-8 as aforementioned. All samples were run in triplicates, and each experiment was repeated three times.

Lactate Dehydrogenase (LDH) Release Assay

Cell cytotoxicity was determined by LDH activity released from damaged cells using the Cytotoxicity LDH assay Kit (Dojindo Molecular Technologies). In brief, ARPE-19 cells were plated in 96-well plates (5000 cells/well) and pre-treated with different concentrations of TPP-Niacin for 2 h followed by exposure to H₂O₂ (300 μM) for 24 h. The background of LDH in the growth medium was measured and subtracted from all test samples. Basal levels of LDH (zero percentage of cell death), as measured in the supernatant of vehicle-treated cells, and maximal levels of LDH (cell death of one hundred percentage), measured by induction of lysis buffer for complete cell death, were averaged and used to calculate the percentage cell death using the manufacturer’s protocol.

Measurement of ROS

The generation of intracellular ROS was examined using the ROS Detection Reagents (Thermo Fisher Scientific) according to the manufacturer’s instructions. Briefly, cells were grown in a 96-well black plate and subjected to different treatments with/without TPP-Niacin and H₂O_2. Then, the cells were incubated with 5 μM 2,7-dichlorofluorescein diacetate (H₂DCF-DA) or 10 μM dihydroethidium (DHE) at 37 °C for 20 min. The fluorescence intensity was measured using the fluorescence plate reader (Bio-Tek) at Ex./ Em. = 495/527 nm for H₂DCF-DA and Ex./ Em. = 535/610 nm for DHE. And then, DCFDA stained cell images were obtained with a fluorescent microscope IX51 with DP Controller (Olympus Optical, Japan). All samples were run in triplicates, and each experiment was repeated three times.

Antioxidant Enzyme Activity

ARPE‐19 cells (2 × 10⁶ cells per well) were plated onto 100 mm cell culture dishes and treated in the same steps as above. ARPE‐19 cells were collected into the clean tubes with 100 μL Pro-Prep (Intron, Korea) lysis buffer for 20 min in ice after washing with PBS. Then, the supernatant was carefully collected after centrifugation and then protein concentration was calculated with a Bicinchoninic acid protein assay kit (BCA, Thermo Fisher Scientific). Intracellular activities of SOD1, SOD2, CAT, and GPx were detected with the commercial kits (Abcam, UK) following their directions. The results were shown as the percentage of the untreated group.

MMP and Staining

The MMP assay was conducted by following the manufacturer’s instruction of the JC-10 MMP assay kit (Sigma-Aldrich). In brief, ARPE-19 cells (5 × 10³ cells/well) seeded in a 96-well clear bottom black plate (Eppendorf Ltd., Germany) were treated with in the same steps as above. After 24 h, the JC-10 assay solution was added to the cells. And then, the plate was incubated under the dark condition for 30 min. Following the incubation, assay buffer B was added and the fluorescent intensity was measured at 490/525 nm and 540/590 nm using a multimode plate reader (Bio-Tek). The ratio of red/green fluorescent intensity was used to determine the MMP. Carbonyl cyanide m-chlorophenyl hydrazone (CCCP) and N-acetyl-cysteine (NAC) were used as positive and antioxidant control, respectively. All samples were run in triplicates, and each experiment was repeated three times. To visualize the effect of TPP-Niacin on MMP, cells were stained with Tetramethylrhodamine, ethyl ester (TMRE) reagent (Abcam, UK). The stained cells were analyzed in an inverted fluorescent microscope IX51 with DP Controller (Olympus Corp., Japan) at Ex./ Em. = 549/575 nm.

Transmission Electron Microscopy

ARPE-19 cells (5 × 10⁶ cells/well) seeded in 100 mm dishes and treated in the same steps as above. Cells were washed three times with 0.1 M Phosphate Buffer (PB) and fixed overnight in 3% glutaraldehyde at 4 ℃ and 1% osmium tetroxide solution as used for additional fixation for 30 min. Cells were dehydrated with a graded series of ethanol, and then dehydrated sample was embedded in epoxy Resin. The embedded sample was cut into ultrathin sections around 60 nm through an ultramicrotome (RMC MT-XL; RMC Products, Tucson, AZ, USA), and a transmission electron microscope (Hitachi H-7100, Japan) was used to observe.

RNA Collection and Quantitative PCR

Total RNA was collected using Trizol reagent (Thermo Fisher Scientific) and resuspended in RNAs free water. The concentration of each sample was determined using the NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). Reverse transcription was performed with 1μg of RNA to produce the complimentary DNA (cDNA) using SensiFast cDNA synthesis kit (Bioline, London, UK). To measure the gene expression, a quantitative polymerase chain reaction (qPCR) was performed using 3μl of cDNA template and the Power SYBR Green Master Mix (Thermo Fisher Scientific) on the StepOnePlus (Applied system, USA). All samples were run in triplicates, and each experiment was repeated three times. Data was normalized to the mean expression of the housekeeping gene using GAPDH and quantified using the 2−^ΔΔCT method. The primer sequences used are inventoried in Table 1.

Statistics

Statistical analysis was performed using GraphPad Prism 5 software (GraphPad Software Inc., La Jolla, CA, USA). All data were presented as mean±SD. Student’s t-test was used to calculate statistical significance between 2 groups. Statistical significance is denoted by the following: ns P >0 05, ∗P <0 05, ∗∗P <0 01, and ∗∗∗P <0 001.

Cell Viability and Protective Effect of TPP-Niacin on ARPE-19 Cells

To evaluate the optimal concentration of TPP-Niacin to be used without causing cytotoxicity, ARPE-19 cells were incubated with various concentrations of TPP-Niacin for 24, 48, and 72 h. As shown in Figure 1B, TPP-Niacin at 25 and 50 μM concentrations did not show any cytotoxicity in the ARPE-19 cells compared to the control group, whereas concentrations between 100 and 400 μM of TPP-Niacin attenuated the cell viability at 48 and 72 h. Thus, 25 and 50 μM of TPP-Niacin were used in the following experiments. To determine a suitable H₂O₂ concentration for oxidative damage, the cells were exposed to various concentrations of H₂O₂ for 24 h. The H₂O₂ treatment (around 300 μM) significantly reduced cell viability, resulting in 46.3 % cell death (Figure 1C). Therefore, the H₂O₂concentration of 300 μM was utilized in the subsequent experiments. To test the defensive effect of TPP-Niacin on H₂O₂-induced cell death, the cells were treated with TPP-Niacin for 2 h before being exposed to H₂O₂for 24 h. As shown in Figure 1D, the pre-treatment with 25 and 50 μM of TPP-Niacin significantly improved H₂O₂-induced reduction of ARPE-19 cells (at 25 μM: 70 ± 6.1%; at 50 μM: 72 ± 7.5%). The protective effect of TPP-Niacin was also assessed by the lactate dehydrogenase (LDH) assay. The TPP-Niacin cells pre-treated for 2 h significantly reduced H₂O₂-induced LDH level (Figure 1E). In addition, to compare the protective effects of niacin and TPP-Niacin, the cell viability assay was performed with and without oxidative stress. The test compounds did not show any cytotoxicity, and the pre-treatment of cells with niacin, TPP-Niacin, and N-acetyl-cysteine (NAC) for 2 h significantly protected the cells from H₂O₂-induced cell death (Supplementary Figures 1A and 1B).

TPP-Niacin Suppressed H₂O₂-Induced Oxidative Stress in ARPE-19 Cells

The excessive accumulation of ROS is regarded to be one of the main sources of cell damage induced by H₂O₂. Intracellular ROS signals were quantified using a fluorescence probe, 2,7-dichlorofluorescein diacetate (DCFDA) and dihydroethidium (DHE) reagent, in the ARPE-19 cells. As shown in Figure 2, compared with the control group, 300 μM H₂O₂ caused a significant increase in the fluorescent intensity of DCFDA (A) and DHE (B) in the ARPE-19 cells. However, pre-treatment with TPP-Niacin in the ARPE-19 cells markedly decreased the ROS levels when compared to H₂O₂ treatment alone (Figures 2A and 2B). The suppressive activity of TPP-Niacin was also observed in the fluorescence image, as illustrated in Figure 2C. Meanwhile, to find the role of the antioxidant enzymes in the protective effect due to TPP-Niacin against oxidative damage, the expressions of major antioxidant enzymes, including SOD1, SOD2, catalase (CAT), and GPx were measured by ELISA. The pre-treatment with TPP-Niacin effectively replenished the activities of SOD1 and SOD2 in the ARPE‐19 cells, which were earlier decreased by treatment with 300 μM H₂O₂ (Figures 3A and 3B). Additionally, the activity of CAT was significantly improved by pre-treatment with TPP-Niacin compared to treatment with H₂O₂ alone (Figure 3C). As shown in Figure 3D, pre-treatment with TPP-Niacin markedly enhanced the GPx level, which was almost abrogated by treatment with H₂O₂. In addition, the ARPE-19 cells pre-treated with niacin and TPP-Niacin showed a marked reduction in H₂O₂-induced ROS production. As expected, TPP-Niacin exerted a somewhat higher protective effect against oxidative stress compared to niacin-treated cells (as shown in Supplementary Figures 2A and 2B).

TPP-Niacin Decreased H₂O₂-Induced Change of MMP and Mitochondrial Morphology

Mitochondrial dysfunction causes loss of MMP (△Ψm). To determine whether TPP-Niacin could decrease H₂O₂-induced △Ψm loss, the △Ψm of the ARPE-19 cells was performed by analyzing the red/green fluorescence intensity ratio via the JC-10 assay. the ARPE-19 cells were exposed to 300 μM H₂O₂ and resulted in a decrease of red/green fluorescence intensity ratio indicating △Ψm dissipation, similar to the carbonyl cyanide m-chlorophenyl hydrazone (CCCP; mitochondrial oxidative phosphorylation uncoupler) group. However, pre-treatment with TPP-Niacin at 25 and 50 μM for 2 h improved the H₂O₂-induced △Ψm loss to the same extent as the antioxidant positive control (NAC), as shown in Figure 4A. The same tendency was observed in ARPE-19 cells pre-treated with TPP-Niacin, when compared with those treated with H₂O₂ alone, using tetramethylrhodamine ethyl ester (TMRE) reagent for visual illumination of the mitochondria (Figure 4B). Interestingly, pre-treatment with the parent compound (niacin) for 2 h did not show any improvement in the H₂O₂-induced △Ψm loss (Supplementary Figure 3); thus, the results revealed that TPP-Niacin could successfully be used as a target for mitochondria. Additionally, mitochondrial morphology was characterized by electron microscopy (EM) (Figure 4C). The H₂O₂ treated cells showed less dense cytoplasm and larger numbers of swollen mitochondria with disrupted cristae, whereas these appeared rather uniform, including intact cristae of the mitochondria morphology, in the control group. Although some mitochondria presented a disorganized structure with disturbed cristae and swollen appearance in the TPP-Niacin pre-treated cells, pre-treatment with TPP-Niacin revealed diminished mitochondrial damage in the ARPE-19 cells (Figure 4C).

TPP-Niacin Increased Expression of OXPHOS and Mitochondrial Related Genes

To understand the molecular mechanisms of the protective effect of TPP-Niacin on mitochondrial biogenesis, the expression of mitochondrial respiration and mitochondrial dynamics genes were studied by real-time quantitative PCR (RT-qPCR). As expected, the expressions of OXPHOS component genes, ATP synthase subunit O (ATP5O), COX4I1(Cytochrome c oxidase subunit 4 isoform 1), Cytochrome c oxidase subunit 5B (COX5b), and NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5 (NDUFB5), were significantly increased by pre-treatment with TPP-Niacin in the ARPE 19 cells, as compared to H₂O₂ treatment alone and the control group (Figure 5A). As illustrated in Figure 5B, the mRNA expression levels of mitochondrial dynamics genes (fission 1 (FIS1), mitofusin 1 and 2 (MFN1 and 2)), mitochondrial DNA replication (polymerase (DNA directed), gamma (POLG)), and transcription gene (transcription factor a, mitochondrial (TFAM)), were significantly elevated by the TPP-Niacin compared to the H₂O₂ treated group. These results suggest that the upregulation of mitochondrial biogenesis genes act like in intermediating the protective effect of TPP-Niacin on H₂O₂-induced cell damage in ARPE-19 cells.

TPP-Niacin Increased Expression of Mitochondrial Biogenesis Related Genes via Upregulated PGC-1a/NRF2 Axis

The transcriptional coactivator, peroxisome-proliferator-activated receptor-gamma coactivator 1α (PGC-1α) is a potent moderator of mitochondrial function, including oxidative phosphorylation and mitochondrial biogenesis in RPE cells [24]. To further elucidate the involvement of PGC-1α in the protective effect of TPP-Niacin, the expression of PGC-1α related genes and antioxidant genes were assessed by RT-PCR. The expression of PGC-1α and PGC-1β was strongly upregulated after treatment with TPP-Niacin. Additionally, the gene expressions of ESRRA, FOXO1, FOXO3, NRF2, PPARα, and Sirt1 were significantly increased by TPP-Niacin (Figure 6A). Consistent with the results of ELISA (as shown in Figure 3), the TPP-Niacin (25 and 50 µM) pre-treatment increased the expressions of SOD1, SOD2, CAT, and GPX in ARPE-19 cells compared to the H₂O₂ treated cells. In addition, the NRF2 downstream target genes, NAD(P)H: quinone oxidoreductase 1 (NQO1), heme oxygenase-1 (HO-1), were also measured by RT-PCR. As shown in Figure 6B, the TPP-Niacin strongly upregulated the expression of HO-1 and NQO-1 but not that of NOX genes (data not shown) in the H₂O₂-treated ARPE-19 cells. These results suggest that the detoxified effects of TPP-Niacin may be due to its action as a ROS scavenger, by which it increases the expression level of the antioxidant enzyme, via reducing oxidative damage.

Oxidative stress in the retina plays a major role in the pathogenesis of dry AMD. While antioxidant defence systems in the retinal cells are appropriate in normal states, strong oxidative stress disintegrates the normal antioxidant systems and result in irreparable damage to the retina. It has been reported that the use of additional antioxidants reduces oxidative stress and preserves retinal function while avoiding oxidative damage. [25, 26]. In addition, experimental and clinical studies suggest that consuming high doses of antioxidants, such as lutein, β-carotene, vitamins, and zinc supplements, are possible protections for curtailing the progression of AMD and vision loss [2]. In the present study, we demonstrated the improved protective effects of TPP-Niacin for the first time; this is a mitochondrial targeting compound against oxidative damage in human RPE cells. In the mitochondrial level, the TPP-Niacin exerts improved protective effects via the mediation of the MMP and its related effector genes, including OXPHOS, mitochondrial dynamics, and mitochondrial DNA replication and transcription. Notably, TPP-Niacin is capable of supplying the prevention against oxidative damage by increment the expression level of antioxidant enzymes, mainly HO-1 and NQO-1, via the upregulation of PGC-1a and NRF2 in the ARPE-19 cells. Furthermore, TPP-Niacin provides better protection than niacin against oxidative damage in ARPE-19 cells, therefore underscoring the potential use of TPP-Niacin as a possible therapeutic agent for AMD, a disease initiated by cell death from oxidative stress and RPE dysfunction.

RPE cells are one of the types of cells that consume high amounts of energy, exist in the back of the photoreceptor cells, and have the most commonplace oxidative-damaged composition in the retina. H₂O₂ is a critical factor in producing oxidative damage and cell death in various cell types, including retinal cells [27]. In the present study, H₂O₂ was used to test ARPE-19 cells to generate oxidative stress and cell cytotoxicity to imitate the onset of dry AMD. As noted in the viability and LDH assays, pre-treatment with TPP-Niacin in the ARPE-19 cells significantly increased the cell viability against H₂O₂-induced cell death, whereas TPP-Niacin reduced the cell death from oxidative damage. Intriguingly, TPP-Niacin treatment alone was able to slightly increase the growth of ARPE-19 cells compared to the parent compound (Supplementary Figure 1A).

Intracellular accumulation of ROS is interconnected with oxidative stress and dysfunction of RPE cells [28]. Diminishments of intracellular ROS may shield the RPEs from oxidative damage [5, 29]. The results in this study confirmed that TPP-Niacin markedly diminished H₂O₂-induced intracellular ROS levels in RPE cells, as observed via DCFDA and DHE staining. There are major antioxidant enzymes, including Cu/Zn-superoxide dismutase (cytosolic SOD, SOD1), manganese superoxide dismutase (mitochondrial SOD, SOD2), catalase, and glutathione peroxidase (GPx). The SODs dismutase superoxide to oxygen and hydrogen peroxide, whereas catalase and GPx transform hydrogen peroxide into H₂O and O₂[28, 29]. The present study demonstrated that pre-incubation with TPP-Niacin increased SOD1 and SOD2 compared to the H₂O₂ group, thus suggesting that TPP-Niacin may combat oxidative stress. Additionally, as a result of catalase and GPx, the TPP-Niacin significantly increased catalase and GPx activities in the decreased by H₂O₂ in ARPE-19 cells. These data indicate that TPP-Niacin may retain the ability to indirectly scavenge oxygen free radicals. Consequently, TPP-Niacin may reduce H₂O₂-induced oxidative stress in ARPE-19 cells by falling the intracellular ROS status and by eliminating oxygen free radicals. In addition, we observed that ARPE-19 cells pre-treated with niacin and TPP-Niacin markedly reduced H₂O₂-induced ROS production. As expected, the TPP-Niacin exerted a somewhat higher preventive effect against oxidative damage, as shown by a 10% increment in the cell viability and 17% decrement in ROS level compared to niacin-treated cells, respectively. The antioxidant activities of TPP-Niacin are at a slightly higher level compared to the parent compound, suggesting that TPP-Niacin is an effective derivative of the parent compound.

The pathological changes of mitochondrial-related dysfunction, including accumulation of ROS and superoxide in mitochondria and MMP (△Ψm) reduction, were discovered in AMD. [25]. In other mitochondrial targeting compounds [10, 14, 31], we observed that pre-treatment with TPP-Niacin significantly enhanced the MMP and improved the mitochondrial ultrastructure in a phenotypic analysis by EM, compared to H₂O₂ alone. Based on these data, we next analyzed gene expressions of mitochondria-related genes, such as OXPHOS subunits, mitochondrial dynamics, and mitochondrial DNA replication and transcription genes. Our results showed that TPP-Niacin significantly upregulated COX4I1, COX5B, NDUFB and MFN1, MFN2, TFAM, and POLG genes; thus, these mitochondrial specific effects of TPP-Niacin could lead to improved mitochondrial function and biogenesis against oxidative stress by H₂O₂.

Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) and -beta (PGC-1β) are transcriptional coactivators that control mitochondrial metabolism and function in various tissues [32], including the retina [27, 33, 34]. To intermediate their functions, the PGC-1α isoforms cooperate with transcription factors, such as estrogen-related receptor alpha (ESRRA), peroxisome proliferator-activated receptor α, γ (PPARα, γ), forkhead foxO1 and 3 (FOXO1), and nuclear respiratory factors 1 (NRF1) and Nfe212 (nuclear factor erythroid 2-related factor 2, NRF2) to control respiration, mitochondrial biogenesis, and expression of antioxidants [27, 35]. PGC-1α is necessitated for the generation of ROS scavenging enzymes, including SOD1, SOD2, GPx, and CAT [36, 37]. Recently, several studies have shown that superoxide dismutase 2 (SOD2), an enzyme detoxifying an excessive accumulation of mitochondrial ROS, was turned on by PGC-1α in RPE cells [27, 38]. Therefore, to determine the possible pathway of the protective effect of TPP-Niacin, we examined the gene expressions of PGC-1α related genes. We observed that PGC-1α and PGC-1β were robustly upregulated by TPP-Niacin compared to the H₂O₂-induced oxidative damage group. In addition, when examining potential downstream transcription factors responsible for these changes, ESRRA, FOXO1 and 3, and NRF1 and 2 were found to be upregulated by TPP-Niacin treatment.

On further investigating the possible mechanism associated with the protective ability of TPP-Niacin, it has appeared that the HO-1 and NQO-1 of downstream target genes of NRF2 signalling play major roles in the prevention of the cells from oxidative damage [39, 40]. Recently, many studies have reported that the activation of NRF2/HO-1 signalling is required for the alleviation of oxidative damage to RPE cells [40–45]. In this study, it was speculated that the anti-oxidative effects of TPP-Niacin might be combined with PGC-1α and NRF2 signalling. The results of the present study reveal that TPP-Niacin protects the ARPE-19 cells from H2O2-induced oxidative damage by activating the NRF2 signalling through upregulation of the expression of NRF2, NQO-1, and HO-1.

Initially, we thought that TPP-Niacin had an effect on nano-concentration state, as well as other mitochondrial targeting compounds, but TPP-Niacin showed antioxidant effects in the range of 10–200 μM. However, as shown in the comparison data with niacin, TPP-Niacin was more effective than its original chemical against oxidative damage in RPE cells. These results underscore TPP-Niacin as a more potent antioxidant against oxidative stress compared to niacin and suggest that its improved protective effects are exerted via regulation of mitochondrial dynamics and antioxidant mechanisms. As many reported other research, it is well established that niacin exerts significant antioxidant, anti-inflammatory and anti-apoptotic activities in a variety of cells and tissues [19, 20, 48–50]. Our study so far has only been applied to focus on the improved antioxidant effect of TPP-Niacin, in terms of mitochondrial and ROS regulation. Further data collection would be needed to determine exactly how TPP-Niacin affects with antioxidant effect via mitochondrial biogenesis and dynamics.

In conclusion, this study shows that TPP-niacin is an improved protective antioxidant than niacin against oxidative damage to ARPE-19 cells via the reduction of ROS levels and protection against oxidative stress-induced cell death. The signal mechanisms by which TPP-Niacin presented such effects involve regulation of the mitochondrial quality control and transcriptional factors such as PGC-1α and NRF2, as well as a boost of antioxidant molecules. These results supply the first experimental evidence for TPP-Niacin as a possible therapeutic agent in the prevention of AMD.

MMP: mitochondrial membrane potential; NAC: N-acetyl-cysteine; CCCP: carbonyl cyanide m-chlorophenyl hydrazone; H₂DCF-DA:2,7-dichlorofluorescein diacetate; DHE: dihydroethidium; ATP5O: ATP synthase subunit O ; COX4I1:Cytochrome c oxidase subunit 4 isoform 1; COX5b: Cytochrome c oxidase subunit 5B; NDUFB5: NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5; POLG: mitochondrial DNA replication (polymerase (DNA directed), gamma; TFAM: transcription factor a, mitochondrial; ESRRA: estrogen-related receptor alpha; PPARα, γ: peroxisome proliferator-activated receptor α, γ ; FOXO1: forkhead foxO1; and NRF1: nuclear respiratory factors 1; NRF2: Nfe212 (nuclear factor erythroid 2-related factor 2.

Acknowledgments

Not applicable.

Authors’ Contributions

M.H.K. and S.G. Y. conceptualization of the study; M.H.K. and D.H. K. performed the experiments; M.H.K. analyzed the data; M.H.K. wrote the paper; D.Y.K. and S.G.Y. reviewed and edited the manuscript.

Funding

The work was supported by the Ministry of Education National Research Foundation (NRF) through the Basic Science Research Program under Grant NRF-2017R1D1A1B03030396 and 2018R1A6A1A03025523 and was partially supported by the Bio & Medical Technology Development Program of the National Research Foundation (NRF) & funded by the Ministry of Science & ICT (2019M3E5D1A02069623).

Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Miller JW, Bagheri S, Vavvas DG. Advances in Age-related Macular Degeneration Understanding and Therapy. US Ophthalmic Rev. 2017;10:119.
Holz FG, Schmitz-Valckenberg S, Fleckenstein M. Recent developments in the treatment of age-related macular degeneration. J Clin Invest. 2014;124:1430–8. doi:10.1172/JCI71029.
Bowes Rickman C, Farsiu S, Toth CA, Klingeborn M. Dry age-related macular degeneration: Mechanisms, therapeutic targets, and imaging. Investig Ophthalmol Vis Sci. 2013;54.
Nebbioso M, Lambiase A, Cerini A, Limoli PG, La Cava M, Greco A. Therapeutic Approaches with Intravitreal Injections in Geographic Atrophy Secondary to Age-Related Macular Degeneration: Current Drugs and Potential Molecules. Int J Mol Sci. 2019;20:1693. doi:10.3390/ijms20071693.
Hernández-Zimbrón LF, Zamora-Alvarado R, Ochoa-De la Paz L, Velez-Montoya R, Zenteno E, Gulias-Cañizo R, et al. Age-Related Macular Degeneration: New Paradigms for Treatment and Management of AMD. Oxid Med Cell Longev. 2018;2018:1–14.
Hollyfield JG, Bonilha VL, Rayborn ME, Yang X, Shadrach KG, Lu L, et al. Oxidative damage–induced inflammation initiates age-related macular degeneration. Nat Med. 2008;14:194–8. doi:10.1038/nm1709.
Shaw PX, Stiles T, Douglas C, Ho D, Fan W, Du H, et al. Oxidative stress, innate immunity, and age-related macular degeneration. AIMS Mol Sci. 2016;3:196–221. doi:10.3934/molsci.2016.2.196.
Murphy MP. How mitochondria produce reactive oxygen species. Biochem J. 2009;417:1–13. doi:10.1042/BJ20081386.
Hyttinen JMT, Viiri J, Kaarniranta K, Błasiak J. Mitochondrial quality control in AMD: does mitophagy play a pivotal role? Cell Mol Life Sci. 2018;75:2991–3008. doi:10.1007/s00018-018-2843-7.
Smith RAJ, Hartley RC, Cochemé HM, Murphy MP. Mitochondrial pharmacology. Trends Pharmacol Sci. 2012;33:341–52. doi:10.1016/j.tips.2012.03.010.
Logan A, Murphy MP. Using chemical biology to assess and modulate mitochondria: Progress and challenges. Interface Focus. 2017;7.
Battogtokh G, Choi YS, Kang DS, Park SJ, Shim MS, Huh KM, et al. Mitochondria-targeting drug conjugates for cytotoxic, anti-oxidizing and sensing purposes: current strategies and future perspectives. Acta Pharm Sin B. 2018;8:862–80. doi:10.1016/j.apsb.2018.05.006.
Murphy MP. Understanding and preventing mitochondrial oxidative damage. Biochem Soc Trans. 2016;44:1219–26. doi:10.1042/BST20160108.
Kelso GF, Porteous CM, Coulter C V, Hughes G, Porteous WK, Ledgerwood EC, et al. Selective targeting of a redox-active ubiquinone to mitochondria within cells: antioxidant and antiapoptotic properties. J Biol Chem. 2001;276:4588–96. doi:10.1074/jbc.M009093200.
Finichiu PG, Larsen DS, Evans C, Larsen L, Bright TP, Robb EL, et al. A mitochondria-targeted derivative of ascorbate: MitoC. Free Radic Biol Med. 2015;89:668–78.
Jameson VJA, Cochemé HM, Logan A, Hanton LR, Smith RAJ, Murphy MP. Synthesis of triphenylphosphonium vitamin E derivatives as mitochondria-targeted antioxidants. Tetrahedron. 2015;71:8444–53. doi:10.1016/j.tet.2015.09.014.
Maddalena LA, Ghelfi M, Atkinson J, Stuart JA. The mitochondria-targeted imidazole substituted oleic acid “TPP-IOA” affects mitochondrial bioenergetics and its protective efficacy in cells is influenced by cellular dependence on aerobic metabolism. Biochim Biophys Acta - Bioenerg. 2017;1858:73–85. https://www.sciencedirect.com/science/article/pii/S0005272816306570?via%3Dihub. Accessed 14 Oct 2019.
Boden WE, Sidhu MS, Toth PP. The Therapeutic Role of Niacin in Dyslipidemia Management. J Cardiovasc Pharmacol Ther. 2014;19:141–58. doi:10.1177/1074248413514481.
Si Y, Zhang Y, Zhao J, Guo S, Zhai L, Yao S, et al. Niacin inhibits vascular inflammation via downregulating nuclear transcription factor-b signaling pathway. Mediators Inflamm. 2014;2014.
Ganji SH, Qin S, Zhang L, Kamanna VS, Kashyap ML. Niacin inhibits vascular oxidative stress, redox-sensitive genes, and monocyte adhesion to human aortic endothelial cells. Atherosclerosis. 2009;202:68–75. doi:10.1016/j.atherosclerosis.2008.04.044.
Kamanna VS, Kashyap ML. Mechanism of Action of Niacin. Am J Cardiol. 2008;101:S20–6. doi:10.1016/J.AMJCARD.2008.02.029.
Yuan H, Cho H, Chen HH, Panagia M, Sosnovik DE, Josephson L. Fluorescent and radiolabeled triphenylphosphonium probes for imaging mitochondria. Chem Commun. 2013;49:10361–3.
Yang, S.G.; Kim, D.H. South Korea Patent Application No. 10-2019-0075016, 2019
Iacovelli J, Rowe GC, Khadka A, Diaz-Aguilar D, Spencer C, Arany Z, et al. PGC-1α induces human RPE oxidative metabolism and antioxidant capacity. Investig Ophthalmol Vis Sci. 2016;57:1038–51.
SanGiovanni JP, Chew EY, Clemons TE, Ferris FL, Gensler G, Lindblad AS, et al. The relationship of dietary carotenoid and vitamin A, E, and C intake with age-related macular degeneration in a case-control study: AREDS report No. 22. Arch Ophthalmol. 2007;125:1225–32.
Richer S, Patel S, Sockanathan S, Ulanski LJ, Miller L, Podella C. Resveratrol based oral nutritional supplement produces long-term beneficial effects on structure and visual function in human patients. Nutrients. 2014;6:4404–20.
Cai J, Nelson KC, Wu M, Sternberg P, Jones DP. Oxidative damage and protection of the RPE. Prog Retin Eye Res. 2000;19:205–21. doi:10.1016/S1350-9462(99)00009-9.
Babizhayev MA, Yegorov YE. Reactive Oxygen Species and the Aging Eye. Am J Ther. 2016;23:e98–117. doi:10.1097/MJT.0b013e3181ea31ff.
Nita M, Grzybowski A. The Role of the Reactive Oxygen Species and Oxidative Stress in the Pathomechanism of the Age-Related Ocular Diseases and Other Pathologies of the Anterior and Posterior Eye Segments in Adults. Oxid Med Cell Longev. 2016;2016.
Barot M, Gokulgandhi MR, Mitra AK. Mitochondrial Dysfunction in Retinal Diseases. Curr Eye Res. 2011;36:1069–77. doi:10.3109/02713683.2011.607536.
Zernii EY, Gancharova OS, Baksheeva VE, Golovastova MO, Kabanova EI, Savchenko MS, et al. Mitochondria-targeted antioxidant SkQ1 prevents anesthesia-induced dry eye syndrome. Oxid Med Cell Longev. 2017;2017.
Finck BN, Kelly DP, Finck BN, Kelly DP. PGC-1 coactivators : inducible regulators of energy metabolism in health and disease Find the latest version : Review series PGC-1 coactivators : inducible regulators of energy metabolism in health and disease. 2006;116:615–22.
Saint-Geniez M, Jiang A, Abend S, Liu L, Sweigard H, Connor KM, et al. PGC-1α regulates normal and pathological angiogenesis in the retina. Am J Pathol. 2013;182:255–65. doi:10.1016/j.ajpath.2012.09.003.
Xiaoxin Guo, Ebernella S. Dason, Vicente Zanon-Moreno, Qi Jiang, Adrian Nahirnyj, Darren Chan JGF and JMS. PGC-1α Signaling Coordinates Susceptibility to Metabolic and Oxidative Injury in the Inner Retina. Am J Pathol. Am J Pathol 2014 Apr;184(4):1017-1029. doi: 10.1016/j.ajpath.2013.12.012
Kaarniranta K, Pawlowska E, Szczepanska J, Jablkowska A, Blasiak J, Kaarniranta K, et al. Role of Mitochondrial DNA Damage in ROS-Mediated Pathogenesis of Age-Related Macular Degeneration (AMD). Int J Mol Sci. 2019;20:2374. doi:10.3390/ijms20102374.
Austin S, St-Pierre J. PGC1a and mitochondrial metabolism-emerging concepts and relevance in ageing and neurodegenerative disorders. J Cell Sci. 2012;125:4963–71. doi:10.1242/jcs.113662.
St-Pierre J, Drori S, Uldry M, Silvaggi JM, Rhee J, Jäger S, et al. Suppression of reactive oxygen species and neurodegeneration by the PGC-1 transcriptional coactivators. Cell. 2006;127:397–408. doi:10.1016/j.cell.2006.09.024.
Satish S, Philipose H, Rosales MAB, Saint-Geniez M. Pharmaceutical Induction of PGC-1 α Promotes Retinal Pigment Epithelial Cell Metabolism and Protects against Oxidative Damage. Oxid Med Cell Longev. 2018;2018:1–9. doi:10.1155/2018/9248640.
Hu Y, Duan M, Liang S, Wang Y, Feng Y. Senkyunolide I protects rat brain against focal cerebral ischemia-reperfusion injury by up-regulating p-Erk1/2, Nrf2/HO-1 and inhibiting caspase 3. Brain Res. 2015;1605:39–48. doi:10.1016/j.brainres.2015.02.015.
Kanzaki H, Shinohara F, Kanako I, Yamaguchi Y, Fukaya S, Miyamoto Y, et al. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes. Redox Biol. 2016;8:186–91. doi:10.1016/j.redox.2016.01.006.
Hu H, Hao L, Tang C, Zhu Y, Jiang Q, Yao J. Activation of KGFR-Akt-mTOR-Nrf2 signaling protects human retinal pigment epithelium cells from Ultra-violet. Biochem Biophys Res Commun. 2018;495:2171–7. doi:10.1016/J.BBRC.2017.12.078.
Felszeghy S, Viiri J, Paterno JJ, Hyttinen JM, Koskela A, Chen M, et al. Loss of NRF-2 and PGC-1α genes leads to retinal pigment epithelium damage resembling dry age-related macular degeneration. Redox Biol. 2018;20:1–12. doi:10.1016/j.redox.2018.09.011.
Huang S-Y, Chang S-F, Chau S-F, Chiu S-C. The Protective Effect of Hispidin against Hydrogen Peroxide-Induced Oxidative Stress in ARPE-19 Cells via Nrf2 Signaling Pathway. Biomolecules. 2019;9:380. doi:10.3390/biom9080380.
Hu X, Liang Y, Zhao B, Wang Y. Thymoquinone protects human retinal pigment epithelial cells against hydrogen peroxide induced oxidative stress and apoptosis. J Cell Biochem. 2019;120:4514–22. doi:10.1002/jcb.27739.
Arumugam B, Palanisamy UD, Chua KH, Kuppusamy UR. Protective effect of myricetin derivatives from Syzygium malaccense against hydrogen peroxide-induced stress in ARPE-19 cells. Mol Vis. 2019;25:47–59. http://www.ncbi.nlm.nih.gov/pubmed/30820141. Accessed 17 Sep 2019.
Zhao H, Wang R, Ye M, Zhang L. Genipin protects against H2O2-induced oxidative damage in retinal pigment epithelial cells by promoting Nrf2 signaling. Int J Mol Med. 2018;:936–44. doi:10.3892/ijmm.2018.4027.
Wang Z, Hao Y, Wang Y, Liu J, Yuan X, Sun B, et al. Wheat alkylresorcinols protect human retinal pigment epithelial cells against H2O2-induced oxidative damage through Akt-dependent Nrf2/HO-1 signaling. Food Funct. 2019;10:2797. doi:10.1039/c8fo02564a.
Liu D, Wang X, Kong L, Chen Z. Nicotinic Acid Regulates Glucose and Lipid Metabolism Through Lipidindependent Pathways. Curr Pharm Biotechnol. 2014;16:3–10.
Ruparelia N, Digby JE, Choudhury RP. Effects of niacin on atherosclerosis and vascular function. Curr Opin Cardiol. 2011;26:66–70. doi:10.1097/HCO.0b013e3283410c16.
Sahebkar A. Effect of niacin on endothelial function: A systematic review and meta-analysis of randomized controlled trials. Vasc Med. 2014;19:54–66. doi:10.1177/1358863X13515766.

Table 1. Primer sequences used in this study

Target gene	Forward sequence (5’-3’)	Reverse sequence (5’-3’)
ATP5O	CGCTATGCCACAGCTCTTTA	AAGGCAGAAACGACTCCTTG
COX4I1	GGCATTGAAGGAGAAGGAGA	TCATGTCCAGCATCCTCTTG
COX5B	GAGGTGGTGTTCCCACTGAT	CAGACGACGCTGGTATTGTC
NDUFB5	CTTCCTCACTCGTGGCTTTC	TCTGGGACATAGCCTTCTGG
FIS1	GACATCCGTAAAGGCATCGT	ACAGCAAGTCCGATGAGTCC
MFN1	TGCCCTCTTGAGAGATGACC	TCTTTCCATGTGCTGTCTGC
MFN2	ATGCATCCCCACTTAAGCAC	GCAGAACTTTGTCCCAGAGC
TFAM	TAAGACTGCAAGCAGCGAAG	TTCTCAGTTTCCCAGGTGCT
POLG	TGCAGTGAGGAGGAGGAGTT	CCCAGGTAAGTGCCATGAGT
SOD1	GAAGGTGTGGGGAAGCATTA	CTTTGCCCAAGTCATCTGCT
SOD2	AAACCTCAGCCCTAACGGTG	GCCTGTTGTTCCTTGCAGTG
CAT	GATAGCCTTCGACCCAAGCA	AGAAGGCTGTTGTTCCGGAG
GPX1	AGTCGGTGTATGCCTTCTCG	CAAACTGGTTGCACGGGAAG
TXN2	TGGTGGCCTGACTGTAACAC	CACCGCTGACACCTCATACT
PRDX3	TGCATGTGGAAGAACGAGCT	TCCACTGAGACTGCGACAAC
PRDX5	AGGGTGTGCTGTTTGGAGTT	TCCACATTCAGGGCCTTCAC
PRDX6	CAGCTCGTGTGGTGTTTGTT	AGATGGGAGCTCTTTGGTGA
HMOX1	AGTCTTCGCCCCTGTCTACT	GCTTGAACTTGGTGGCACTG
NQO1	AAAGGACCCTTCCGGAGTAA	CGTTTCTTCCATCCTTCCAG
PGC1a	CAAGCAAAGGGAGAGGCAGA	ACCTGCGCAAAGTGTATCCA
PGC1b	TGGGCTGAGTTCTCCATTCT	TGAAGCTGCGATCCTTACCT
ESRRA	TCGCTGTCTGACCAGATGTC	AGGGCCAAGGCCTTTAGTAG
FOXO1	GCATCCATGGACAACAACAG	AGATGGCGGGTACACCATAG
FOXO3	CATCATGGCAAGCACAGAGT	GAGCGTGATGTTATCCAGCA
NRF1	CTTACAAGGTGGGGGACAGA	CAATGTCACCACCTCCACAG
NRF2	GCGACGGAAAGAGTATGAGC	ACGTAGCCGAAGAAACCTCA
PPARA	CCCTTTTTGTGGCTGCTATC	ATCCGACTCCGTCTTCTTGA
SIRT1	CCATGGCGCTGAGGTATATT	TCTCCATCAGTCCCAAATCC
GAPDH	ACCCAGAAGACTGTGGATGG	TTCTAGACGGCAGGTCAGGT

Download PDF

Journal Publication

published 20 Jan, 2021

Read the published version in BMC Pharmacology and Toxicology →

Editorial decision: Major revision
06 Oct, 2020
Review #2 received at journal
02 Oct, 2020
Review #1 received at journal
08 Sep, 2020
Reviewer #2 agreed at journal
08 Sep, 2020
Reviewer #1 agreed at journal
20 Aug, 2020
Reviewers invited by journal
26 Jun, 2020
Editor invited by journal
25 Jun, 2020
Editor assigned by journal
25 Jun, 2020
Submission checks completed at journal
24 Jun, 2020
First submitted to journal
21 Jun, 2020

You are reading this older preprint version

Read the latest preprint version →

Improved Effect of a Mitochondria-Targeted Antioxidant on Hydrogen Peroxide-Induced Oxidative Stress in Human Retinal Pigment Epithelium Cells

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Methods

Results

Discussion

Abbreviations

Declarations

References

Tables

Status:

Journal Publication

Version 1