An AMPK-dependent hypoxia-responsive subnucleus of the nucleus tractus solitarius coordinates the hypoxic ventilatory response and protects against apneoa in mice

doi:10.21203/rs.3.rs-3747861/v1

Download PDF

Research Article

An AMPK-dependent hypoxia-responsive subnucleus of the nucleus tractus solitarius coordinates the hypoxic ventilatory response and protects against apneoa in mice

https://doi.org/10.21203/rs.3.rs-3747861/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Functional magnetic resonance imaging (fMRI) suggests that the hypoxic ventilatory response is facilitated by the AMP-activated protein kinase (AMPK), not at the carotid bodies, but within a subnucleus (Bregma − 7.5 to -7.1mm) of the nucleus tractus solitarius that exhibits rightsided bilateral asymmetry. Here, we map this subnucleus using cFos expression as a surrogate for neuronal activation and mice in which the genes encoding the AMPK-α1 (Prkaa1) and AMPKα2 (Prkaa2) catalytic subunits were deleted in catecholaminergic cells by Cre expression via the tyrosine hydroxylase promoter. Comparative analysis of brainstem sections, relative to controls, revealed that AMPKα1/α2 deletion inhibited, with rightsided bilateral asymmetry, cFos expression in and thus activation of a neuronal cluster that partially spanned three interconnected anatomical nuclei adjacent to the area postrema: SolDL (Bregma − 7.44mm to -7.48mm), SolDM (Bregma − 7.44mm to --7.48mm) and SubP (Bregma − 7.48mm to -7.56mm). This approximates the volume identified by fMRI. Moreover, these nuclei are known to be in receipt of carotid body afferent inputs, and catecholaminergic neurons of SubP and SolDL innervate aspects of the ventrolateral medulla responsible for respiratory rhythmogenesis. Accordingly, AMPKα1/α2 deletion attenuated hypoxiaevoked increases in minute ventilation, blocked active expiration, decreased sigh frequency and increased apnoea frequency. The metabolic status of these AMPKα1/α2 knockouts and the brainstem and spinal cord catecholamine levels were equivalent to controls. We conclude, that within the brainstem an AMPK-dependent, hypoxia-responsive subnucleus partially spans SubP, SolDM and SolDL, namely SubSolHΙe, and is critical to coordination of active expiration, the hypoxic ventilatory response and defence against apnoea.

AMPK

NTS

catecholaminergic

hypoxia

active expiration

hypoxic ventilatory response

apnoea

When oxygen availability falls, the hypoxic ventilatory response (HVR) delivers compensatory increases in ventilatory drive. The HVR is initiated by increases in afferent fibre discharge from the carotid bodies, the primary peripheral arterial chemoreceptors of mammals, that in turn elicit increases in ventilatory drive via the respiratory central pattern generators (rCPG) in the brainstem [72, 42, 36]. Our previous studies revealed that the HVR is facilitated by a cellular energy sensor, the AMP-activated protein kinase (AMPK), within catecholaminergic neurons of the nucleus tractus solitarius (NTS) that receive carotid body afferent input responses [52], rather than at the level of the carotid bodies^1–3. Therefore, the role of AMPK extends beyond cellular metabolic homeostasis [69] to breathing and thus oxygen [17, 19] and energy (ATP) supply to the body as a whole [18].

AMPK maintains cellular energy homeostasis in a cell-autonomous manner, through the action of at least twelve possible isoforms formed by heterotrimeric association of the two α catalytic, two β and three γ regulatory subunits [69]. Importantly, each may hold different sensitivities to activation by increases in cellular AMP and ADP, and differ in their capacity to directly phosphorylate and thus regulate downstream targets⁶. AMPK is coupled to mitochondrial oxidative phosphorylation and thus oxygen supply by two discrete but cooperative pathways. Binding of AMP to the AMPKγ subunit increases activity 10-fold by allosteric action, while AMP or ADP binding delivers increases in LKB1-dependent phosphorylation and reductions in dephosphorylation of Thr172 on the α subunit that confer 100-fold further activation [29]. All of these effects are inhibited by ATP⁵. There are also three AMP- and ADPindependent pathways to AMPK activation: long chain fatty acid regulation through the allosteric drug and metabolite (ADaM) site [69, 62]; glucose modulation through a fructose-1,6bisphosphate (FBP) sensing mechanism that may involve the aldolasevATPaseRagulator complex on lysosomes^[79,44]; calcium-dependent activation through calcium-calmodulin activated kinase kinase 2 (CaMKK2) [75]. Of these, it is the canonical energy stress and thus the LKB1AMPK signalling pathway that facilitates the HVR [51].

Classically, once activated AMPK maintains energy homeostasis in a cell autonomous manner, by activating catabolic and inhibiting anabolic processes[69]. However, AMPK may also regulate cell- and system-specific function [16] by phosphorylating and regulating non-canonical targets including ion channels [64, 40, 35, 4, 55, 58, 10], enzymes for transmitter biosynthesis [80], receptors [1], and transporters [67].

Functional magnetic resonance imaging indicated that AMPK deletion in catecholaminergic neurons preferentially attenuates activation of a subnucleus of the NTS with right-sided bilateral asymmetry [52]. Importantly, carotid body afferent inputs terminate within this region of the NTS [21], which lies adjacent to the caudal most aspect of the area postrema (AP). Here, within the dorsal vagal complex [31] afferent input responses are integrated before onward relay of output commands to the ventrolateral medulla (VLM) which facilitate increases in ventilatory drive via the ventral rCPG [2, 78, 34]. Although the precise circuit mechanisms remain to be determined, it is evident that the most prominent afferent chemoreceptor projections terminate within the commissural (SolC) and medial (SolM) subnuclei, while less prominent projections are evident at the interstitial (SolI), intermediate (SolIM), dorsolateral (SolDL), and ventrolateral (SolVL) subnuclei. In addition, a few terminals project to the AP and the dorsal motor nucleus of the vagus (10N) [21]. By contrast, vagal afferents arising from the pulmonary stretch receptors terminate within SolIM, SolI, the ventral subnucleus (SolV), and SolVL [41], while densely projecting baroreceptor afferent terminals project to SolM at the caudal most aspect of the AP, where they coincide with afferent innervation from peripheral chemoreceptors [53]. These findings are significant because conditional deletion of AMPK in catecholaminergic neurons attenuates the HVR without dramatically altering systemic cardiovascular responses to hypoxia [57].

It is therefore important that we gain a greater understanding of the site and mechanism of AMPK action. This is especially so given that mice with AMPK deletion targeted to catecholaminergic neurons exhibit a neonatelike HVR during poikilocapnic hypoxia, comprising hypoventilation and apnoea with preserved hypercapnic ventilatory responses [52], while exposure to hypoxia under anaesthesia triggers irreversible ventilatory arrest [52]. In short, these mice exhibit face validity that is consistent with symptoms in patients suffering from central apnoea of prematurity in neonates [56, 61, 24] and central sleep apnoea in adults, which is allied with susceptibility to respiratory arrest under anaesthesia [60].

We show here that AMPK deletion selectively attenuates, with right-sided bilateral asymmetry, activation of a neuronal cluster that partially spans three anatomical nuclei of the NTS that lie adjacent to the AP, namely SolDL, SolDM and SubP, and at a location that approximates the volume of the AMPKdependent, hypoxia-responsive region of the NTS (Bregma − 7.1mm to -7.5mm) identified by fMRI [52]. Accordingly, AMPK deficiency blocks hypoxia-evoked increases in active expiration, decreases sigh frequency, and preferentially increases the frequency of apnoeas.

Mouse models

Experiments were performed in accordance with the regulations of the United Kingdom Animals (Scientific Procedures) Act of 1986. All studies and breeding were approved by the University of Edinburgh and performed under UK Home Office project licenses. Studies performed in Cork were carried out under licence from the Department of Health and Children, Ireland. Both male and female C57/Bl6 mice were used. Numbers of mice (≥ 4 per measure) used are indicated for each experiment. Global, dual knockout of the genes encoding AMPK-α1 (Prkaa1) and AMPK-α2 (Prkaa2) is embryonic lethal. We therefore employed conditional deletion of the genes for the AMPK-α1 and AMPK-α2 subunits, using mice in which the sequence encoding the catalytic site of both α subunits was flanked by loxP sequences[43] (AMPK-α1/α2 Flx). Mice with AMPK deletion in catecholaminergic cells were obtained as described previously⁴ by crossing AMPK-α1/α2 Flx mice with mice in which Cre recombinase expression was driven via the tyrosine hydroxylase (TH) promoter [46].

Genotyping

The presence of wild-type or floxed AMPK-α1 and AMPK-α2 alleles and Cre recombinase[50, 49, 52] was detected by PCR of digested ear clip tissue. Three primers were used to detect TH Cre (forward 5’ CACCCTGACCCAAGCACT 3’; reverse 5’ CTTTCCTTCCTTTATTGAGAT 3’; internal positive control 5’ GATACCTGGCCTGGTCTCG 3’; expected size WT = 290bp, Cre = 390bp) and two primers were used for each AMPK catalytic subunit: α1-forward 5’ TATTGCTGCCATTAGGCTAC 3’, α1-reverse: 5’ GACCTGACAGAATAGGATATGCCCAACCTC 3’ (WT = 588bp, floxed = 682bp); α2-forward 5’ GCTTAGCACGTTACCCTGGATGG 3’, α2-reverse: 5’ GTTATCAGCCCAACTAATTACAC 3’ (WT = 204bp, floxed = 250bp). 10µl samples were run on 2% agarose gels with 0.01% v/v SYBR®Safe DNA Gel Stain (Invitrogen) in TBE buffer against a 100bp DNA ladder (GeneRuler™, Fermentas) using a Model 200/2.0 Power Supply (Bio-Rad). Gels were imaged using a Genius Bio Imaging System and GeneSnap software (Syngene).

Plethysmography

As described previously [50, 49, 52], we used a whole-body unrestrained plethysmograph, incorporating a Halcyon™ low noise pneumatochograph (Buxco Research Systems, UK) coupled to FinePointe acquisition and analysis software (Data Science International, USA). Following acclimation and baseline measurements (awake but quiet, undisturbed periods of breathing) under normoxia (room air), mice were exposed to hypoxia (8% O₂, with 0.05% CO₂, balanced with N₂) for 10min or 60min. The FinePointe software automatically calculated the respiratory parameters assessed after application of exclusion criteria due to non-ventilatory artefacts (movement, sniffing, etc.). Data were acquired as 2 second averages of 2 to 4 data points of undisturbed breathing per time point of the HVR. Apnoeas were defined as a period of cessation of breathing that was greater than the average duration, including inter-breath interval, of 2 successive breaths (~ 600ms) of control mice during normoxia with a detection threshold for inspiration of 0.25 mmHg (SD of the noise).

Metabolic measurements

Naïve and untrained mice undergoing metabolic measurements (O₂ consumption (VO₂) and CO₂ production (VCO₂)) were placed in a whole-body plethysmography chamber as described above (Buxco, USA). Airflow through the chamber was maintained at 1l/min. Fractional concentrations of O₂ and CO₂ were measured in air entering and exiting the plethysmography chamber by an O₂ and CO₂ analyser (ADI instruments, Colorado Springs, CO, USA) online data sampling performed at a frequency of 0.1Hz, with one cumulative value per minute per mouse used for further analysis. To ensure steady-state conditions during hypoxia, metabolism values were taken after 5min exposure to hypoxia.

Two hypoxic protocols were used for each mouse – a step challenge and a graded hypoxia challenge. The step challenge introduced 8% O₂ (0.05% CO₂, balanced in N₂) immediately following a 5min baseline period at 21% O₂ (0.05% CO₂, balanced in N₂) and lasted for a total of 10min. The graded hypoxia challenge involved a 5min baseline period at 21% O₂ (0.05% CO₂, balanced in N₂), which was then followed by 5min of decreasing O₂ concentrations (18% O₂, 15% O₂, 12% O₂, 10% O₂, 8% O₂, all in 0.05% CO₂, balanced in N₂).

For the hypoxic step challenge data are shown normalised for body mass (g) after 5min of hypoxia and presented on a minute-by-minute basis thereafter. For the graded hypoxic challenge, measurements were taken during the final (fifth) minute of each given O₂ concentration.

High-performance liquid chromatography (HPLC) coupled to electrochemical detection for the measurement of brainstem monoamine concentrations

The effect of AMPK deletion in catecholaminergic cells on the brainstem bioamine content was assessed by High Performance Liquid Chromatography (HPLC).

Following completion of all metabolic measurements, experimental mice were returned to their holding cages and allowed to recover and settle for a minimum of 60min. Mice were culled by exposure to 5% isoflurane in air and dislocation of the neck and trunk blood was collected immediately and placed on ice. Brainstems and spinal cords were dissected.

Tissues were sonicated (Bandelin Sonopuls HD 2070) in 1 ml of chilled mobile phase, spiked with 2 ng/20ml of N-methyl 5-HT as internal standard. Brainstem monoamine precursor and metabolite concentrations were measured as previously described [48, 59]. Noradrenaline (NA), serotonin (5-HT), and monoamine metabolite and precursor, 5-hydroxyindoleacetic acid (5- HIAA), and L-3,4 dihydroxyphenylalanine (LDOPA) were identified by their characteristic retention times and concentrations determined by comparison against standard injections run at regular intervals during sample analysis.

Perfusion, fixation and cryoprotection

Following administration of an overdose of sodium pentobarbital, the chest cavity was exposed and mice were perfusion-fixed by cardiac puncture with ice-cold heparinised saline containing 4% paraformaldehyde (PFA). The whole brain and cervical spinal cord were extracted and post-fixed overnight in a 4% PFA/15% sucrose post-fix solution at 4°C. The next day, brains were transferred into a 30% sucrose solution and stored at 4°C for a minimum of 24h.

Upon tissue extraction, each specimen was allocated a random three-digit code and all subsequent processes were carried out blind with respect to the treatment condition until unblinding took place at the point of statistical analysis.

Sectioning of the brainstem

Brainstems and the cervical part of the spinal cord were separated from the forebrain roughly at the point of the optic chiasm using a sharp blade, then wrapped in aluminium foil and flash frozen in ground dry ice. Frozen brainstems were mounted caudal side up onto a Frigomobil freezing microtome (Leica), covered in Cryo-M-Bed embedding compound (Bright) and allowed to freeze again. Sections were cut with a 33° blade at a thickness of 30µm and collection started as soon as the cerebellum became visible. 7 alternating sections (A’s and B’s), each separated by 60µm, were collected per vial in 0.1M phosphate buffer (PB) and later transferred into cryoprotecant (20% v/v Glycerol, 30% v/v Ethylene glycol, 50% v/v 0.2M PBS) for storage at -20°C until used for immunohistochemistry.

Immunohistochemistry and Diaminobenzidine staining

For immunostaining, several vials per animal from the same alternation (either all A’s or all B’s per animal) were used in a free-floating technique. All procedures were carried out at room temperature on a shaker. Sections from each vial were washed four times for 10min in 0.3% Triton X-100 in 0.1M phosphate buffered (PBT), followed by a 20min incubation in 0.3% (v/v) hydrogen peroxide. After another four 10min washes in 0.1M PBT, sections were incubated in blocking buffer (3% normal serum against the host species of the secondary antibody) for 30min-60min and then incubated in rabbit anticFos primary antibodies (1:50,000; 226 003 Synaptic Systems, Germany) diluted in blocking buffer for an initial 30min-60min at room temperature before being transferred to 4°C for 36hrs-48hrs.

After six 5min washes in 0.1M PBT, a biotinylated IgG anti-rabbit secondary antibody (1:500; BA-1100, Vector Laboratories) diluted in blocking buffer was applied for 1hr at room temperature. Sections were rinsed in four 5min washes with 0.1M PBT and antibody-antigen complexes were visualised by using ABC methods with a Vector stain elite kit (Vector Laboratories, UK) with nickel‐intensified diaminobenzidine (Ni‐DAB). Sections were washed in 0.1M PB twice for 5min and once for 10min and the above protocol repeated with the following changes: the primary antibody used was mouse anti-TH (1:2000; MAB318, Merck Millipore, UK), secondary antibody a biotinylated IgG anti-mouse (1:500; BA-1100, Vector Laboratories), and antibody‐antigen complexes were visualised by using ABC methods with a Vector stain elite kit intensified with diaminobenzidine only.

Sections were mounted on gelatine-coated glass microscope slides (Fisher) in a caudo-rostral order and air dried in a sealed container overnight. Dried sections were dehydrated by submerging them in solutions of increasing concentrations of ethanol, (70% v/v, 90% v/v and 95% v/v) for 5mins each, followed by three times 10mins at 100% v/v and finally two 10mins steps in xylene. A glass coverslip was applied using DPX Mountant for histology (Sigma) and all slides were left to dry in a fume hood for 48hrs before storage at 4°C and microscopy.

Image acquisition

Images of each section were captured using a Leica DMR reflected light microscope and LAS V4.5.0 imaging software (Leica). A x5 magnification was used to capture an overview the entire section, whereas a x20 magnification was used to capture images of the dorsal nucleus tractus solitarius (NTS) and area postrema (AP), and the ventrolateral regions that showed TH-positive cell bodies.

For the dorsal NTS regions of interest, three images were stitched into one using the LAS imaging software in order to retain the original image resolution for measurements of surface area.

Image analysis

Using an online tool, regions of the NTS present in the mouse brain atlas²³ were selected and the background made transparent. These “templates” were then overlaid onto each immunohistochemical image using Inkscape version 0.48.2. The template with the best fit for the AP as a landmark was chosen, whereby the size of the template was increased or decreased proportionally to fit the underlying image. Templates were created for each brain map in the mouse brain atlas that included the area postrema, which encompassed Bregmas − 7.76mm, -7.64mm, -7.56mm, and − 7.48mm. Any sections that could not be clearly allocated to a specific Bregma from the brain atlas – due to smaller distances between sections cut (60µm) and those illustrated in the atlas (80µm) – were labelled as -7.70mm, -7.60mm, -7.52mm, -7.44mm.

The images with the templates were then further analysed using (FIJI Is Just) ImageJ version 2.0.0-rc-43/1.51s. At this point, all procedures were still carried out blind with respect to treatment condition (normoxia/hypoxia). To measure the surface area for each subnucleus of the NTS, a global scale was set for each image according to the LAS specifications for x20 magnifications. Using the “ROI” plugin and a free-hand drawing tool, each subnucleus and the AP were traced along the template lines and the surface areas measured. Each of the measurements was then multiplied by 30 to account for the 30µm thickness of each section. cFos⁺ nuclei within each subnucleus of the NTS and the AP were counted manually using a counter plugin and simultaneously confirmed on the microscope. Data are presented as total cFos⁺ counts per 1000µm³.

Statistical analysis

Once all stained sections from each experimental animal had been counted, unblinding occurred and statistical comparison was completed using GraphPad Prism 6. One-way ANOVA with Tukey post-hoc test was used when comparing across one variable (e.g., genotype) and two-way ANOVA with Sidak post-hoc tests when comparing across two variables (e.g., genotype and time). Statistical significance was assumed when p ≤ 0.05. To ensure as few mice as possible were used to determine differences by significance test, experiments were conducted and acquired data statistically assessed in stages by the variable criteria sequential stopping rule (SSR). In this way animal use was minimised, power maximised and the probability of type I errors kept constant.

Previously, targeted deletion of AMPKα1 and AMPKα2 in brainstem catecholaminergic cells through Cre expression via the tyrosine hydroxylase promoter (TH-AMPK-α1/α2 knockout) was confirmed by single-cell end-point PCR, viral injection of a Creinducible vector carrying a reporter gene [52] and by crossing THAMPK-α1/α2 knockout mice with mice engineered for Credependent expression of Rosa (tdTomato) and subsequent analysis by confocal imaging of caudal brainstem areas [50].

AMPK deletion attenuates cFos expression of a hypoxia-responsive nucleus within the nucleus tractus solitarius

Functional magnetic resonance imaging (fMRI) analysis previously indicated that THAMPKα1/α2 deletion in catecholaminergic neurons resulted in marked attenuation of neuronal activation during hypoxia within a “dorsal active region” (DAR) of the nucleus tractus solitarius (NTS) that exhibited right-sided bilateral asymmetry [52]. The overall shape of the DAR indicated that several anatomical subnuclei of the NTS were likely affected by AMPK deficiency. Surprisingly, AMPK deletion and subsequent reductions in neuronal activity within the DAR attenuated the hypoxic ventilatory response (HVR) [52, 50, 49] but not cardiovascular responses to hypoxia [49], despite the fact that both cardiovascular and respiratory compartments of the ventrolateral medulla (VLM) are in receipt of NTS afferent inputs. This suggests that an AMPK-dependent, hypoxia-responsive subnucleus within the NTS preferentially facilitates respiratory function. Therefore, we sought to identify the precise location of this NTS subnucleus along the neuraxis of TH-AMPKα1/α2 knockout mice. To this end, we employed immunohistochemical strategies to investigate the expression of cFos as a surrogate for neuronal activation during hypoxia.

Consistent with previously reported outcomes in adult rabbits and rats [14, 15, 30], exposures to severe hypoxia (8% O₂) for 60 min resulted in significant increases in cFos expression within the NTS of control mice (Fig. 1A; p < 0.0001 for 8% O₂ versus 21% O₂) and TH-AMPK-α1/α2 knockouts (p < 0.05 for 8% O₂ versus 21% O₂). However, comparison of average counts (Fig. 1A) revealed no significant difference in the total number of cFos⁺ nuclei for THAMPK-α1/α2 knockouts when compared to controls (p = 0.336; 60 min, 8% O₂). Nevertheless, in AMPK-α1/α2 knockouts ventilatory responses to hypoxia (8% O₂) were attenuated relative to controls for 60 min, matching the time period used to analyse cFos expression in NTS neurons. Minute ventilation of THAMPKα1/α2 knockout mice (Fig. 1B) fell below normoxic values within 5min, continued to rapidly decrease until 15min (10-15min: -34.1 ± 2.4%, p < 0.001 compared to controls) and thereafter remained significantly attenuated relative to controls for 60min (p < 0.01 to p < 0.001). At 60min both breathing frequency (Fig. 1C) and tidal volume (Fig. 1D) were significantly depressed in THAMPKα1/α2 knockouts relative to AMPK-α1/α2 Floxed controls (p < 0.01 for breathing frequency and p < 0.001 for tidal volume).

We therefore compared by double-blind analysis, counts of cFos⁺ nuclei for each subnucleus of the NTS across all Bregma (-7.44mm to -7.6mm) that spanned the DAR identified by fMRI. Normalisation of cFos counts by surface area and section thickness ensured that differences in the size of subnuclei spanning multiple Bregma were accounted for. Moreover, to assess bilaterality, counts were analysed as the total number of cFos⁺ nuclei per 1000µm³ for both sides of the NTS combined, and by right and left subdivisions. That said, exceptions were made for the AP and SolC, which in rodents and lagomorphs are midline structures [8, 39] and were, therefore, only analysed as a whole.

Using this strategy, we identified a small number of rostral NTS subnuclei that displayed a significant and Bregma-specific reduction in hypoxia-induced cFos expression in TH-AMPK-α1/α2 knockouts relative to controls (Supplementary Fig. 1). Most notably, significant reductions in cFos expression of TH-AMPK-α1/α2 knockouts were identified within SolDL and SubP at Bregma − 7.48mm, and in each case this was observed on the right side of the brainstem (SolDL, p < 0.05; SubP, p < 0.05) but not the left, in accordance with both the observed right-side dominance and approximate anatomical location of the epicentre of the DAR identified by fMRI. Like most other NTS subnuclei, both SolDL and SubP have been proposed to innervate respiratory and cardiovascular compartments of the VLM. However, SolDL may primarily innervate compartments of the rostral VLM responsible for the modulation and/or generation of respiratory rhythmogenesis [21, 2, 78, 34], which could, at least in part, explain our finding that AMPK-α1/α2 deletion in catecholaminergic neurons selectively attenuates the HVR [52, 49].

As mentioned above, cFos expression in SolDL was significantly attenuated in THAMPK-α1/α2 knockouts relative to controls at Bregma − 7.48mm (p = 0.0154), but not in the next most caudal or rostral Bregma (Supplementary Fig. 2 Ai & Bi). By contrast, for SubP significant reductions in cFos expression were identified at Bregma − 7.48 (p = 0.0294) and − 7.56mm (p = 0.0355; (Supplementary Fig. 2 Aiv & Biv)), the latter of which sits along this neuraxis at the caudalmost limit of the DAR identified by fMRI (Bregma − 7.44mm to -7.6mm). Interestingly, combining the cFos⁺ counts of SubP across the three caudal-most Bregma of this neuraxis enhanced the degree of significance further (Bregma − 7.48mm to -7.56mm: p = 0.0178). A similar pattern emerged for SolDL, whereby the highest degree of significance was achieved by combining the two rostral Bregma − 7.44mm and − 7.48mm (p = 0.0113).

This presented a paradox, because SolDL and SubP are not connected anatomically. Therefore, we considered the possibility that SolDM may be involved, given that SolDM neurons may aid coordination of orofacial movements via the nucleus ambiguus [26]. We first examined cFos⁺ counts along the entire neuraxis of the murine SolDM, which spans a distance that ranges from Bregma − 7.44mm to -7.50mm [23] but identified no statistical differences for any of these Bregma individually when comparing THAMPKα1/α2 knockouts to controls (Supplementary Fig. 3Ai & Bi), nor when any of the adjacent Bregma were combined. Nevertheless, in order to thoroughly cross-compare all possible different combinations, we tested various models that included each SolDL, SolDM and SubP combination, starting with those that delivered the highest statistical difference for cFos⁺ counts in response to hypoxia (Fig. 3A & B). To our surprise this resulted in the highest degree of statistical significance observed yet (p = 0.0043). Furthermore, the addition of SubP at Bregma − 7.44mm to this model marginally strengthened rather than weakening the degree of significance (p = 0.0042). Therefore, it would appear that the combination of SolDL, SolDM, and SubP, all of which contribute to cardiorespiratory control during hypoxia (Supplementary Fig. 4), at Bregma − 7.44mm and an extension for SolDL across two (-7.44mm to -7.48mm) and SubP across four (-7.44mm to -7.56mm) Bregma in a caudal direction most likely corresponds to the nucleus that exhibits reduced hypoxiaevoked neuronal activation in THAMPKα1/α2 knockouts (Fig. 3C). Strikingly, both the anatomical location and rightside dominant bilateral asymmetry of this hypoxia-responsive nucleus, named here as SubSolHΙe, within the caudal brainstem identified by cFos expression is consistent with the anatomical range, location and right-side dominant bilateral asymmetry of the DAR identified by fMRI (Bregma − 7.1mm to -7.6mm). A deficit in cFos expression was also observed within the AP, but this was only apparent at Bregma − 7.56mm and did not extend further in either direction along the neuraxis of the DAR (Fig. 3A). That said a role for this segment of the AP should not be discounted lightly.

The aforementioned findings are all the more intriguing, because extended wholebrain analysis of our previously published fMRI data [52] identified further regions of interest (Supplementary Fig. 5) that lay both caudal and rostral to SubSolHΙe which exhibited significantly lower signal change (P < 0.005) during hypoxia in AMPKα1/α2 knockouts than in AMPK-α1/α2 floxed controls. These regions of interest correspond by location, caudal to rostral, to the nucleus retroambiguus [38], the rostral ventral respiratory column (e.g., Bötzinger complex, retrotrapezoid nucleus / parafacial respiratory group) [32,5,20,45], the lateral nucleus of the cerebellum [73,47,70], and all are in receipt of noradrenergic inputs from the NTS and contribute to respiratory pattern formation (see discussion for further details).

Adding to the above, significant reductions in cFos⁺ neurons were seen in other nuclei of THAMPK-α1/α2 knockouts (Fig. 3) that were either left-side dominant (Fig. 3B), or bilateral (Fig. 3C), not previously registered by fMRI and located too lateral or too ventral to comprise any part of the hypoxia-responsive subnucleus identified by fMRI. Briefly, bilateral reductions in cFos⁺ neurons were identified for 10N at Bregma − 7.44mm (p < 0.01 for both sides, p < 0.05 for the right and left sides alone). Left-sided bilateral asymmetry was observed for SolCe at Bregma − 7.44mm (p < 0.01 for the left side alone), and SolV at Bregma − 7.64mm (p < 0.05 for both sides, p < 0.01 for left side alone) and Bregma − 7.44mm (p < 0.05 for both sides and left side alone); however, deficits in cFos counts within SolV were not enhanced by any combination of Bregma along this neuraxis.

AMPK deletion in catecholaminergic cells inhibits active expiration and increases sigh frequency during hypoxia

Downstream of the NTS, hypoxia-evoked afferent input responses impact the parafacial nucleus which coordinates active expiration [33] and the retrotrapezoid nucleus/parafacial respiratory group which coordinates sighs [45]. Therefore, we next investigated the effect of AMPK-α1/α2 deletion on these distinct ventilatory activities.

Active expiration was significantly attenuated in TH-AMPK-α1/α2 knockouts relative to controls (Fig. 4A). During exposures to 8% O₂, the expiration time ratio of hypoxia:normoxia (Te) in AMPK-α1/α2 Floxed mice displayed a marked reduction 30s after the onset of hypoxia (0.5 ± 0.02). Thereafter, a lengthening of Te occurred until approximately 2min followed by a secondary minor decrease and plateau, measuring 0.8 ± 0.02 by 5min (p < 0.0001 compared to 30s) and 0.8 ± 0.03 by 10min (p < 0.0001 compared to 30s, not significant compared to 5min). Similarly, following a nadir at 30s (0.7 ± 0.03), the Te of TH-AMPK-α1/α2 knockouts lengthened over time, but unlike control mice the prolongation of expiration time plateaued close to normoxic values, measuring 1.1 ± 0.04 by 5min (p < 0.0001 compared to 30s) and 1 ± 0.04 by 10min (p < 0.05 compared to 5min). In short, TH-AMPK-α1/α2 knockouts failed to maintain accelerated active expiration and instead rapidly returned to and remained at Te values equivalent to those measured during normoxia, that were significantly lengthened compared to controls at both 5min (p < 0.0001) and 10min (p < 0.001). Therefore, active expiration was blocked by AMPK deletion in catecholaminergic cells.

Sigh frequency was also significantly attenuated in TH-AMPK-α1/α2 knockouts compared to controls (Fig. 4B) during both halves of 10min exposures to severe hypoxia (0-5min: p < 0.0001; 5-10min: p < 0.05). However, analyses at one-minute intervals revealed that although sigh frequencies were on average lower in THAMPKα1/α2 knockouts during every minute except the last, the difference only reached significance during the first 5min of exposures to 8% O₂ compared to AMPKα1/α2 Floxed mice (p < 0.05 to 0.0001).

AMPK deletion in catecholaminergic cells triggers oscillating apnoeic salvos during hypoxia

Consistent with previous observations [52], TH-AMPK-α1/α2 knockouts also exhibited a marked increase in apnoea frequency, apnoea duration and apnoea duration index compared to controls during the first 25min of exposures to hypoxia (Fig. 5A-C). Moreover, minuteby-minute analyses revealed periodic “apnoeic salvos” in THAMPKα1/α2 knockouts from 30-60min, which were characterised by timedependent phasic increases in the number of apnoeas, that occurred at a frequency of ~ 3–4 mHz and had a salvo duration of ~ 1min (Fig. 5A). These apnoeic salvos were present in each of the four THAMPKα1/α2 knockouts analysed (Supplementary Fig. 6). By contrast, AMPKα1/α2 Floxed mice maintained a steady apnoea frequency throughout 60min exposures to hypoxia. By contrast, there was dampened by a timedependent decline in apnoea duration in THAMPKα1/α2 knockouts to a level equivalent to controls (Fig. 5B) that dampened, as one might expect, oscillations in apnoea duration index (ADI) of THAMPKα1/α2 knockouts (Fig. 5C).

Attenuation of the HVR in mice by AMPK deletion in catecholaminergic cells is not compensated for by changes in whole-body metabolic rate

The fact that TH-AMPK-α1/α2 knockouts exhibit a torpor-like state during hypoxia [52] concomitant with the observed ventilatory depression is indicative of mice entering a hypometabolic state [28] rather than hypoventilation per se. We therefore sought to assess the metabolic responses of control AMPK-α1/α2 Floxed and TH-AMPK-α1/α2 knockouts during hypoxia. Metabolic rates during normoxia (21% O₂) were comparable between control AMPKα1/α2 Floxed and TH-AMPK-α1/α2 knockouts for both oxygen consumption (VO₂; Fig. 6Ai) and carbon dioxide production (VCO₂; Fig. 6Bi).

During 10min exposures to 8% O₂ (Fig. 6Aii & Bii), control AMPK-α1/α2 Floxed mice displayed a reduction in VO₂ relative to normoxia by 5min, which was maintained until the end of the exposure at 10min. Likewise, VCO₂ was reduced relative to normoxia in control mice by 5min and this reduction was maintained until 10min. Compared to this, the VO₂ of THAMPKα1/α2 knockouts displayed no significant differences relative to controls. Similarly, VCO₂ was slightly reduced but not significantly different compared to control mice.

Furthermore, O₂ consumption and CO₂ production were assessed during 5min exposures to graded hypoxia (5min each of 21% O₂, 18% O₂, 15% O₂, 12% O₂, 10% O₂, 8% O₂; Fig. 6Aiii & Biii). A progressive reduction in O₂ availability that lasted for a total of 25min also revealed no differences between control and THAMPKα1/α2 knockouts with respect to the gradual reductions of VO₂ and VCO₂, respectively.

Deletion of AMPK in catecholaminergic neurons does not alter brainstem catecholamine content

Finally, we sought to assess the bioavailability of catecholamines within the central nervous system at the sites targeted by conditional AMPK deletion in catecholaminergic neurons. Bioamine levels within the brainstems and spinal cords (Fig. 7) of control AMPKα1/α2 Floxed and THAMPKα1/α2 knockouts revealed no differences in catecholamine levels; namely noradrenaline, serotonin, the catecholamine precursor L-DOPA, or the serotonin metabolite 5hydroxyindoleacetic acid (5-HIAA).

Using cFos expression as a surrogate marker for neuronal activation, we have mapped a novel AMPK-dependent hypoxia-responsive subnucleus of the NTS, namely SubSolHΙe, which is in receipt of chemoafferent inputs from the carotid body [21]. AMPK deletion in catecholaminergic neurons selectively attenuated, with rightsided bilateral asymmetry, activation during hypoxia of this neuronal cluster, which partially spans three anatomical nuclei of the nucleus tractus solitarius (NTS), namely SolDL (Bregman − 7.44mm to -7.56mm), SolDM (Brema − 7.44mm) and SubP (Bregma − 7.4mm to -7.56mm), and perhaps also the area postrema (AP; at Bregma − 7.56mm). Strikingly, this approximates both the anatomical location and, with the exception of the AP which is a midline structure, the rightside dominant bilateral asymmetry observed for the AMPKdependent hypoxiaresponsive subnucleus of the NTS previously identified by fMRI [52]. These findings are all the more intriguing, because extended wholebrain fMRI analysis identified regions of interest during hypoxia that lay both rostral and caudal to the Dorsal Active Region (DAR) described previously[52], all of which exhibited significantly lower oxygen consumption (p < 0.005) during hypoxia in AMPKα1/α2 knockouts, namely, from caudal to rostral, the nucleus retroambiguus which provides ascending inputs critical to inspiratory rhythm generation [38], the rostral ventral respiratory column (e.g., Bötzinger complex, retrotrapezoid nucleus / parafacial respiratory group) which coordinates postinspiratory activity and active expiration [32,5,20,45], and the lateral nucleus of the cerebellum [73] which receives noradrenergic inputs from the NTS and contributes to eupnoeic breathing and orofacial rhythms [47,70]; accordingly, AMPK deletion in adrenergic neurons (PNMTCre) does not attenuate the HVR [50]. Therefore, it is also notable that in addition to afferent inputs from the NTS to the nucleus retroambiguus [26,38] contributing to the coordination of orofacial rhythms, neurons of both the SolDM and nucleus retroambiguus receive afferent inputs from the superior laryngeal nerve that contribute to both orofacial rhythms and the swallowing reflex [26,66].

We also identified significant attenuation of cFos expression in subsections of three other NTS nuclei, namely SolV, SolCe and 10N, the anatomical location of which was too lateral and/or ventral to comprise any part of the hypoxiaresponsive subnucleus identified by fMRI, and were perhaps too small to be revealed by this technique. This may be significant given that while AMPKα1/α2 deletion attenuated increases in sigh frequency, because a few carotid body chemoafferent terminals project to 10N [21], and hypoxia has been found to increase sigh frequency in a manner dependent on vagal in addition to carotid body chemoafferent activity [6]. The physiological significance of this being that sighs have been proposed to conserve residual lung volume by reinflating collapsed alveoli [77, 11, 45].

Supporting the above, our further analysis of ventilatory dysfunction demonstrated that AMPKα1/α2 deletion in catecholaminergic neurons blocked active expiration in addition to decreasing sigh frequency, and these two functions are coordinated by two discrete circuit mechanisms that lie downstream of the NTS, namely the parafacial nucleus [33] and the retrotrapezoid nucleus/parafacial respiratory group [45], respectively.

Importantly, we further demonstrated that AMPK-α1/α2 deletion in catecholaminergic neurons had no impact on metabolic rate and state relative to controls during acute 10min exposures to hypoxia (8% O₂) or graded increases in hypoxia severity over a 30min period (5min each of 21% O₂, 18% O₂, 15% O₂, 12% O₂, 10% O₂, 8% O₂). This confirms that THAMPK-α1/α2 knockouts enter frank hypoventilation during hypoxia relative to controls, despite the fact that THAMPK-α1/α2 knockouts also enter a torpor-like state during hypoxia [52], which is sometimes associated with mice entering a hypometabolic state [28] concomitant with the observed ventilatory depression.

Furthermore, no differences in brainstem or spinal catecholamines or serotonin levels were observed in TH-AMPKα1/α2 knockouts relative to controls, including therein noradrenaline, serotonin, the catecholamine precursor LDOPA, and the serotonin metabolite 5hydroxyindoleacetic acid (5-HIAA). Therefore, deletion of AMPKα1/α2 catalytic subunits in catecholaminergic neurons did not alter catecholamine dynamics or result in pronounced hyper- or hypoplasia of TH-positive cells. Thus, it is unlikely that the breathing irregularities, hypoventilation and apnoeas observed during hypoxia were consequent to aberrant catecholaminergic neurotransmission per se. Emergence of relative hypoventilation and apnoea during severe poikilocapnic hypoxia [52] therefore suggests that AMPK gain of function may represent a major maturational element underlying the central nervous system component of the shift from neonatal HVR to adult HVR patterning [27]. Such ventilatory dysfunction likely results from the failure of signal integration and relay of command outputs from the hypoxia-responsive NTS subnucleus identified here, namely SubSolHΙe, to the respiratory central pattern generators. This is most likely conferred by the loss of direct phosphorylation and regulation by AMPK of noncanonical targets such as ion channels [64,40,35,4,55,58,10], enzymes for transmitter biosynthesis [80], receptors [1], and transporters [67], the failure of AMPKdependent developmental expression of such targets and/or failure of maturational changes in related synaptic control mechanisms.

Strikingly, the integrated HVR of the TH-AMPKα1/α2 knockouts is highly reminiscent of HVRs observed in neonates [27], i.e., marked late hypoxic ventilatory depression culminating in apnoeic episodes, along with preservation of hypercapnic hypoxic ventilatory responses [52]. When considered alongside the emergence of apnoea during severe poikilocapnic hypoxia [52] this provides further support for the view that AMPK gain of function may represent a major maturational element underlying the central nervous system component of the shift from neonatal HVR to adult HVR patterning [27]. Conversely, AMPK deficiency might precipitate apnoea of prematurity, which contributes to cardiopulmonary arrest and respiratory failure in neonates [3, 56] (requiring longer-term intensive care) and SIDS [9], when apnoea of prematurity occurs in concert with cyclical tachypnoea and brief apnoea [56, 9]. Consistently, during prolonged hypoxia TH-AMPKα1/α2 knockouts exhibit periodic breathing with tachypnoea, separated by prolonged apnoeas (Supplementary Fig. 2). In accordance with this and the site of SubSolHΙe within the NTS, it has been highlighted that with respect to SIDS there is a critical gap in our knowledge regarding the integration and regulation of peripheral afferents and descending autonomic ventilatory control mechanisms at the NTS [3], where reduced chemoreceptor sensitivity and reduced CNS oxygenation [61] may contribute to dysregulation of respiratory rhythm and autoresuscitation failure [13,3,56]. This is all the more intriguing, because cellspecific AMPK deficiency accompanies obesity and type 2 diabetes [65, 25,76], which represent maternal stressors strongly associated with SIDS [37,71], and these stressors are also strongly associated with central sleep apnoea in adults [68, 74, 22, 54,63]. Moreover, under anaesthesia hypoxia triggers irreversible respiratory failure in THAMPKα1/α2 knockouts [52], a known risk factor for adult humans suffering from sleep apnoea [7,12].

Further studies on the AMPK-dependent hypoxia-responsive subnucleus of the NTS identified here, namely “SubSolHΙe”, are therefore required, so that we can address the formidable question [27]: "What role and by what mechanism does AMPK play in the adaptive and maladaptive respiratory responses elicited in the neonate and adult by the wide range of potential hypoxic stimulus presentations, i.e., intermittent, sustained, chronic, etc?".

Ethical Approval and Consent to participate: Ethical approval was given by the Ethics Committee, College of Medicine, University of Edinburgh.

Human and Animal Ethics: All experimental procedures were covered by UK Home Office Project Licence PBA4DCF9D.

Availability of supporting data: All available data are included in this manuscript

Competing interests: The Authors have no competing interests

Open Access: For the purpose of open access, the author has applied a Creative Commons Attribution (CC BY) licence to any Author Accepted Manuscript version arising from this submission

Funding: S.M. was supported by a University of Edinburgh PhD studentship and then by a BHF Programme Grant held by A.M.E. (RG/12/14/29885). This research was also funded, in part, by the Wellcome Trust (WT081195MA).

Author Contributions: A.M.E. conceived of this study. A.M.E. and S.M. designed the experimental plan and wrote this manuscript, made the Figures, developed the AMPK knockout mice, performed plethysmography and completed data acquisition and analysis. K.OH. provided detailed feedback on the manuscript. K.OH. and D.B. completed metabolic measurements and analysis, and bioamine measurement and analysis.

Acknowledgements: We are grateful to Dr Karen O’Connor who performed HPLC analyses in the laboratory of Professor Gerard Clarke, Department of Psychiatry and Neurobehavioural Science, UCC.

Author information: Sandy MacMillan, A. Mark Evans, Centre for Discovery Brain Sciences, Hugh Robson Building, University of Edinburgh, Edinburgh, EH8 9XD, UK. K.OH. and D.B., Department of Physiology, School of Medicine, College of Medicine & Health, University College Cork, Cork, Ireland.

Ahmadi M, Roy R (2016) AMPK acts as a molecular trigger to coordinate glutamatergic signals and adaptive behaviours during acute starvation. Elife 5:e16349. doi:10.7554/eLife.16349
Alheid GF, Jiao W, McCrimmon DR (2011) Caudal nuclei of the rat nucleus of the solitary tract differentially innervate respiratory compartments within the ventrolateral medulla. Neuroscience 190:207-227. doi:10.1016/j.neuroscience.2011.06.005
Altamirano AE, Wilson CG (2021) An overview of developmental dysregulation of autonomic control in infants. Birth Defects Res. doi:10.1002/bdr2.1855
Andersen MN, Skibsbye L, Tang C, Petersen F, MacAulay N, Rasmussen HB, Jespersen T (2015) PKC and AMPK regulation of Kv1.5 potassium channels. Channels 9:121-128. doi:10.1080/19336950.2015.1036205
Anderson TM, Garcia AJ, 3rd, Baertsch NA, Pollak J, Bloom JC, Wei AD, Rai KG, Ramirez JM (2016) A novel excitatory network for the control of breathing. Nature 536:76-80. doi:10.1038/nature18944
Bartlett D, Jr. (1971) Origin and regulation of spontaneous deep breaths. Respir Physiol 12:230-238. doi:10.1016/0034-5687(71)90055-7
Boushra NN (1996) Anaesthetic management of patients with sleep apnoea syndrome. Can J Anaesth 43:599-616. doi:10.1007/BF03011774
Brizzee KR, Klara PM (1984) The structure of the mammalian area postrema. Fed Proc 43:2944-2948
Byard RW (2018) The Autopsy and Pathology of Sudden Infant Death Syndrome. In: Duncan JR, Byard RW (eds) SIDS Sudden Infant and Early Childhood Death: The Past, the Present and the Future. Adelaide (AU),
Chang TJ, Chen WP, Yang C, Lu PH, Liang YC, Su MJ, Lee SC, Chuang LM (2009) Serine-385 phosphorylation of inwardly rectifying K+ channel subunit (Kir6.2) by AMP-dependent protein kinase plays a key role in rosiglitazone-induced closure of the K(ATP) channel and insulin secretion in rats. Diabetologia 52:1112-1121. doi:10.1007/s00125-009-1337-4
Chapuis C, Autran S, Fortin G, Simmers J, Thoby-Brisson M (2014) Emergence of sigh rhythmogenesis in the embryonic mouse. J Physiol 592:2169-2181. doi:10.1113/jphysiol.2013.268730
Eckert DJ, Jordan AS, Merchia P, Malhotra A (2007) Central sleep apnea: Pathophysiology and treatment. Chest 131:595-607. doi:131/2/595 [pii] 10.1378/chest.06.2287
Eichenwald EC, Committee on F, Newborn AAoP (2016) Apnea of Prematurity. Pediatrics 137. doi:10.1542/peds.2015-3757
Erickson JT, Millhorn DE (1991) Fos-like protein is induced in neurons of the medulla oblongata after stimulation of the carotid sinus nerve in awake and anesthetized rats. Brain Res 567:11-24. doi:0006-8993(91)91430-9 [pii]
Erickson JT, Millhorn DE (1994) Hypoxia and electrical stimulation of the carotid sinus nerve induce Fos-like immunoreactivity within catecholaminergic and serotoninergic neurons of the rat brainstem. J Comp Neurol 348:161-182. doi:10.1002/cne.903480202
Evans AM (2006) AMP-activated protein kinase and the regulation of Ca2+ signalling in O2-sensing cells. J Physiol 574:113-123
Evans AM (2019) AMPK breathing and oxygen supply. Respir Physiol Neurobiol 265:112-120. doi:10.1016/j.resp.2018.08.011
Evans AM, Hardie DG (2020) AMPK and the Need to Breathe and Feed: What's the Matter with Oxygen? Int J Mol Sci 21. doi:10.3390/ijms21103518
Evans AM, Mahmoud AD, Moral-Sanz J, Hartmann S (2016) The emerging role of AMPK in the regulation of breathing and oxygen supply. Biochem J 473:2561-2572. doi:10.1042/BCJ20160002
Feldman JL, Del Negro CA, Gray PA (2013) Understanding the rhythm of breathing: so near, yet so far. Annu Rev Physiol 75:423-452. doi:10.1146/annurev-physiol-040510-130049
Finley JC, Katz DM (1992) The central organization of carotid body afferent projections to the brainstem of the rat. Brain Res 572:108-116. doi:10.1016/0006-8993(92)90458-l
Foster GD, Sanders MH, Millman R, Zammit G, Borradaile KE, Newman AB, Wadden TA, Kelley D, Wing RR, Sunyer FX, Darcey V, Kuna ST, Sleep ARG (2009) Obstructive sleep apnea among obese patients with type 2 diabetes. Diabetes Care 32:1017-1019. doi:10.2337/dc08-1776
Franklin KBJ, Paxinos G (2019) The mouse brain in stereotaxic coordinates. Elsevier, Amsterdam ; London 5th Edition:1-376
Gauda EB, McLemore GL, Tolosa J, Marston-Nelson J, Kwak D (2004) Maturation of peripheral arterial chemoreceptors in relation to neonatal apnoea. Semin Neonatol 9:181-194. doi:10.1016/j.siny.2003.11.002
Gauthier MS, O'Brien EL, Bigornia S, Mott M, Cacicedo JM, Xu XJ, Gokce N, Apovian C, Ruderman N (2011) Decreased AMP-activated protein kinase activity is associated with increased inflammation in visceral adipose tissue and with whole-body insulin resistance in morbidly obese humans. Biochem Biophys Res Commun 404:382-387. doi:10.1016/j.bbrc.2010.11.127
Goyal RK, Padmanabhan R, Sang Q (2001) Neural circuits in swallowing and abdominal vagal afferent-mediated lower esophageal sphincter relaxation. Am J Med 111 Suppl 8A:95S-105S. doi:10.1016/s0002-9343(01)00863-4
Gozal D (2016) The Energy Crisis Revisited: AMP-activated Protein Kinase and the Mammalian Hypoxic Ventilatory Response. Am J Respir Crit Care Med 193:945-946. doi:10.1164/rccm.201512-2323ED
Guppy M, Withers P (1999) Metabolic depression in animals: physiological perspectives and biochemical generalizations. Biol Rev Camb Philos Soc 74:1-40. doi:10.1017/s0006323198005258
Hawley SA, Boudeau J, Reid JL, Mustard KJ, Udd L, Makela TP, Alessi DR, Hardie DG (2003) Complexes between the LKB1 tumor suppressor, STRAD alpha/beta and MO25 alpha/beta are upstream kinases in the AMP-activated protein kinase cascade. J Biol 2:28. doi:10.1186/1475-4924-2-28
Hirooka Y, Polson JW, Potts PD, Dampney RA (1997) Hypoxia-induced Fos expression in neurons projecting to the pressor region in the rostral ventrolateral medulla. Neuroscience 80:1209-1224
Holt MK (2022) The ins and outs of the caudal nucleus of the solitary tract: An overview of cellular populations and anatomical connections. J Neuroendocrinol 34:e13132. doi:10.1111/jne.13132
Huckstepp RT, Cardoza KP, Henderson LE, Feldman JL (2015) Role of parafacial nuclei in control of breathing in adult rats. J Neurosci 35:1052-1067. doi:10.1523/JNEUROSCI.2953-14.2015
Huckstepp RTR, Cardoza KP, Henderson LE, Feldman JL (2018) Distinct parafacial regions in control of breathing in adult rats. PLoS One 13:e0201485. doi:10.1371/journal.pone.0201485
Huff A, Karlen-Amarante M, Oliveira LM, Ramirez JM (2023) Postinspiratory complex acts as a gating mechanism regulating swallow-breathing coordination and other laryngeal behaviors. bioRxiv. doi:10.1101/2023.01.18.524513
Ikematsu N, Dallas ML, Ross FA, Lewis RW, Rafferty JN, David JA, Suman R, Peers C, Hardie DG, Evans AM (2011) Phosphorylation of the voltage-gated potassium channel Kv2.1 by AMP-activated protein kinase regulates membrane excitability. Proc Natl Acad Sci U S A 108:18132-18137. doi:10.1073/pnas.1106201108
Iturriaga R, Alcayaga J, Chapleau MW, Somers VK (2021) Carotid body chemoreceptors: physiology, pathology, and implications for health and disease. Physiol Rev 101:1177-1235. doi:10.1152/physrev.00039.2019
Johansson S, Villamor E, Altman M, Bonamy AK, Granath F, Cnattingius S (2014) Maternal overweight and obesity in early pregnancy and risk of infant mortality: a population based cohort study in Sweden. BMJ 349:g6572. doi:10.1136/bmj.g6572
Jones SE, Saad M, Lewis DI, Subramanian HH, Dutschmann M (2012) The nucleus retroambiguus as possible site for inspiratory rhythm generation caudal to obex. Respir Physiol Neurobiol 180:305-310. doi:10.1016/j.resp.2011.12.007
KBJ F, G P (2008) The mouse brain in stereotaxic coordinates. (Elsevier, Amsterdam ; London, ed 3rd, 2008) pp. xxviii
Klein H, Garneau L, Trinh NT, Prive A, Dionne F, Goupil E, Thuringer D, Parent L, Brochiero E, Sauve R (2009) Inhibition of the KCa3.1 channels by AMP-activated protein kinase in human airway epithelial cells. Am J Physiol Cell Physiol 296:C285-295. doi:10.1152/ajpcell.00418.2008
Kubin L, Alheid GF, Zuperku EJ, McCrimmon DR (2006) Central pathways of pulmonary and lower airway vagal afferents. J Appl Physiol (1985) 101:618-627. doi:10.1152/japplphysiol.00252.2006
Kumar P, Prabhakar NR (2012) Peripheral chemoreceptors: function and plasticity of the carotid body. Compr Physiol 2:141-219. doi:10.1002/cphy.c100069
Lantier L, Fentz J, Mounier R, Leclerc J, Treebak JT, Pehmoller C, Sanz N, Sakakibara I, Saint-Amand E, Rimbaud S, Maire P, Marette A, Ventura-Clapier R, Ferry A, Wojtaszewski JF, Foretz M, Viollet B (2014) AMPK controls exercise endurance, mitochondrial oxidative capacity, and skeletal muscle integrity. FASEB J 28:3211-3224. doi:10.1096/fj.14-250449
Li M, Zhang CS, Feng JW, Wei X, Zhang C, Xie C, Wu Y, Hawley SA, Atrih A, Lamont DJ, Wang Z, Piao HL, Hardie DG, Lin SC (2020) Aldolase is a sensor for both low and high glucose, linking to AMPK and mTORC1. Cell Res. doi:10.1038/s41422-020-00456-8
Li P, Janczewski WA, Yackle K, Kam K, Pagliardini S, Krasnow MA, Feldman JL (2016) The peptidergic control circuit for sighing. Nature 530:293-297. doi:10.1038/nature16964
Lindeberg J, Usoskin D, Bengtsson H, Gustafsson A, Kylberg A, Soderstrom S, Ebendal T (2004) Transgenic expression of Cre recombinase from the tyrosine hydroxylase locus. Genesis 40:67-73. doi:10.1002/gene.20065
Liu Y, Qi S, Thomas F, Correia BL, Taylor AP, Sillitoe RV, Heck DH (2020) Loss of cerebellar function selectively affects intrinsic rhythmicity of eupneic breathing. Biol Open 9. doi:10.1242/bio.048785
Lucking EF, O'Connor KM, Strain CR, Fouhy F, Bastiaanssen TFS, Burns DP, Golubeva AV, Stanton C, Clarke G, Cryan JF, O'Halloran KD (2018) Chronic intermittent hypoxia disrupts cardiorespiratory homeostasis and gut microbiota composition in adult male guinea-pigs. EBioMedicine 38:191-205. doi:10.1016/j.ebiom.2018.11.010
MacMillan S, Evans AM (2018) AMPK-alpha1 or AMPK-alpha2 Deletion in Smooth Muscles Does Not Affect the Hypoxic Ventilatory Response or Systemic Arterial Blood Pressure Regulation During Hypoxia. Front Physiol 9:655. doi:10.3389/fphys.2018.00655
MacMillan S, Evans AM (2022) AMPK facilitates the hypoxic ventilatory response through non-adrenergic mechanisms at the brainstem. Pflugers Arch. doi:10.1007/s00424-022-02713-8
MacMillan S, Holmes AP, Dallas ML, Mahmoud AD, Shipston MJ, Peers C, Hardie DG, Kumar P, Evans AM (2022) LKB1 is the gatekeeper of carotid body chemosensing and the hypoxic ventilatory response. Commun Biol 5:642. doi:10.1038/s42003-022-03583-7
Mahmoud AD, Lewis S, Juricic L, Udoh UA, Hartmann S, Jansen MA, Ogunbayo OA, Puggioni P, Holmes AP, Kumar P, Navarro-Dorado J, Foretz M, Viollet B, Dutia MB, Marshall I, Evans AM (2016) AMP-activated Protein Kinase Deficiency Blocks the Hypoxic Ventilatory Response and Thus Precipitates Hypoventilation and Apnea. Am J Respir Crit Care Med 193:1032-1043. doi:10.1164/rccm.201508-1667OC
Mendelowitz D, Yang M, Andresen MC, Kunze DL (1992) Localization and retention in vitro of fluorescently labeled aortic baroreceptor terminals on neurons from the nucleus tractus solitarius. Brain Res 581:339-343. doi:10.1016/0006-8993(92)90729-s
Meslier N, Gagnadoux F, Giraud P, Person C, Ouksel H, Urban T, Racineux JL (2003) Impaired glucose-insulin metabolism in males with obstructive sleep apnoea syndrome. Eur Respir J 22:156-160
Mia S, Munoz C, Pakladok T, Siraskar G, Voelkl J, Alesutan I, Lang F (2012) Downregulation of Kv1.5 K channels by the AMP-activated protein kinase. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 30:1039-1050. doi:10.1159/000341480
Mohr MA, Fairchild KD, Patel M, Sinkin RA, Clark MT, Moorman JR, Lake DE, Kattwinkel J, Delos JB (2015) Quantification of periodic breathing in premature infants. Physiol Meas 36:1415-1427. doi:10.1088/0967-3334/36/7/1415
Moral-Sanz J, Lewis SA, MacMillan S, Meloni M, McClafferty H, Viollet B, Foretz M, Del-Pozo J, Mark Evans A (2022) AMPK deficiency in smooth muscles causes persistent pulmonary hypertension of the new-born and premature death. Nat Commun 13:5034. doi:10.1038/s41467-022-32568-7
Moral-Sanz J, Mahmoud AD, Ross FA, Eldstrom J, Fedida D, Hardie DG, Evans AM (2016) AMP-activated protein kinase inhibits Kv 1.5 channel currents of pulmonary arterial myocytes in response to hypoxia and inhibition of mitochondrial oxidative phosphorylation. J Physiol 594:4901-4915. doi:10.1113/JP272032
O'Connor KM, Lucking EF, Golubeva AV, Strain CR, Fouhy F, Cenit MC, Dhaliwal P, Bastiaanssen TFS, Burns DP, Stanton C, Clarke G, Cryan JF, O'Halloran KD (2019) Manipulation of gut microbiota blunts the ventilatory response to hypercapnia in adult rats. EBioMedicine 44:618-638. doi:10.1016/j.ebiom.2019.03.029
O'Halloran KD (2016) Chronic intermittent hypoxia creates the perfect storm with calamitous consequences for respiratory control. Respir Physiol Neurobiol 226:63-67. doi:10.1016/j.resp.2015.10.013
Patel M, Mohr M, Lake D, Delos J, Moorman JR, Sinkin RA, Kattwinkel J, Fairchild K (2016) Clinical associations with immature breathing in preterm infants: part 2-periodic breathing. Pediatr Res 80:28-34. doi:10.1038/pr.2016.58
Pinkosky SL, Scott JW, Desjardins EM, Smith BK, Day EA, Ford RJ, Langendorf CG, Ling NXY, Nero TL, Loh K, Galic S, Hoque A, Smiles WJ, Ngoei KRW, Parker MW, Yan Y, Melcher K, Kemp BE, Oakhill JS, Steinberg GR (2020) Long-chain fatty acyl-CoA esters regulate metabolism via allosteric control of AMPK beta1 isoforms. Nat Metab 2:873-881. doi:10.1038/s42255-020-0245-2
Reichmuth KJ, Austin D, Skatrud JB, Young T (2005) Association of sleep apnea and type II diabetes: a population-based study. Am J Respir Crit Care Med 172:1590-1595. doi:10.1164/rccm.200504-637OC
Ross FA, Rafferty JN, Dallas ML, Ogunbayo O, Ikematsu N, McClafferty H, Tian L, Widmer H, Rowe IC, Wyatt CN, Shipston MJ, Peers C, Hardie DG, Evans AM (2011) Selective Expression in Carotid Body Type I Cells of a Single Splice Variant of the Large Conductance Calcium- and Voltage-activated Potassium Channel Confers Regulation by AMP-activated Protein Kinase. J Biol Chem 286:11929-11936. doi:M110.189779 [pii] 10.1074/jbc.M110.189779
Ruderman NB, Carling D, Prentki M, Cacicedo JM (2013) AMPK, insulin resistance, and the metabolic syndrome. J Clin Invest 123:2764-2772. doi:67227 [pii] 10.1172/JCI67227
Sang Q, Goyal RK (2001) Swallowing reflex and brain stem neurons activated by superior laryngeal nerve stimulation in the mouse. Am J Physiol Gastrointest Liver Physiol 280:G191-200. doi:10.1152/ajpgi.2001.280.2.G191
Schneider H, Schubert KM, Blodow S, Kreutz CP, Erdogmus S, Wiedenmann M, Qiu J, Fey T, Ruth P, Lubomirov LT, Pfitzer G, Mederos YSM, Hardie DG, Gudermann T, Pohl U (2015) AMPK Dilates Resistance Arteries via Activation of SERCA and BKCa Channels in Smooth Muscle. Hypertension 66:108-116. doi:10.1161/HYPERTENSIONAHA.115.05514
Schober AK, Neurath MF, Harsch IA (2011) Prevalence of sleep apnoea in diabetic patients. Clin Respir J 5:165-172. doi:10.1111/j.1752-699X.2010.00216.x
Steinberg GR, Hardie DG (2022) New insights into activation and function of the AMPK. Nat Rev Mol Cell Biol. doi:10.1038/s41580-022-00547-x
Taylor AP, Lee AS, Goedecke PJ, Tolley EA, Joyner AL, Heck DH (2022) Conditional loss of Engrailed1/2 in Atoh1-derived excitatory cerebellar nuclear neurons impairs eupneic respiration in mice. Genes Brain Behav 21:e12788. doi:10.1111/gbb.12788
Tennant PW, Glinianaia SV, Bilous RW, Rankin J, Bell R (2014) Pre-existing diabetes, maternal glycated haemoglobin, and the risks of fetal and infant death: a population-based study. Diabetologia 57:285-294. doi:10.1007/s00125-013-3108-5
Teppema LJ, Dahan A (2010) The ventilatory response to hypoxia in mammals: mechanisms, measurement, and analysis. Physiol Rev 90:675-754. doi:10.1152/physrev.00012.2009
Triarhou LC, Manto M (2022) The Discovery of the Monoaminergic Innervation of the Cerebellum: Convergence of Divergent and Point-to-Point Systems. Cerebellum. doi:10.1007/s12311-022-01480-7
West SD, Nicoll DJ, Stradling JR (2006) Prevalence of obstructive sleep apnoea in men with type 2 diabetes. Thorax 61:945-950. doi:10.1136/thx.2005.057745
Woods A, Dickerson K, Heath R, Hong SP, Momcilovic M, Johnstone SR, Carlson M, Carling D (2005) Ca2+/calmodulin-dependent protein kinase kinase-beta acts upstream of AMP-activated protein kinase in mammalian cells. Cell Metab 2:21-33. doi:10.1016/j.cmet.2005.06.005
Xu XJ, Gauthier MS, Hess DT, Apovian CM, Cacicedo JM, Gokce N, Farb M, Valentine RJ, Ruderman NB (2012) Insulin sensitive and resistant obesity in humans: AMPK activity, oxidative stress, and depot-specific changes in gene expression in adipose tissue. J Lipid Res 53:792-801. doi:10.1194/jlr.P022905
Yamauchi M, Ocak H, Dostal J, Jacono FJ, Loparo KA, Strohl KP (2008) Post-sigh breathing behavior and spontaneous pauses in the C57BL/6J (B6) mouse. Respir Physiol Neurobiol 162:117-125. doi:10.1016/j.resp.2008.05.003
Yang CF, Kim EJ, Callaway EM, Feldman JL (2020) Monosynaptic Projections to Excitatory and Inhibitory preBotzinger Complex Neurons. Front Neuroanat 14:58. doi:10.3389/fnana.2020.00058
Zhang CS, Hawley SA, Zong Y, Li M, Wang Z, Gray A, Ma T, Cui J, Feng JW, Zhu M, Wu YQ, Li TY, Ye Z, Lin SY, Yin H, Piao HL, Hardie DG, Lin SC (2017) Fructose-1,6-bisphosphate and aldolase mediate glucose sensing by AMPK. Nature 548:112-116. doi:10.1038/nature23275
Zhang J, Dong J, Martin M, He M, Gongol B, Marin TL, Chen L, Shi X, Yin Y, Shang F, Wu Y, Huang HY, Zhang J, Zhang Y, Kang J, Moya EA, Huang HD, Powell FL, Chen Z, Thistlethwaite PA, Yuan ZY, Shyy JY (2018) AMPK Phosphorylation of ACE2 in Endothelium Mitigates Pulmonary Hypertension. Am J Respir Crit Care Med. doi:10.1164/rccm.201712-2570OC

No competing interests reported.

MacMIllanetal2023submitPflugersSupplementaryMaterials.pdf

Download PDF

Editorial decision: Revision requested
13 Jan, 2024
Reviews received at journal
24 Dec, 2023
Reviewers agreed at journal
16 Dec, 2023
Reviewers invited by journal
16 Dec, 2023
Submission checks completed at journal
14 Dec, 2023
Editor assigned by journal
14 Dec, 2023
First submitted to journal
13 Dec, 2023

You are reading this latest preprint version

An AMPK-dependent hypoxia-responsive subnucleus of the nucleus tractus solitarius coordinates the hypoxic ventilatory response and protects against apneoa in mice

Status:

Version 1

Abstract

Figures

Introduction

Methods

Statistical analysis

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1