2.1 Materials and reagents
The following list of reagents was mainly utilized in this study: 4-vinylcyclohexene diepoxide (Sigma, USA); herbs (Beijing Tong Ren Tang, China); DMEM medium (Gibco, USA); D-hanks solution (AQ, China); FBS (Gibco, USA); FSHR (Bioss, China); IgG (ZSZSGBBIO, China); 4% polyformaldehyde (KeyGEN Biotech, China); E2 (BAYER, Germany); FSH, E2, AMH enzyme-linked immunosorbent test kit (Elabscience, China); Seahorse Xfe 24 kit (Alicelligent, China); ATP test kit (Beyotime, China); TRIzol (Vazyme, China); RIPA (Beyotime, China); PVDF, ECL (Millipore, USA); CX43 (Servicebio, China); HIF1α(Affinity, USA); PEK, HK1(Proteintech, USA); LDH (WANLEIBIO, China); GAPDH (CST, USA)
2.2 Preparation of YLZ and drug-containing serum
YLZ herbs were weighed as the Table1. Ten times the amount of distilled water was added, followed by 30 min of soaking, 45 min of boiling, filtering, and second boil with 8 times the amount of distilled water, RS was boiled 1 hour separately, filtering, the three solutions were finally mixed and stored at -20℃after it cooled naturally. Mixing the estradiol valerate tablets and distilled water into suspension completely, and stored. After one week of adaptive feeding, thirty female SD rats (300 + 50g, purchased from Beijing WTLH, China, Experimental Animal Use License No. SCXK (Beijing) 2021-0011) Approval Number of Animal Ethics Committee of Capital Medical University: AEEI-2021-131) were randomly divided into 3 groups (n = 10/ group) : normal serum group (given the same volume of distilled water as YLZ), YLZ serum group (10.08g/kg, twice a day) and estradiol serum group (0.1008mg/kg, twice a day). All drugs were administered intragastric 5 days. The doses of YLZ and estradiol valerate tablets were converted from clinical human doses to rat doses and combined with our findings from earlier studies. One hour after the last gavage, the rats were anesthetized with isoflurane, blood was collected from the rat's abdominal aorta and centrifuged at 4℃ and 3000rpm for 15 min. The complement was inactivated (56℃, 30 minutes) and bacteria were removed through a 0.22µm filtration membrane, then stored at -80℃ for subsequent experiments.
2.3 UHPLC-QE-MS analysis of YLZ and its drug-containing serum
The composition of YLZ and its drug-containing serum were analyzed as follows: 3ml sample of three independently decocted YLZ was thawed on ice. After 30s vortex, the dection were centrifuged at 12000rpm (RCF = 13800 (×g), R = 8.6 cm) for 15 min at 4℃. 300µL of supernatant was transferred to a fresh tube and 1000µL of extracted solution containing 10µg/mL of internal standard was added, then the samples were sonicated for 5 min in ice-water bath. After placing 1 h in -40℃, the samples were centrifuged at 12000rpm (RCF = 13800 (×g), R = 8.6 cm)for 15 min at 4℃. The supernatant was carefully filtered through a 0.22µm microporous membrane, then take 200µL from each sample and pooling as QC samples. Store at -80℃ until the UHPLC- MS analysis.
400µL of three independent blank serum and YLZ-containing serum samples were added to 40µL of hydrochloric acid(2mol/L), then the mixture was vortexed for 1 min and followed by incubated for 15 min at 4℃. The vortex and incubat cycle was repeated for 4 times.Add 1.6 mL acetonitrile, then the mixture was vortexed for 5 min and the samples were centrifuged at 12000rpm (RCF = 13800 (×g), R = 8.6 cm) for 5 min at 4℃. 1800µL of supernatant was transferred to a fresh tube and nitrogen dried. The dried samples were reconstituted in 150µL of 80% methyl alcohol containing 10µg/mL of internal standard by vortex for 5 min. The constitution was then centrifuged at 12000 rpm (RCF = 13800 (×g), R = 8.6 cm) for 5 min at 4℃, and 120µL of supernatant was transferred to a fresh glass vial for LC/MS analysis.
LC-MS/MS analysis was performed on an UHPLC system (Vanquish, Thermo Fisher Scientific) with a Waters UPLC BEH C18 column (1.7 µm 2.1*100 mm).The elution condition of the mobile phase (A: water; B: acetonitrile) was as Table 2. An Orbitrap Exploris 120 mass spectrometer coupled with an Xcalibur software was employed to obtain the MS and MS/MS data based on the IDA acquisition mode. During each acquisition cycle, the mass range was from 100 to 1500, and the top four of every cycle were screened and the corresponding MS/MS data were further acquired. Sheath gas flow rate: 30 Arb, Aux gas flow rate: 10 Arb, Ion Transfer Tube Temp: 350 ℃, Vaporizer Temp: 350 ℃, Full ms resolution: 60000, MS/MS resolution: 15000, Collision energy: 16/32/48 in NCE mode, Spray Voltage: 5.5 kV (positive) or -4 kV (negative) .
Table 2
The elution condition of the mobile phase (A: water; B: acetonitrile)
Time/min | flow rate(µL/min) | Phase A% (water) | Phase B%(Acetonitrile) |
0 | 40 | 95 | 5 |
3.5 | 40 | 85 | 15 |
6 | 40 | 70 | 30 |
6.5 | 40 | 70 | 30 |
12 | 40 | 30 | 70 |
12.5 | 40 | 30 | 70 |
18 | 40 | 0 | 100 |
22 | 40 | 0 | 100 |
25 | 40 | 0 | 100 |
26 | 40 | 95 | 5 |
30 | 40 | 95 | 5 |
2.4 Animals and experimental protocol
In vitro experiments, twenty-four 8-9-week-old SPF-grade Sprague-Dawley female rats (Beijing WTLH,China, SCXK (Beijing) 2021-0011) were housed at the animal experiments building of Capital Medicine University. The environment conditions were natural light, temperature 22 + 2℃, and the humidity 65 + 5%. The whole rats had free space with enough water and feed. The animal experimental protocol was approved by the Animal Ethics Committee of Capital Medical University (NO.AEEI-2021-131). After seven days of acclimation culture, rats were divided into four groups: Control group, VCD model group (80mg/kg), Estradiol valerate group(0.1008mg/kg), YLZ medium dose group༈10.08g/kg༉, All groups except the control group were injected intraperitoneally with VCD for fifth days; the control group was replaced with equal volume of saline. Meanwhile, the YLZ and E2 groups were gavaged with their corresponding drugs for 6 weeks; the control and VCD groups were gavaged with the same volume of saline.
2.4 Estrous cycle monitoring
Vaginal smears were made at 9 a.m. each day for 15 days in the process of model building. Small cotton swabs were soaked in saline, inserted into the vagina of rat approximately 5 mm, rotated clockwise 6 times, then rolled and smeared on a clean slide. After the slide was naturally air-dried, stained with Swiss Giemsa staining solution for approximately 5–10 min, rinsed with water and observed under an ordinary optical microscope.
2.5 Enzyme-Linked Immunosorbent Assay (ELISA)
The serum was determined using ELISA kits for the level of FSH, E2 and AMH, following the kit instructions.
2.6 Hematoxylin and eosin (HE) staining
The ovaries were isolated and fixed in 4% polyformaldehyde for 48h and then were processed for paraffin embedding and sectioning. Serial sections of 4µm thickness were cut with a Leica RM2016 rotator microtome. The sections were dewaxed with xylene,rehydrated with graded concentrations of ethanol and then stained with hematoxylin and eosin and observed via light microscopy.
2.7 Tissue immunofluorescence
Put the slices in 3 changes of xylene, 10min each, then dehydrate in 3 changes of pure ethanol for 5min each, wash in distilled water. After repairing antigen was completed, it is naturally cooled. Put the slides 5min PBS(PH7.4) and shake it odecoloring shaker for 3 times, each time for 5 minutes. Adding 3% BSA into the tissue and cover it evenly to block, non-specific binding at room temperature for 30 minutes.(The primary antibody is blocked with 10% donkey serum from goat, and the primary antibody from other sources is blocked with 3% BSA). Adding primary antibody and secondary antibody. The DAPI solution was dripped into the tissue and incubated at room temperature for 10min in the dark. Add autofluorescence quencher B solution for 5min and rinse with running water for 10min. The Anti-fluorescence quenching was used to seal slides, and collecting images by Fluorescent Microscopy.
2.8 Primary ovarian GCs culture
Female SD rats (21–25 days old, 50 ± 5g) were subcutaneously injected with pregnant mare serum gonadotropin (PMSG) 50IU and were sacrificed 48h later. Removed ovaries were washed immediately with D-Hanks and placed in DMEM medium. GCs were harvested in the medium by 1ml needle puncture of ovarian follicles and then purified by filtration with 40µm disposable cell filter mesh. After the centrifugation at 1000×g for 5min, the cells were resuspended in medium and counted in a hemocytometer. The cells were seeded in T25 cell culture bottle and cultured in DMEM medium supplemented with 10% FBS and 1% green streptomycin mixture at 37 ℃ and 5% CO2 for 48h to allow the cells to attach. Cells of logarithmic growth stage were taken and divided into control group, model group (0.5 mM VCD), estradiol group (0.5 mM VCD + 5% E2 containing serum), YLZ group (0.5 mM VCD + 5% YLZ containing serum), HIF1αinhabition group (0.5 mM VCD + 0.5µM echinomycin (Echi)), HIF1αinhabition + YLZ group (0.5 mM VCD + 0.5µM Echi + 5% YLZ containing serum)
2.9 Identification of primary ovarian GCs
Cell immunofluorescence identified the primary ovarian GCs. Cells were inoculated in a 24-well plate with cell patch, After cells had grown to 60% confluence, slides were washed with PBS, fixed in 4% paraformaldehyde and then permeabilized with 0.5% TritonX, incubated with FSHR overnight, incubated with IgG the next day, dried and mounted, finally, observed and captured picture under a fluorescence microscope
2.10 Cell proliferation viability determination
CCK-8 assay measured the cell proliferation viability. After cells successfully attached, E2 and YLZ group were given drugs respectively for 24h, 48h, 72h, At the end of culture, cells of E2 group and YLZ group in 96-well plates were incubated in 100µL DMEM supplemented with 10 µL CCK-8 reagent for 2.5h at 37℃ and 5% CO2 incubator.The optical density (OD) value of each well was measured at a wavelength of 450 nm by a multiscan spectrum. The cell proliferation viability = (the OD value of the test group well -the mean OD value of the blank group)/(the OD value of the negative control group well-the mean OD value of the blank group). Each group was established in four wells.
2.11 ATP level detection
ATP level detection by the chemiluminescence ATP assay kit, according to the manufacturer’s recommendations.
2.12 Cell energy metabolism determination by Seahorse XFe24
The glycolytic metabolic rate were measured an seahorse XFe24 ennergy Analyzer(Seahorse Bioscience, USA).5×104 cells were seeded in XFe24 culture microplate(Alicelligent,China),and detection of the ECAR and OCR value according to the operating instructions.
2.13 RT-qPCR
The mRNA expression of HIF1α, Cx43, LDH, HK1, PEK were detected by RT-qPCR. Granulosa cells were cultured in 6-well plates, Extraction of total RNA was performed with TRIzol reagent after the end of cell intervention in each group.And then the RNA were further reverse-transcribed into cDNA. The following conditions were used for reverse transcription: 42 ℃ for 15 min, 85 ℃ for 5 s, cooling to 4℃ for 5 min, and refrigeration at -20 ℃. The reverse transcription reaction mixture was added to the tubes used for real time fluorescence quantitative reaction, and the amplification reaction system were as follows: pre-denaturation at 95 ℃ for 10 min, followed by 40 cycles (95 ℃ for 5 s and 60 ℃ for 60 s). The reaction results were analysed by by the relative fold change using the 2 −△△CT method. Table 3 shows the primer sequences used for real time fluorescence quantitative reaction of the genes. GAPDH was used as the internal reference gene.
Table 3
Gene | Forward primer | Reverse primer |
Rat Cx43 | TCTATGGGTTCAGCTTGAGCG | AGATGGTTTTCTCCGTGGGAC |
Rat HIF1α | TCGAAGTAGTGCTGATCCTGC | GAAGGACTTGCTGGCTGATCT |
Rat HK1 | TGGCCTATTACTTCACCGAGC | CGCATGGCGTACAGATACTTG |
Rat LDH | TTCATCCACTGAGCTGTCACG | ATTCACACCACTCCACACAGG |
Rat PEK | TCGGATACGGCATTTGGCTT | CGTCTTCCACGGTCACTTCG |
Rat GAPDH | TGTTCTAGAGACAGCCGCAT | AAATCCGTTCACACCGACCT |
2.14 Western blot analysis
The protein expression levels of HIF1α, Cx43, LDH, HK1, PEK were detected by Western blot. In brief, RIPA lysate and protease inhibitor were added to the cells of each group, centrifuged at 4°, 12000rpm for 15min, and the supernatant was obtained. The protein concentration was determined according to the instructions of the BCA protein quantitative kit. The total protein was separated by 10% SDS-PAGE and transferred to a polyvinylidence difluoride (PVDF) membrane on ice. And then, the membrane were blocked with 5% skim milk at room temperature for 2h. The primary antibody was added and incubated over-night at 4℃ and the horseradish peroxidase (HRP) conjugated goat anti-rabbit IgG antibody for 1h at room temperature. The membranes were exposured with ECL. The relative optical density was assessed by ImageJ software.
2.15 Statistical analysis
Data of the study were showed as mean + standard deviation (SD), and data were analyzed by SPSS 19.0. One-way ANOVA were used to analyze statistical differences between different groups. P < 0.05 was identified a statistically significant difference.