Diversity of Endo and Exo-Bacteria Associated With Fungi Isolated From Plant Rhizospheres: A Pilot Study

doi:10.21203/rs.3.rs-376398/v1

Download PDF

Research article

Diversity of Endo and Exo-Bacteria Associated With Fungi Isolated From Plant Rhizospheres: A Pilot Study

https://doi.org/10.21203/rs.3.rs-376398/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Over the past several years, the scientific community has described the diversity of microbial communities in a variety of soils associated with plants, but at present, little is known about the specific diversity of the soil fungal microbiome involving bacteria colonizing the surface of fungi (i.e., exo-bacteria) or existing within fungal hypha (i.e., endobacteria). This study aimed to collect, identify, and characterize several fungi and their associated (endo- and exo-) microbiome obtained from the rhizosphere of six different plants. Microcosm devices called fungal highway columns, containing one of four plant-based media as attractants, were placed in the rhizosphere of six different plants. The isolated fungi and their associated endo- and exo- bacteria were identified by sequencing of the ITS (fungi) or 16S (bacteria) rRNA regions, followed by Scanning Electron Microscope (SEM), and fluorescence in situ hybridization (FISH) imaging.

Results: Most of the fungi recovered are known plant pathogens, such as Fusarium, Pleosporales, and Cladosporium together with species associated with the soil, e.g. Kalmusia. The exo-bacteria recovered were previously described as plant promoters, such as Bacillus, Rhizobium, Acinetobacter or Ensifer. The interactions between fungi and exo-bacteria recovered from fungal highway columns were further investigated via confrontation assays. From the reconstruction of the potential co-occurring bacterial-fungal associations in the rhizosphere, we discovered that the most promiscuous exo-bacterium group (associated with diverse fungi) was Bacillus. From the study of the endobacterial community, emerged a core of shared endosymbionts with a potential implication in the nitrogen cycle.

Conclusions: The present study demonstrated the importance of selecting and studying cultivable fungi and bacteria from the rhizosphere. Our findings demonstrated that at the rhizosphere level, the range of interactions between fungi and bacteria, both internal and external to the fungal hypha, could vary even among closely related species.

General Microbiology

fungal highways

endo-bacteria

exo-bacteria

fungal microbiome

The effects of plant symbiotic relationships with fungi or bacteria have been studied and reported in countless ecosystems [1–10]. Symbiotic relationships between plants and microorganisms have been shown to be able to reduce the use of chemical fertilizers [11, 12], increase plant resistance to abiotic stress, such as salinity and drought [13–15], and increase plant defenses against harmful microorganisms [16]. Furthermore, the establishment of a positive microbial community in the rhizosphere could also increase plant growth due to the reduction of N₂ to ammonia (NH₃) [11, 17, 18] and enhance plant absorption of phosphate since organic acids produced by microorganisms can solubilize inorganic phosphate [19–22]. However, most of these studies analyzed individual plant-fungi or plant-bacteria interactions [23]. Considering the complexity of soil ecosystems, these studies provide only a partial understanding of the role of microbes in the soil and plants. The microbial interactions should, in fact, be viewed in a more integrated manner and take into consideration the complex microbial networks in the soil. For instance, the rhizosphere is a highly diverse ecosystem, where complex interactions between different species, e.g. plant, fungi, and bacteria, create unique networks and niches in soils [24].

The experimental proof of the intimate relationships of bacterial-fungal interactions inside or outside the fungal hyphae originated in the early '70s [25–29]. However, a quarter century later, Garbaye was the first to postulate the importance of bacterial-fungal interactions with plants in soil ecosystems [30]. Following this investigation, other studies found that the presence of fungal-bacterial associations can increase the bioavailability of nutrients, such as nitrogen [31, 32] and phosphorus [33]. In fact, the symbiotic relationship between plant, fungi and bacteria has been demonstrated, not only to positively affect nutrient uptake, but also improve plant fitness, either by conferring increased host resistance to pathogens [34–37], or by preventing establishment of antagonistic microbial communities [7, 34, 37, 38].

The study of interactions among bacteria-fungi-plant is, however, still in its infancy. To understand this three-way interaction, it is necessary to first gain a broader understanding of the diversity of the bacterial-fungal interactions, both phylogenetically and functionally. Most studies investigating bacterial-fungal interactions have been with exo-bacteria (bacteria growing on the surface of the hyphae) and obligatory endobacteria (bacteria growing inside the fungal hyphae), such as Gigaspora margarita and the bacterium Burkholderia [39] or Mortierella elongata and Mycoavidus [40]. Studies on these model pairs of organisms demonstrate the importance of these interactions. For instance, curing the fungus from having the endo-symbiont can cause a significant alteration in the fungal metabolism [40], negatively affect the fungal growth and phenotype, and therefore the ecological fitness of the fungus [41]. The studies with these model organisms begin demonstrating the ecological importance of these interactions and the large knowledge gap related to the extent that fungal-bacterial partners can influence each other in the environment. [42].

Hence, the goal of this study was to gain a broader understanding of the phylogenetic diversity of bacterial-fungal interactions. To do this, we collected fungi and their associated bacteria, including endo- and exo-bacteria, in six different plant rhizospheres, and characterized their diversity, abundance, and interactions with fungal isolates using four different plant-based media.

2.1. Media

Potato dextrose broth (PDB), Luria Bertani broth (LB), FeSO₄.7H₂O, MnCl₂.4H₂O, and ZnSO₄.7H₂O were purchased from Sigma Aldrich. Oatmeal, cornmeal, and sorghum grain agar plates were prepared following the ATTC medium 551 modified protocol [43]. In summary, oat, corn, and sorghum were purchased as whole grains and grounded using a commercial grinder (National Panasonic Co.) to obtain a fine powder (size smaller than 3 mm). Twenty grams of ground grains were boiled in DI water on a hot plate (temperature set at 180 ^oC) for 30 minutes, simmered, then sieved (Nominal Sieve Size Opening 0.09 mm). After adding 18 grams of agar and bringing the volume to 1 L, the solution was then autoclaved for 20 minutes, and the trace salts solution from the ATTC medium 551 was added. The oatmeal (oat) (100% whole grain), cornmeal (corn) (100% dried corn), sorghum grain (Bob's Red Mill sorghum grain), or potato-carrot (PC) (HiMedia, VWR) media were used in the isolation process of the fungi and their associated endo- and exo-bacteria in the soil. All media prepared for the fungal isolation were supplemented with 150 mg/L final concentration of chloramphenicol as the antibiotic (Alfa Aesar). The bacterial isolation media were prepared with 50 mg/L cycloheximide as a fungicide (Sigma Aldrich). Briefly, the sterile media for fungal and bacterial isolations were allowed to cool under the biosafety cabinet to around 50–60 ^oC before adding the antibiotic/fungicide and plating.

2.2. Isolation of fungi and their associated bacteria from soil using modified microcosm fungal highway columns

The method of collection of the fungi and associated bacteria used was previously described as the "fungal-highway column." It has been established as a novel method for fungal isolation from soil together with its associated exo-bacteria [44]. We used the same system with a few modifications. Briefly, the column microcosm shell was prepared using two screw caps and two round-bottom polypropylene tubes. The round bottom tubes were cut at the bottom and glued with superglue to make a narrow passage between the tubes. The microcosm was then sterilized by boiling with deionized water for 15 minutes and then soaked in 70% ethanol overnight. After sterilization, it was air-dried inside the biological hood. The other parts of the microcosm, such as caps, mesh, and 1 mm glass beads, were autoclaved for 20 min at 121 ^oC and 15 psi. The assembly of the microcosm parts under sterile conditions was performed under a biological hood with sterilized tweezers and a spatula. The glass beads were used to fill the inside of the entire column. The selected attracting medium, (either potato-carrot, oatmeal, cornmeal, and sorghum grain agar) was placed on top and at the bottom of the sterile caps of the column (Fig. 1). At the bottom, a perforated cap was used to allow unhindered contact with the rhizosphere. The medium in the bottom cap of the column was crushed to serve as an attractant to the fungi/bacteria, and at the same time, to allow them to grow throughout the column to reach the top cap of the column. At the entrance of the column, in contact with the soil, a nylon mesh (150 µm) was added to prevent the ingress of mites from the soil in the column. These modifications to the originally published column design [44] were made to reduce the overall size, to be cost-effective, easier to manufacture, and to minimize the possible contamination of the column with mites and their associated bacteria. The full microcosm setup is represented in Fig. 1.

The microcosm fungal highway columns (Fig. 1) were set up at the surface of the rhizosphere of six different plants, which were selected based on their tree or bush growth forms, and named in this study as Tree sites and Bush sites. The Tree sites (T) were composed of two angiosperms, Citrus sinensis (Orange tree) (T1), and Diospyros kaki (Persimmon tree) (T2), and a gymnosperm, Cycas revoluta (Cycad) (T3). The plants included in the Bush sites (B) had three evergreen angiosperm shrubs, Ilex vomitoria (Yaupon) (B1), Myrica cerifera (Wax myrtle) (B2), and Buxus sempervirens (Boxwood) (B3). In each site, triplicate fungal highway columns for each media were set up in the soil under the corresponding plants selected for this study. After collection, the isolates of each of the triplicate fungal highway columns of each media in each site were plated in their respective media, but finally analyzed as pooled samples to maximize the number of isolates per site in each media.

After one week of contact with the soil, the microcosms were removed and then taken to the laboratory in sterile whirl Pak bags for immediate microbial isolation. Under the biological hood, the column's top cap with the media was spread onto sterile plates containing the respective media used as attractant: Oatmeal Agar, Cornmeal Agar, Sorghum grain Agar or Potato-carrot Agar. The initial media was prepared without antibiotic or fungicide to obtain the whole community growing on the plate. All the plates were incubated at 28 ^oC for two weeks. After the incubation, the fungal colonies grown on the plates were isolated into their corresponding growth media. These media contained either antibiotic to purify the fungi from exo-bacteria or fungicide to purify the bacteria from the fungi, as described earlier. Most fungal isolates were transferred to fresh plates every seven days until the culture was pure. For the few slow-growing fungal isolates, the transfer to new plates was made every 14 days. In the case of bacterial isolates, most grew well after 16 to 24 hours and were transferred to new plates every 24 hours until purified. The isolation process continued until each plate had only colonies with a single morphology of fungi or bacteria. Then, the purified isolates were used for total DNA extraction.

The distilled water stasis technique was applied to store the fungal isolates [45]. Up to five pieces of media containing fresh cultures of fungus were transferred to a sterile 15 ml tube containing 10 ml of sterile DI water. The cap was tightly closed and sealed with parafilm. After the bacterial isolates were purified, they were grown in the corresponding liquid media under optimal growth conditions (Additional file 1 – Supporting Information) and stored with 25 % sterile glycerol at – 80 ^oC.

2.3. DNA extraction and quality control

Sterilized cellophane paper was used on top of the agar plates for DNA extraction of the fungal isolates. Cellophane (Gel Company cellophane sheet 35x45cm PK100, Fisher Scientific) was cut into smaller pieces to match the size and shape of the Petri dishes used for the media. The cut cellophane sheets were wrapped individually with aluminum foil for autoclaving at 121 ^oC, 15 psi for 20 minutes. After autoclaving, these sheets were dried in the biohood. Under the biosafety hood, sterile tweezers were used to place the cellophane sheets on top of the agar media. Then, a disposable spreader was used to flatten and place the cellophane evenly over the surface of the media. On top of the cellophane paper, an agar piece containing the fungal isolate was placed in the middle of the plate to grow for DNA extraction. After the growth diameter reached approximately 1/2 to 2/3 of the plate, the biomass was removed, under sterile conditions, using disposable inoculation loops and transferred into the bead beating tube of the extraction kit (Zymo Quick-DNA Fungal/Bacterial Kit, D6005). The tube was weighed before and after adding the fungal biomass to estimate the amount of biomass to be extracted. The kit lysing solution was added inside the biosafety hood. To attain optimal DNA extraction yields, beta-mercaptoethanol was added in the lysing step to a final dilution of 0.5 %(v/v), as per the kit manufacturer's suggestion.

For the DNA extraction of bacterial isolates, each isolate was grown in LB or PDB liquid media depending on their growth ability in either of these two media (Additional file 1 - Supporting information). For the ones that could not grow in liquid media (Additional file 1 - Supporting information), they were inoculated on plates, and then the biomass was scraped off for extraction. Bacterial isolates were also extracted using the same Zymo kit as the fungal isolates. For DNA quality and quantity control, the microplate reader (Take3, BioTek Instruments, U.S.A) was used to evaluate DNA concentration and degree of purity (260/280 ratio).

2.4. Sequencing and bioinformatics

2.4.1. Identification of Fungal and Exo-bacterial Isolates

The exo-bacterial isolates were identified using amplicon sequencing of the V3/V4 region of 16S rRNA, that was amplified using the F341/R806 primer pair (Table 1 – Supporting Information)[46]. The sequencing was conducted using a 300-cycle paired-end Illumina MiSeq protocol. All sequence analysis steps were performed using the QIIME2 application within the EDGE Bioinformatics environment [47, 48]. The PCR primer sequences were removed from the forward and reverse reads. The sequences were then quality screened using maximum expected error parameters before being denoised with DADA2 [30]. The denoised sequences were merged before the taxonomic assignment. For the 16S amplicon sequences, the taxonomy assignment was done with a custom taxonomy classifier built using the portion of the SILVA database sequences that matched the amplicon used here.

The fungal isolates were sequenced using the Sanger sequencing method with primers for the internal transcribed spacer (ITS) (ITS1F and ITS4) [49]. The conditions of the PCR are presented in Table 1 in the Supporting Information. First, the fungal DNA was amplified with regular PCR, and the PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, USA). All the purified products were eluted with sterile nuclease-free water and then quantified with the Take 3 plate reader. These purified PCR products were sent for Sanger sequencing with BigDye™ Terminator Version 3.1 sequencing kit (Lone Star Labs Genetic Sequencing, Houston, TX). The sequencing was done with both reverse and forward primers. The assembly, trimming, and editing were performed with MEGA version X [50]. The sequences were analyzed using NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to find the most related sequences and identify the fungal isolates. For those isolates that could not be identified definitely with the ITS, additional Sanger sequencing results for the large 25-28S RNA subunit (LSU) were obtained using the primer pair LROR and LR5 (Table 1 – Supporting Information)[49].

2.4.2. Quantification and identification of the fungal endobacterial community

To determine the presence of endo-bacteria in the fungal isolates, we performed a PCR on the fungal DNA using the 16S rRNA primers (EUB9-27F and 907r), as described in Table 2. The successful amplification was determined visually on a 1% gel electrophoresis.

To further quantify the number of endobacteria in the fungal isolates, quantitative real-time PCR (qPCR) was carried out. The qPCR was performed using primers E8-F and E533-R, as previously described [51]. The thermal cycling conditions and primers are included in Table 1 – Supporting information. The gene copy per DNA sample was normalized by nanograms of DNA then per gram of fungal biomass used to extract the DNA (Additional file 2 - Supporting information).

The endobacteria identification was performed with nested PCR for V1/V5 region with the primer pair EUB9-27F/907r (Table 1 – Supporting Information) and then V3/V4 region with F341/R806. The identification was obtained following the same protocol as described above for the identification of the exo-bacterial isolates. All the sequencing data were deposited in NCBI (ITS sequences: accession numbers MT771292-MT771337; LSU sequences: accession number MT625979-MT626024; 16s rRNA gene sequences: BioProject PRJNA644907).

2.5. Confrontation assays to determine fungal-bacteria interactions

For each location-media combination, a set of fungi and bacteria were isolated (Table 1, Additional file 3 – Supporting information). Following the isolation, each fungal strain was tested against the co-isolated bacteria obtained from the same location-media combination following a modified protocol [49]. The confrontation assay consisted of inoculating the fungi on the corresponding isolation medium plate. A cylinder of the agar media (collected with the wider part of a 200 µL pipette tip) containing the fungal hyphae was transferred from the edge of a 5-day-old culture (pre-inoculum) to a fresh plate and incubated at 28°C.

These fungi were grown to reach about 5 cm of diameter, which, on average, took seven days. After allowing the fungus to grow for six days, in a parallel experiment, the exo-bacterium was inoculated in sterile liquid media. Then, on the day the fungus reached the expected diameter of approximately 5 cm, the bacterial culture was centrifuged and adjusted to a 600 nm optical density (OD₆₀₀) of 1 with phosphate buffer solution (PBS). Then, 25 µL of the bacterial suspension was placed on three equidistant sides of the plate at approximately 3 cm from the center of the fungus inoculation (Fig. 1 – Supporting Information). After the bacterial drop dried, the plates were incubated for another five days until the fungal diameter reached the plates' edges. The interactions between the fungi and bacteria were recorded (Fig. 6). Control plates were prepared in the same manner but without adding the bacterial suspension to the plate (Fig. 1 – Supporting Information); the same volume of sterile PBS was added instead. The time of growth for each fungus and bacteria growth were optimized and recorded (Additional file 1 - Supporting information). All experiments were performed in triplicates and the results, based on the visual screening, were reported as neutral, when fungal growth was not affected by the bacterial inoculum, or negative, when the fungal growth was inhibited by the bacterium (Fig. 2 – Supporting information, Additional file 4 - Supporting information).

2.6. Scanning Electron Microscopy (SEM)

The fungi and bacteria that displayed a neutral interaction from the confrontation assay were further analyzed with SEM. The experiment involved growing the fungus and bacteria on the same plate for ten days until the fungus grew over the bacteria. A 5 mm portion of the media where fungus and bacterium overlapped was collected and then immediately fixed with 2.5% glutaraldehyde solution at 4°C for 24 h in the dark. Post-fixation and dehydration procedures followed our previous publication [52]. Briefly, following the washing steps with phosphate buffer solution (PBS), the sample was incubated for 2 h with 1 % osmium tetraoxide (Sigma Aldrich, USA). Dehydrations were done with ethanol/water (v/v %) at 50 %, 70 %, 95 % and 100 %. The final rinses were with acetone/ethanol at a ratio of 1:2, 1:1, and 2:0. The SEM samples were dried on glass slides [52] and then sputter-coated with gold (Denton V, USA) for 40 s at 45 mAmps. The images were obtained with SEM JSM 6010LA (Jeol, USA) with an accelerating voltage of 10 kV and a spot size of 26.

2.7. Fluorescence in situ Hybridization (FISH)

For the fluorescence in situ hybridization (FISH) analysis, Didymella (F41c) and Fusarium (F54) were selected to confirm the presence of endobacteria in the fungal hyphae. FISH involved preparing growth media pads by casting 4 % phytagel (Sigma Aldrich) supplemented with potato dextrose broth (Sigma) between two standard microscope slides spaced by #1.5 coverslips. Growth pads were shaped using a sterile 15 mL conical tube as a mold cutter and were transferred to the center of microscope slides equipped with a 25 mL Gene Frame (Thermo Fisher Scientific). The slides were placed in a 100 mm disposable petri dish (Thermo Fisher Scientific) alongside a cap from a 15 mL conical tube filled with DI-water to control humidity. Mycelia from fungal tissue was transferred to the media pads and incubated for three days at 21°C and then fixed with 4 % paraformaldehyde (Thermo) in PBS buffer at 4°C overnight. Samples were washed three times with PBS, and cell walls were lysed with a cocktail of 5 mg mL^− 1 lysozyme (Sigma Aldrich) and chitinase (Sigma Aldrich) for 1 hour at 37°C. The samples were washed three times with PBS and subsequently dehydrated with a series of ethanol treatment at 50 %/75 %/100 %/75 %/50 % ethanol in PBS for 3 minutes each at room temperature then resuspended in a solution of PBS.

Hybridization chain reaction FISH (HCR-FISH) was adapted from Choi et al [53]. Stellaris RNA Fish buffers (Biosearch Technologies) were used for subsequent hybridization and washing steps. Samples were preconditioned with Stellaris Wash Buffer A supplemented with 10 % formamide for 5 minutes and replaced by Stellaris Hybridization Buffer supplemented with 10 % formamide and containing a final 125 nM probe concentration. Probes used in this study are a variant of the Eub338 extended with the initiator sequence for HCR (5’- GCTGCCTCCCGTAGGAGTATTTCACATTTACAGACCTCAACCTACCTCCAACTCTCAC-3’) and the universal eukaryote probe, Euk516 (5’-ACCAGACTTGCCCTCC-3’). Probes were hybridized for 4 hours at 37°C and then washed three times with Wash Buffer A for 20 minutes each at 37°C. For hybridization chain reaction FISH, samples were preconditioned with amplification buffer 2X saline sodium citrate buffer (SSC, Thermo Fisher Scientific), 0.1 % Tween 20 (Thermo Fisher Scientific), and 10 % low MW dextran sulfate (Sigma Aldrich) for 20 minutes at room temperature and exchanged with HCR amplification probes (Molecular Instruments): B4-Alexa Fluor 647 in amplification buffer. HCR amplification was performed overnight at room temperature and subsequently washed with Stellaris Wash Buffer A without formamide three times for 20 minutes each at room temperature. DAPI staining was performed with the addition of 1 µM DAPI in Stellaris Wash Buffer A and incubated for 10 minutes at room temperature. Excess dye was washed with Stellaris Wash Buffer B for 5 minutes at room temperature and rinsed with 2X SSC buffer three times prior to imaging. Images were collected with a Zeiss Axio Observer microscope and were processed using FIJI.

Bacteria have been described to colonize and use the fungal hyphae as highways to translocate in unsaturated soil matrices [51, 52]. Recently, a microcosm fungal highway column was developed as a unique isolation technique that allows bacteria to be transported using the fungus hyphae and to experimentally obtain insights on the bacterial-fungal interactions occurring in the soil [44, 54]. In the present study, this device was placed in the soil in proximity to the roots of six different plants using four different plant-based media as attractant for the isolation of cultivatable fungi and their associated bacteria from plant rhizospheres. The setup of the microcosm requires that the fungus grow upward in the unsaturated microcosm column to colonize the agar on top of the column. In this setup, the bacteria would also have to interact directly with the fungi to get transported to the top of the column. Therefore, we hypothesized that in these highway columns the bacteria should only have a positive or neutral interaction with the fungus to travel to the top of the column.

3.1. Fungal isolation from highway column samplings: relationship with types of plants and media

The fungal highway columns yielded a total of 46 fungal isolates from six different plant rhizospheres using four different plant-based media (Table 1). Most of the fungal isolates were identified as belonging to known plant pathogen species. The most represented fungal genera found in the collection were Fusarium and Cladosporium, both common soil-borne pathogens largely associated with plants and common inhabitants of the soil microbial community [55, 56]. Other fungal isolates, also associated with plant diseases, were Alternaria [57, 58], Diaporthe, and its asexual state Pomopsis [59, 60]. Moreover, we were able to isolate Aspergillus niger and Aspergillus fumigatus, which are often present in soils [61, 62], and Didymella, known for its pectolytic activities against plant cell walls [63]. We also isolated fungi often described as endophytes, such as Pestalotiopsis [64–69] and Plectospaerella [70], and non-pathogenic slow-growing mold, such as Stachybotrys [71] and Kalmusia. The latter is a fungus commonly associated with the soil crust [72]. In summary, all the fungal isolates have been previously described to be part of the soil microbial community.

Additional investigation involved the identification of possible relationships between plant type and the fungal isolates. For this purpose, we grouped the plants based on their tree or bush aspect and described them as tree sites and bush sites. In the case of the tree sites, they were divided into T1, T2, and T3, which corresponded to Citrus sinensis (Orange tree), Diospyros kaki (Persimmon tree), and Cycas revoluta (Cycad), respectively (Table 1). The Citrus sinensis (T1) was characterized by the fewest recovered fungal isolates (Fig. 2), i.e. one from Sorghum grain agar and one from Potato-carrot agar. Similar results and low fungal yield was previously observed in another study with the same type of tree [73]. These authors described that the principal taxa of fungi associated to Citrus sinensis was Basidiomycota, a generally slow growing phylum of fungi, and consequently difficult to isolate with conventional techniques of soil mycology [74]. This location was the only site where the genus Plectosphaerella was isolated (Additional file 1 - Supporting information). Plectosphaerella is a plant pathogen previously isolated from nine different plant genera [75–77] but never from Citrus sinensis. Kalmusia was another plant pathogen isolated that, as with Plectosphaerella, had never been described to be associated with orange trees. Among all the locations studied, the largest number of fungal species were obtained in the rhizosphere of Diospyros kaki (T2) (Fig. 2). This result may be explained by the natural decay of fallen persimmon fruits, which increased the nutrient content in the soil [78, 79]. Such a finding is also corroborated by the fact that the majority of the fungi obtained in this location were saprophytes [80–82].

In the case of the bush sites, they were divided into B1, B2, and B3, which corresponded to Ilex vomitoria (Yaupon), Myrica cerifera (Wax myrtle), and Buxus sempervirens (Boxwood), respectively (Table 1). Among all the bush locations, the number of fungi retrieved from these locations ranged from five, coming from the Buxus sempervirens (B3), to nine isolates from Ilex vomitoria (B1) (Fig. 2). Also, Ilex vomitoria (B1) was the only location with the presence of the fungus Diaporthales (Fig. 3). This fungus is a known plant pathogen commonly associated with various plants [59, 83]. The overall comparison of the bush and tree sites showed that the bush sites presented a higher diversity of fungal isolates (Fig. 3 – Supporting Information). In general, both sites seemed to share a core of four fungi commonly known as plant pathogens and soil inhabitants, namely, Pleosporales, Fusarium, Aspergillus and Cladosporium [55, 56, 61] (Fig. 3).

In addition to the types of plants, we determined the effect of different plant-based media on the diversity of fungi collected for each plant type. The results showed a noticeable difference in the culture collections, confirming previous findings on the effect of different media on the isolation of fungi [84–86]. Cornmeal agar recovered the highest number of fungal isolates, while oatmeal agar recovered the lowest (Fig. 2). Furthermore, we found at least one common taxon i.e. Fusarium and Pleosporales, in both tree and bush locations, as well as in all growth media, except for Potato-carrot. This finding suggests that these two taxa are ubiquitous in different plant rhizospheres.

Due to the intrinsic specificity of the nutrient requirement of the different microorganisms [87] and the fact that plant-based media do not have a defined chemical composition, it is difficult to draw a conclusion related to the effects of the media effects. However, we could conclude that none of the media used in this experiment can be defined as "optimal" considering the different number of fungi and bacteria obtained in the different media and different sites. Still, the community of culturable fungi was influenced by a combination of plant coverage types and the type of media used as a fungal attractant.

Table 1

Number of fungal and bacterial isolates obtained with the different media (Oatmeal Agar, Cornmeal Agar, Sorghum grain Agar, and Potato-carrot Agar) in six different types of rhizospheres. The area code in the table corresponds to the type of plant and was assigned as tree (T) and bush (B).

Area code	Description	Oatmeal Agar		Cornmeal Agar		Sorghum grain Agar		Potato-carrot Agar
Area code	Description	Fungal Isolates	Bacterial Isolates	Fungal Isolates	Bacterial Isolates	Fungal Isolates	Bacterial Isolates	Fungal Isolates	Bacterial Isolates
T1	Citrus sinensis (Orange tree)					1	1	1
T2	Diospyros kaki (Persimmon tree)	2		6	5	5	5	3	12
T3	Cycas revoluta (Cycad)	2				4	1		2
B1	Ilex vomitoria (Yaupon)	3		6					4
B2	Myrica cerifera (Wax myrtle)	3		3	5	2	3		8
B3	Buxus sempervirens (Boxwood)	2		2				1	5

3.2. Linking fungal and bacterial isolates from the same columns

The isolated fungi and associated exo-bacteria carried along the columns with the fungal hyphae were further investigated. A total of 51 exo-bacterial isolates were successfully collected with serial transfers on plant-based media with fungicide (Fig. 4, Fig. 5). The most predominant phyla isolated were Firmicutes (57%), followed by Proteobacteria (29%) and Actinobacteria (16%). These phyla are the most prominent endophytic representatives described to be associated with diverse plants, such as Arabidopsis thaliana [89], Setaria italica (Foxtail millet) [90], Glycine max (soybean), [91] and Panicum virgatum (switchgrass) [92]. These results confirm the capacity of this isolation technique to obtain a similar rhizosphere microbiome to other techniques.

Among all locations, Bacillus was the most common isolate, followed by other well-known soil bacteria: Acinetobacter, Ensifer, Pseudomonas, Microbacterium, Paenibacillus, Rhizobium, and Stenotrophomonas. Most of these bacterial isolates are known to either act as plant growth promoters [93–104] or as biocontrol agents against plant pathogens [105–107].

Similar to the finding from the fungal isolates, Diospyros kaki (T2) presented the most exo-bacterial isolates, while Citrus sinensis (T1) presented the least. Among the tree rhizospheres, the total number of different bacterial isolates retrieved ranged from 22 associated with Diospyros kaki, to 1 with Citrus sinensis (Fig. 4). Interestingly, from the latter location, we were able to retrieve Pseudorhodoferax, a bacterium, that from the best of our knowledge, has never been described as being associated with the fungus Kalmusia.

In the bush sites, Myrica cerifera (B2) was characterized by the highest percentage of isolates ascribed to the genus Bacillus (62.5%). This genus was retrieved from almost all locations, except from Citrus sinensis (T1) and Cycas revoluta (T3) (Fig. 5).

Despite the small number of locations and isolates, a positive correlation was observed between the number of fungal and bacterial isolated in the different sites (Pearson's r² = 0.84) (Fig. 7 – Supporting Information). Additionally, a positive correlation between the diversity indices of fungal and bacterial isolates were obtained from the different locations (Pearson's r² = 0.76) (Fig. 8 – Supporting Information). From this data, we hypothesized that a species-specific partnership between fungus and bacterium could be occurring. However, the possibility of non-specific interactions cannot be excluded considering the co-occurrence of multiple bacteria and fungi retrieved in the columns. These results suggest that the abundance and diversity of the retrieved fungi should be able to directly affect the capacity to represent and recover the associated bacterial community. He et al. reported a similar result where a positive correlation was described when they studied the possible presence of a linkage between diversities of plants, fungi, and bacteria [108].

3.3. Bacterial-fungal interactions: reconstruction of the microbial associations in the soil

The positive linear correlation between fungal diversity and associated bacteria observed earlier suggested the need for a deeper understanding of the types of interactions between fungi and their associated bacteria. As mentioned earlier, we hypothesized that only positive or neutral interactions with fungi would have allowed the translocation of exo-bacteria via the fungal hyphae. Therefore, co-isolated bacteria and fungi in the same locations and media were further investigated via the confrontation assay (Fig. 6) in order to reconstruct the type of partnerships that were occurring in the soil.

As hypothesized, some of the bacteria isolated from the same location and growth medium displayed species-specific associations and neutral/positive interactions with the co-isolated fungus. This was the case for Agrococcus, Brevibacillus, and Exiguobacterium, which displayed positive or neutral interactions only in the presence of Didymella. A similar pattern was observed with the bacteria Cellulomonas associated with the fungus Staphylotrichum coccosporum and Stenotrophomonas with Aspergillus fumigatus. However, contrary to our initial hypothesis, in some cases different bacterial isolates belonging to the same species displayed different types of interactions with the same fungal isolate, suggesting that the bacterial-fungal interactions are not necessarily species-specific but rather strain-specific. (Additional file 4 - Supporting information). For instance, in the present study, we observed that some Bacillus isolates presented both neutral and antagonistic relationships with different fungal isolates of the same genus. One example was the association of Fusarium and Bacillus, where we recorded both negative and neutral interactions (Fig. 6). The negative interactions between Fusarium and Bacillus have also been observed and explained by others [109, 110].

The negative effects of bacteria toward fungi is typically a result of the bacterial production of antifungal secondary metabolites. For instance, as described by Mnif et al [111] lipopeptides produced by Bacillus display antifungal activity against F. solani. Another antifungal compound produced by different bacteria, including Pseudomonas, is 2,4-diacetylphloroglucinol (DAPG) [112]. DAPG is an active compound against various plant-pathogenic fungi, including Fusarium [113–116]. Besides the negative interactions observed between Fusarium and Bacillus, other studies also reported antagonistic interactions between Ensifer and the fungus Pleosporales, due to the production of alliinase, as a secondary metabolite for bacterial defense [113, 114, 117–119]. The present study also corroborates these previous findings that Bacillus, Ensifer and Pseudomonas present antagonistic patterns towards these fungal genera/species.

In addition to the negative interactions between Fusarium and Bacillus, this fungus also presented a neutral interaction with Rhodococcus. This interaction, however, was not species-specific since this bacterium also presented neutral interactions with other fungi. To further understand the nature of the neutral interactions observed in the present study, scanning electron microscopies were obtained. A representative image of the neutral interaction between Fusarium and the bacterium Rhodococcus is presented in Fig. 7. The results showed that the bacteria displayed the capacity to grow on top of the hyphae (Fig. 7). This type of finding was also reported by others [44]. However, it is important to point out that except for a few documented associations, such as the co-existence of A. fumigatus and Stenotrophomonas as a hyphae biofilm, [120] there is a lack of literature about those types of interactions in natural environments. This study shows that bacteria are commonly associated with fungi in plant rhizospheres. Furthermore, this isolation technique using highway columns promises to shed light on the specificity and types of relationships between bacteria and fungi in plant rhizospheres.

3.4. Endo-hyphal microbiome and bacterial-fungal specificity

Like other taxonomic groups of eukaryotic organisms, fungi have also been reported to have established associations with bacteria as endosymbionts [28, 29, 92, 121–124]. To determine if any of our fungal isolates harbored bacterial endosymbionts within their fungal hyphae, we performed both qualitative and quantitative investigations of our fungal isolates. Initial qualitative determination of bacterial presence inside the fungal hyphae was determined via 16S rRNA gene signal using fluorescence in situ hybridization (FISH) imaging (Fig. 8) [53]. The FISH results confirmed the presence of bacteria inside the hyphae of selected isolates. Figure 8 shows an example of bacterial signatures observed inside the Didymella mycelium. At low magnification, the presence of the signal (Cyan) can be observed ubiquitously across the fungal hyphae, while at higher magnifications bacteria can be observed within the hyphae. Innate fluorescence of the fungi was investigated to determine whether the fungi exhibited any fluorescent artifacts. Fusarium (F54) was also observed to exhibit internalized bacterial signals, which was to be expected since this fungus exhibited one of the highest bacterial loads determined by quantitative real time PCR (Additional file 1 - Supporting Information).

After confirming the presence of endosymbionts in the fungal isolates, 16S rRNA gene sequencing of these endosymbionts were done. The taxa of endobacteria present in each fungal isolated are listed in the Supporting information (Fig. 11, 12, 13, 14, 15, 16 – Supporting Information). On average, the fungal genera characterized by the largest numbers of endobacterial taxa were Pleosporales, followed by Fusarium (Fig. 13–14 – Supporting Information). This is the first study reporting the presence of endobacteria in Fusarium. Most of the endosymbiotic bacteria found in the genus Fusarium and in the order Pleosporales were composed of bacterial phyla commonly associated with the soil microbial community, such as Proteobacteria, Firmicutes, and Actinobacteria [125], suggesting that these bacteria probably have a mechanism to enter the fungal hyphae. Comparing exo-bacterial and endo-bacterial communities, we found that in most cases there was no intersection between these two microbial communities. Among the different exo-bacteria co-isolated with the fungi, only Bacillus, Microbacterium, Pseudomonas, and Stenotrophomonas were also found as endosymbionts. One of the most compelling examples is Bacillus spp. These species, despite having been associated as exo-bacteria with various fungal isolates (almost 70% of our collection), were present as endobacteria in only five fungi. More specifically, this genus was present in conjunction with the fungal taxa of Pleosporales, Didymella, and Neopestalotiopsis. This result validates the hypothesis that the endobacterial microbial community present in the fungi is not necessarily affected or linked to the exogenous microbial community. On the other hand, Pseudomonas and Stenotrophomonas were found to be present as both endo- and exo-bacteria, respectively, in 85% and 71% of their co-isolated fungi, suggesting that these genera could be horizontally transmitted from the fungus to the external environment and vice-versa [126].

The analysis conducted on the bacterial endosymbionts present in fungal isolates resulted in the observation that different genera of fungi present both a unique subset of bacteria and a shared core of five endosymbionts (Fig. 9) composed of isolates from Stenotrophomonas, Pseudomonas, Achromobacter, Candidatus Finniella, and Methylobacterium. This core of endosymbionts was previously documented as fungal endobacteria [121–123, 127, 128]. Among the core of endosymbionts, Stenotrophomonas [129, 130], Pseudomonas [131, 132] and, Achromobacter [133], they have also been described to be involved in nitrogen fixation in soil. Other endosymbionts, such as Bacillus [134], Bradyrhizobium [135], Novosphingobium [136], and Herbaspirillum [137], were also previously described to be participating in nitrogen fixation in soil [131–142]. Previous studies proposed that the bacteria could exploit the nitrogen resources of the fungus. The proposed mechanism involved the production of peptidases by the endophytic bacteria and consequent absorption of the resulting oligopeptides produced by their biodegradation [143, 144]. However, the identification of microorganisms, possibly capable of carrying out nitrogen fixation, present as fungal endosymbionts, indicate that there could be a more complex nutrient exchange pattern between the endobacteria and its host.

In the present study, fungal highway columns allowed us to glimpse the complexity of the network of bacterial-fungal interactions in plant rhizospheres by successfully selecting a group of cultivatable fungi and their intimately associated bacteria. The diversity of fungi and bacteria obtained was clearly influenced by the types of plants and media used. The bush sites presented a larger diversity of isolates than the sites with trees. However, both sites shared a core of four fungi, namely Pleosporales, Fusarium, Aspergillus and Cladosporium. In general, most of the isolated fungi were previously described as plant pathogens [55, 56, 59, 61, 80-83]. Among the media used in this study, we can conclude that cornmeal could be considered as an excellent compromise between the number and diversity of isolates. These results suggest that a careful selection of the growth medium for different types of plant rhizospheres to be used in the fungal highway column is essential to achieve isolation of larger subsets of the fungal and bacterial communities associated with the rhizospheres. This approach could also be used with selective media to select and enrich a specific subset of the fungal-bacterial community associated with the rhizosphere for more detailed studies of model soil microorganisms.

Detailed investigation of the exo-bacterial and endobacterial communities associated to this isolated subset of the fungal community showed that both species-specific and generalistic associations can occur. Although, generalistic associations were more frequently observed in the fungal isolates. Furthermore, the exo-bacteria and endobacteria communities showed little or no intersection between these two microbial communities. Among the different exo-bacteria co-isolated with the fungi, only Bacillus, Microbacterium, Pseudomonas, and Stenotrophomonas were also found as endosymbionts. Bacillus was, however, associated as an exo-bacteria with the vast majority of the fungal isolates and was present as an endosymbiont in only 15% of the fungal isolates. Pseudomonas and Stenotrophomonas, on the other hand, were found in both endo- and exo-bacterial communities. This result suggested that the horizontal transmission of bacteria from the fungus to the environment and vice-versa is not always host specific.

The most notable findings of this study are the identification of a core of endobacteria shared among the principal fungal taxa in soil, and some species-specific interactions observed with some pairs of exo-bacteria and fungi. On the other hand, the cosmopolitan distribution of the Bacillus genus among the exo-bacteria associated with fungi has not been previously described and could provide an excellent model organism to gain a better understanding of exo-bacterial-fungal interactions in future investigations.

PDB: potato dextrose broth; LB: Luria Bertani broth ; PBS: phosphate-buffered saline; PCR: polymerase chain reaction; qPCR: quantitative polymerase chain reaction; ITS: internal transcribed spacer; LSU: large subunit; SEM: scanning electron microscopy; FISH: fluorescence in situ hybridization.

Acknowledgements

We thank Andisheh Ghofrani Tabari for her help in identifying the tree species presented in this study.

Ethical approval and consent to participate

Not applicable.

Authors’ contributions

DFR and PSGC conceived the study. HNN and SP performed the collection and isolation of the samples. SL, HNN, and SP performed DNA extraction of the samples. SL and HNN performed the identification of the isolates, data analysis and visualization. SL performed the confrontation assays and qPCR analysis. GLH performed the identification of the endobacterial community. HNN performed the SEM imaging. DM-III performed the fluorescent in situ analysis and microscopic imaging. SL, DFR, HNN, GLH, DM-III, and PSGC wrote the manuscript. All authors read and approved the manuscript.

Funding

This work was supported by the U.S. Department of Energy, Office of Science, Biological and

Environmental Research Division, under award number LANLF59T.

Availability of data and materials

All data derived from this work is publicly available in the NCBI-GenBank database under the following accession numbers: ITS sequences: accession numbers MT771292-MT771337; LSU sequences: accession number MT625979-MT626024; 16s rRNA gene sequences: BioProject PRJNA644907.

Consent for publication

All authors have read and participated in the preparation of the manuscript. All authors consent to the publication.

Competing interests

The authors declare no competing interests.

Redman, R.S., et al., Thermotolerance generated by plant/fungal symbiosis. 2002. 298(5598): p. 1581-1581.
Rodriguez, R. and R.J.J.o.e.b. Redman, More than 400 million years of evolution and some plants still can't make it on their own: plant stress tolerance via fungal symbiosis. 2008. 59(5): p. 1109-1114.
Behie, S.W. and M.J.J.T.i.P.S. Bidochka, Nutrient transfer in plant–fungal symbioses. 2014. 19(11): p. 734-740.
Stracke, S., et al., A plant receptor-like kinase required for both bacterial and fungal symbiosis. 2002. 417(6892): p. 959-962.
Oburger, E. and D.L. Jones, Sampling root exudates–mission impossible? Rhizosphere, 2018. 6: p. 116-133.
Lynch, J. and J. Whipps, Substrate flow in the rhizosphere. Plant soil, 1990. 129(1): p. 1-10.
Linderman, R.G., Vesicular‐arbuscular mycorrhizae and soil microbial interactions. Mycorrhizae in sustainable agriculture, 1992. 54: p. 45-70.
Jones, D.L., A. Hodge, and Y. Kuzyakov, Plant and mycorrhizal regulation of rhizodeposition. New phytologist, 2004. 163(3): p. 459-480.
Barea, J., C. Azcón-Aguilar, and R. Azcón, Interactions between mycorrhizal fungi and rhizosphere micro-organisms within the context of sustainable soil-plant systems. Multitrophic interactions in terrestrial systems, 2002. 1: p. 65-8.
Azcón-Aguilar, C., J. Barea, and N.Y. Hall, Interactions between mycorrhizal fungi and other rhizosphere microorganisms. Mycorrhizal functioning: an integrative plant-fungal process. , 1992: p. 163-198.
Dixon, R. and D. Kahn, Genetic regulation of biological nitrogen fixation. Nature Reviews Microbiology, 2004. 2(8): p. 621-631.
Hungria, M., M.A. Nogueira, and R.S. Araujo, Co-inoculation of soybeans and common beans with rhizobia and azospirilla: strategies to improve sustainability. Journal of Biology, 2013. 49(7): p. 791-801.
Abd_Allah, E.F., et al., Enhancing growth performance and systemic acquired resistance of medicinal plant Sesbania sesban (L.) Merr using arbuscular mycorrhizal fungi under salt stress. Saudi journal of biological sciences, 2015. 22(3): p. 274-283.
Aroca, R., et al., Arbuscular mycorrhizal symbiosis influences strigolactone production under salinity and alleviates salt stress in lettuce plants. Journal of plant physiology, 2013. 170(1): p. 47-55.
Gómez-Bellot, M.J., et al., Influence of arbuscular mycorrhizal fungi and treated wastewater on water relations and leaf structure alterations of Viburnum tinus L. plants during both saline and recovery periods. Journal of plant physiology, 2015. 188: p. 96-105.
Bordiec, S., et al., Comparative analysis of defence responses induced by the endophytic plant growth-promoting rhizobacterium Burkholderia phytofirmans strain PsJN and the non-host bacterium Pseudomonas syringae pv. pisi in grapevine cell suspensions. Journal of experimental botany, 2011. 62(2): p. 595-603.
Newton, W.E., Nitrogen fixation in perspective, in Nitrogen fixation: from molecules to crop productivity. 2000, Springer. p. 3-8.
Franche, C., K. Lindström, and C. Elmerich, Nitrogen-fixing bacteria associated with leguminous and non-leguminous plants. Plant soil, 2009. 321(1-2): p. 35-59.
Jones, D.L. and soil, Organic acids in the rhizosphere–a critical review. Plant, 1998. 205(1): p. 25-44.
Rodríguez, H., et al., Genetics of phosphate solubilization and its potential applications for improving plant growth-promoting bacteria. Plant, 2006. 287(1-2): p. 15-21.
Sharma, S.B., et al., Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils. SpringerPlus, 2013. 2(1): p. 587.
Chen, Y., et al., Phosphate solubilizing bacteria from subtropical soil and their tricalcium phosphate solubilizing abilities. Applied soil ecology, 2006. 34(1): p. 33-41.
Broeckling, C.D., et al., Root exudates regulate soil fungal community composition and diversity. Appl. Environ. Microbiol, 2008. 74(3): p. 738-744.
Weston, I.A., Root exudates: an overview. Root Ecology., 2003. 168: p. 235-255.
Mosse, B., Honey-coloured, sessile Endogone spores: II. Changes in fine structure during spore development. Archiv für Mikrobiologie, 1970. 74(2): p. 129-145.
BONFANTE, F., CYTOLOGICAL OBSERVATIONS ON THE MYCORRHIZA" ENDOGONE FLAMMICORONA"-" PINUS STROBUS". 1977.
Bonfante-Fasolo, P. and S.J.M. Scannerini, The ultrastructure of the zygospore in Endogone flammicorona Trappe & Gerdemann. 1976. 59(2): p. 117-123.
Bianciotto, V. and P. Bonfante, Arbuscular mycorrhizal fungi: a specialised niche for rhizospheric and endocellular bacteria. Antonie van Leeuwenhoek, 2002. 81(1-4): p. 365-371.
Bonfante, P., Plants, mycorrhizal fungi and endobacteria: a dialog among cells and genomes. Biological Bulletin 2003. 204(2): p. 215-220.
Garbaye, J., Mycorrhization helper bacteria: A new dimension to the mycorrhizal symbiosis. Acta Botanica Gallica, 1994. 141(4): p. 517-521.
Barea, J.-M., R. Azcón, and C.J.A.v.l. Azcón-Aguilar, Mycorrhizosphere interactions to improve plant fitness and soil quality. 2002. 81(1-4): p. 343-351.
Barea, J.M., R. Azcon, and C. Azcón-Aguilar, 21 Vesicular-arbuscular Mycorrhizal Fungi in Nitrogen-fixing Systems, in Methods in microbiology. 1992, Elsevier. p. 391-416.
Smith, S.E. and D.J. Read, Mycorrhizal symbiosis. 2010: Academic press.
Azcón-Aguilar, C. and J.J.M. Barea, Arbuscular mycorrhizas and biological control of soil-borne plant pathogens–an overview of the mechanisms involved. 1997. 6(6): p. 457-464.
Cordier, C., et al. The beneficial rhizosphere: a necessary strategy for microplant production. in International Symposium on Methods and Markers for Quality Assurance in Micropropagation 530. 1999.
Linderman, R., Mycorrhizal interactions in the rhizosphere, in The rhizosphere and plant growth. 1991, Springer. p. 343-348.
Linderman, R.G., Effects of mycorrhizas on plant tolerance to diseases, in Arbuscular mycorrhizas: Physiology and function. 2000, Springer. p. 345-365.
Azcón-Aguilar, C., J.J.M.f.a.i.p.-f.p.C. Barea, and N.Y. Hall, Interactions between mycorrhizal fungi and other rhizosphere microorganisms. 1992: p. 163-198.
Bianciotto, V., et al., An obligately endosymbiotic mycorrhizal fungus itself harbors obligately intracellular bacteria. 1996. 62(8): p. 3005-3010.
Uehling, J., et al., Comparative genomics of Mortierella elongata and its bacterial endosymbiont Mycoavidus cysteinexigens. 2017. 19(8): p. 2964-2983.
Lumini, E., et al., Presymbiotic growth and sporal morphology are affected in the arbuscular mycorrhizal fungus Gigaspora margarita cured of its endobacteria. 2007. 9(7): p. 1716-1729.
Jargeat, P., et al., Isolation, free-living capacities, and genome structure of “Candidatus Glomeribacter gigasporarum,” the endocellular bacterium of the mycorrhizal fungus Gigaspora margarita. 2004. 186(20): p. 6876-6884.
Atlas, R.M., Handbook of microbiological media. 2010: CRC press.
Simon, A., et al., Exploiting the fungal highway: development of a novel tool for the in situ isolation of bacteria migrating along fungal mycelium. FEMS microbiology ecology, 2015. 91(11): p. fiv116.
Humber, R.A., Fungi: preservation of cultures, in Manual of techniques in insect pathology. 1997, Elsevier. p. 269-279.
Nguyen, H.N., S.L. Castro-Wallace, and D.F.J.E.S.N. Rodrigues, Acute toxicity of graphene nanoplatelets on biological wastewater treatment process. 2017. 4(1): p. 160-169.
Bolyen, E., et al., Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. 2019. 37(8): p. 852-857.
Callahan, B.J., et al., DADA2: high-resolution sample inference from Illumina amplicon data. 2016. 13(7): p. 581-583.
White, T.J., et al., Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. 1990. 18(1): p. 315-322.
Kumar, S., et al., MEGA X: molecular evolutionary genetics analysis across computing platforms. 2018. 35(6): p. 1547-1549.
Nguyen, H.N., S.L. Castro-Wallace, and D.F. Rodrigues, Acute toxicity of graphene nanoplatelets on biological wastewater treatment process. Environmental Science: Nano, 2017. 4(1): p. 160-169.
Nguyen, H.N., et al., Cellular and metabolic approaches to investigate the effects of graphene and graphene oxide in the fungi Aspergillus flavus and Aspergillus niger. Carbon, 2019. 143: p. 419-429.
Choi, H.M., V.A. Beck, and N.A.J.A.n. Pierce, Next-generation in situ hybridization chain reaction: higher gain, lower cost, greater durability. 2014. 8(5): p. 4284-4294.
Junier, P., et al., Democratization of fungal highway columns as a tool to investigate bacteria associated with soil fungi.
Steinkellner, S., et al., Flavonoids and strigolactones in root exudates as signals in symbiotic and pathogenic plant-fungus interactions. Molecules, 2007. 12(7): p. 1290-1306.
Barron, G.L. and J. Peterson, The genera of Hyphomycetes from soil. Soil Science, 1968. 106(6): p. 477.
Pringle, R.B. and R.P. Scheffer, Host-specific plant toxins. Annual Review of Phytopathology, 1964. 2(1): p. 133-156.
Yoder, O., Toxins in pathogenesis. Annual review of phytopathology, 1980. 18(1): p. 103-129.
Gomes, R., et al., Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia: Molecular Phylogeny, Evolution of Fungi, 2013. 31: p. 1.
Masirevic, S. and T. Gulya, Sclerotinia and Phomopsis—two devastating sunflower pathogens. Field Crops Research, 1992. 30(3-4): p. 271-300.
Bossche, H.V., D.W. Mackenzie, and G. Cauwenbergh, Aspergillus and aspergillosis. 1988: Springer.
Klich, M.A., Biogeography of Aspergillus species in soil and litter. Mycologia, 2002. 94(1): p. 21-27.
Chilosi, G. and P. Magro, Pectolytic enzymes produced in vitro and during colonization of melon tissues by Didymella bryoniae. Plant Pathology, 1998. 47(6): p. 700-705.
Agarwal, A. and S. Chauhan, A new species of the genus Pestalotiopsis from Indian soil. Indian Phytopathol, 1988. 41: p. 625-627.
Ho, W. and K.D. Hyde, Fungal succession on fronds of Phoenix hanceana in Hong Kong. Fungal Diversity, 2002.
Hu, H., et al., Phylogenetic diversity of endophytic Pestalotiopsis species in Pinus armandii and Ribes spp.: evidence from rDNA and β-tubulin gene phylogenies. Fungal diversity, 2007.
Liu, A., et al., Notes on endophytic Pestalotiopsis from Hainan, China. Mycosystema, 2006. 25(3): p. 389-397.
Watanabe, K., K. Motohashi, and Y. Ono, Description of Pestalotiopsis pallidotheae: a new species from Japan. Mycoscience, 2010. 51(3): p. 182-188.
Wei, J.-G., et al., Endophytic Pestalotiopsis species associated with plants of Podocarpaceae, Theaceae and Taxaceae in southern China. Fungal diversity, 2007. 24(1): p. 55-74.
Carlucci, A., et al., Plectosphaerella species associated with root and collar rots of horticultural crops in southern Italy. Persoonia: Molecular Phylogeny, Evolution of Fungi, 2012. 28: p. 34.
Wu, Y. and T. Zhang, Two new species of Stachybotrys from soil. Mycotaxon, 2009. 109: p. 461-464.
Christensen, M. and C. Kinter, Soil fungi as components of biological soil crusts, in Biological Soil Crusts: Structure, Function, and Management. 2001, Springer. p. 155-166.
Sun, P., et al., Identification of fungal community in citrus rhizosphere by ITS gene sequencing. 2017. 16(2): p. 85-91.
Goos, R.D., Basidiomycetes Isolated from Soil. Mycologia, 1960. 52(4): p. 661-663.
Palm, M.E., W. Gams, and H.I. Nirenberg, Plectosporium, a new genus for Fusarium, tabacinum, the anamorph of Plectosphaerella cucumerina. Mycologia, 1995. 87(3): p. 397-406.
Alderman, D. and J.L. Polglase, Fusarium tabacinum (Beyma) Gams, as a gill parasite in the crayfish, Austropotamobius pallipes Lereboullet. Journal of Fish Diseases, 1985. 8(2): p. 249-252.
Zhang, Z.-Y., et al., Phylogeny and taxonomy of two new Plectosphaerella (Plectosphaerellaceae, Glomerellales) species from China. MycoKeys, 2019. 57: p. 47.
Palou, L., et al., Fungi associated with postharvest decay of persimmon in Spain. Acta Horticulturae, 2009(833): p. 275-280.
Tafinta, I., et al., Isolation and identification of fungi associated with the spoilage of sweet orange (Citrus sinensis) fruits in Sokoto State. Nigerian Journal of Basic Applied Sciences, 2013. 21(3): p. 193-196.
Tekaia, F. and J.-P.J.C.o.i.m. Latgé, Aspergillus fumigatus: saprophyte or pathogen? 2005. 8(4): p. 385-392.
Dickinson, C., Biology of Alternaria alternata, Cladosporium cladosporioides and C. herbarum in respect of their activity on green plants. 1981.
Fracchia, S., et al., Effect of the saprophytic fungus Fusarium oxysporum on arbuscular mycorrhizal colonization and growth of plants in greenhouse and field trials. 2000. 223(1-2): p. 177-186.
Udayanga, D., et al., A multi-locus phylogenetic evaluation of Diaporthe (Phomopsis). Fungal diversity, 2012. 56(1): p. 157-171.
Vinayaka, K., et al., Association and variation of endophytic fungi among some macrolichens in central Western Ghats, Southern India. Int. J. Curr. Microbiol. Appl. Sci, 2016. 5: p. 115-124.
Sharma, G. and R.R. Pandey, Influence of culture media on growth, colony character and sporulation of fungi isolated from decaying vegetable wastes. Journal of yeast and fungal research, 2010. 1(8): p. 157-164.
Kumara, K., R.J.T.A.R. Rawal, and Extension, Influence of carbon, nitrogen, temperature and pH on the growth and sporulation of some Indian isolates of Colletotrichum gloeosporioides causing anthracnose disease of papaya (Carrica papaya L). 2010. 11.
Muggia, L., T. Kopun, and M. Grube, Effects of growth media on the diversity of culturable fungi from lichens. Molecules, 2017. 22(5): p. 824.
Shannon, C.E.J.B.s.t.j., A mathematical theory of communication. 1948. 27(3): p. 379-423.
Lundberg, D.S., et al., Defining the core Arabidopsis thaliana root microbiome. 2012. 488(7409): p. 86-90.
Jin, T., et al., Taxonomic structure and functional association of foxtail millet root microbiome. 2017. 6(10): p. gix089.
Mendes, L.W., et al., Taxonomical and functional microbial community selection in soybean rhizosphere. 2014. 8(8): p. 1577-1587.
Xia, Y., et al., Characterization of culturable bacterial endophytes and their capacity to promote plant growth from plants grown using organic or conventional practices. 2015. 6: p. 490.
Mayhood, P.M., Investigation of the Individual Soybean Root Nodule Microbiome. 2020.
Dastager, S.G., et al., Isolation and characterization of novel plant growth promoting Micrococcus sp NII-0909 and its interaction with cowpea. 2010. 48(12): p. 987-992.
Dardanelli, M.S., et al., Effect of the presence of the plant growth promoting rhizobacterium (PGPR) Chryseobacterium balustinum Aur9 and salt stress in the pattern of flavonoids exuded by soybean roots. 2010. 328(1-2): p. 483-493.
Cordovez, V., et al., Priming of Plant Growth Promotion by Volatiles of Root-Associated Microbacterium spp. 2018. 84(22).
Bharti, N., et al., Exiguobacterium oxidotolerans, a halotolerant plant growth promoting rhizobacteria, improves yield and content of secondary metabolites in Bacopa monnieri (L.) Pennell under primary and secondary salt stress. 2013. 29(2): p. 379-387.
Berg, G., et al., Symbiotic plant–microbe interactions: stress protection, plant growth promotion, and biocontrol by Stenotrophomonas, in Symbioses and Stress. 2010, Springer. p. 445-460.
Rokhbakhsh-Zamin, F., et al., Characterization of plant-growth-promoting traits of Acinetobacter species isolated from rhizosphere of Pennisetum glaucum. 2011. 21(6): p. 556-566.
Rogel, M.A., et al., Nitrogen-fixing nodules with Ensifer adhaerens harboring Rhizobium tropici symbiotic plasmids. 2001. 67(7): p. 3264-3268.
Patten, C.L., B.R.J.A. Glick, and e. microbiology, Role of Pseudomonas putida indoleacetic acid in development of the host plant root system. 2002. 68(8): p. 3795-3801.
Msaddak, A., et al., Members of Microvirga and Bradyrhizobium genera are native endosymbiotic bacteria nodulating Lupinus luteus in Northern Tunisian soils. 2017. 93(6).
Egamberdiyeva, D. and G.J.P.G.R. Höflich, Root colonization and growth promotion of winter wheat and pea by Cellulomonas spp. at different temperatures. 2002. 38(3): p. 219-224.
van Rhijn, P. and J.J.M.r. Vanderleyden, The Rhizobium-plant symbiosis. 1995. 59(1): p. 124-142.
Timmusk, S., et al., Paenibacillus polymyxa invades plant roots and forms biofilms. 2005. 71(11): p. 7292-7300.
Shafi, J., et al., Bacillus species as versatile weapons for plant pathogens: a review. 2017. 31(3): p. 446-459.
Ongena, M. and P.J.T.i.m. Jacques, Bacillus lipopeptides: versatile weapons for plant disease biocontrol. 2008. 16(3): p. 115-125.
He, X.-Y., et al., Positive correlation between soil bacterial metabolic and plant species diversity and bacterial and fungal diversity in a vegetation succession on Karst. Plant, 2008. 307(1-2): p. 123-134.
Martinez-Absalon, S., et al., Isolation and molecular characterization of a novel strain of Bacillus with antifungal activity from the sorghum rhizosphere. Genetics, Molecular Research, 2012: p. 1-9.
Cao, Y., et al., Bacillus subtilis SQR 9 can control Fusarium wilt in cucumber by colonizing plant roots. Biology Fertility of Soils, 2011. 47(5): p. 495-506.
Mnif, I., et al., Antifungal efficiency of a lipopeptide biosurfactant derived from Bacillus subtilis SPB1 versus the phytopathogenic fungus, Fusarium solani. Environmental Science, Pollution Research, 2015. 22(22): p. 18137-18147.
Sharifi-Tehrani, A., et al., Biocontrol of soil-borne fungal plant diseases by 2, 4-diacetylphloroglucinol-producing fluorescent pseudomonads with different restriction profiles of amplified 16S rDNA. 1998. 104(7): p. 631-643.
Tarkka, M.T., A. Sarniguet, and P. Frey-Klett, Inter-kingdom encounters: recent advances in molecular bacterium–fungus interactions. Current genetics, 2009. 55(3): p. 233-243.
Challis, G.L. and D.A. Hopwood, Synergy and contingency as driving forces for the evolution of multiple secondary metabolite production by Streptomyces species. Proceedings of the National Academy of Sciences, 2003. 100(suppl 2): p. 14555-14561.
Cronin, D., et al., Ecological interaction of a biocontrol Pseudomonas fluorescens strain producing 2, 4-diacetylphloroglucinol with the soft rot potato pathogen Erwinia carotovora subsp. atroseptica. 1997. 23(2): p. 95-106.
Duffy, B.K. and G.J.P. Défago, Zinc improves biocontrol of Fusarium crown and root rot of tomato by Pseudomonas fluorescens and represses the production of pathogen metabolites inhibitory to bacterial antibiotic biosynthesis. 1997. 87(12): p. 1250-1257.
Yutani, M., et al., Alliinase from Ensifer adhaerens and its use for generation of fungicidal activity. AMB express, 2011. 1(1): p. 2.
Rateb, M.E., et al., Induction of diverse secondary metabolites in Aspergillus fumigatus by microbial co-culture. RSC Advances, 2013. 3(34): p. 14444-14450.
Briard, B., C. Heddergott, and J.-P. Latgé, Volatile compounds emitted by Pseudomonas aeruginosa stimulate growth of the fungal pathogen Aspergillus fumigatus. MBio, 2016. 7(2): p. e00219-16.
Melloul, E., et al., Characteristics of Aspergillus fumigatus in association with Stenotrophomonas maltophilia in an in vitro model of mixed biofilm. PloS one, 2016. 11(11): p. e0166325.
Salvioli, A., et al., Endobacteria affect the metabolic profile of their host Gigaspora margarita, an arbuscular mycorrhizal fungus. Environmental Microbiology, 2010. 12(8): p. 2083-2095.
Lumini, E., et al., Endobacteria or bacterial endosymbionts? To be or not to be. New phytologist, 2006. 170(2): p. 205-208.
Izumi, H., et al., Endobacteria in some ectomycorrhiza of Scots pine (Pinus sylvestris). FEMS microbiology ecology, 2006. 56(1): p. 34-43.
Bertaux, J., et al., Occurrence and distribution of endobacteria in the plant‐associated mycelium of the ectomycorrhizal fungus Laccaria bicolor S238N. Environmental Microbiology, 2005. 7(11): p. 1786-1795.
Schloss, P.D. and J. Handelsman, Toward a census of bacteria in soil. PLoS computational biology, 2006. 2(7).
Bianciotto, V., et al., Vertical transmission of endobacteria in the arbuscular mycorrhizal fungus Gigaspora margarita through generation of vegetative spores. 2004. 70(6): p. 3600-3608.
Duponnois, R., J. Garbaye, and Soil, Effect of dual inoculation of Douglas fir with the ectomycorrhizal fungus Laccaria laccata and mycorrhization helper bacteria (MHB) in two bare-root forest nurseries. Plant, 1991. 138(2): p. 169-176.
Duponnois, R. and C. Plenchette, A mycorrhiza helper bacterium enhances ectomycorrhizal and endomycorrhizal symbiosis of Australian Acacia species. Mycorrhizae, 2003. 13(2): p. 85-91.
Al-Dhabi, N.A., et al., Removal of nitrogen from wastewater of date processing industries using a Saudi Arabian mesophilic bacterium, Stenotrophomonas maltophilia Al-Dhabi-17 in sequencing batch reactor. 2021. 268: p. 128636.
Jia, Y., et al., Carbon selection for nitrogen degradation pathway by Stenotrophomonas maltophilia: Based on the balances of nitrogen, carbon and electron. 2019. 294: p. 122114.
Abouseoud, M., et al., Evaluation of different carbon and nitrogen sources in production of biosurfactant by Pseudomonas fluorescens. Desalination, 2008. 223(1-3): p. 143-151.
Mirza, M.S., et al., Molecular characterization and PCR detection of a nitrogen-fixing Pseudomonas strain promoting rice growth. Biology Fertility of Soils, 2006. 43(2): p. 163-170.
Iwasaki, H. and T. Matsubara, A nitrite reductase from Achromobacter cycloclastes. The Journal of Biochemistry, 1972. 71(4): p. 645-652.
Seldin, L., et al., Bacillus nitrogen fixers from Brazilian soils. Plant, 1983. 70(2): p. 243-255.
VanInsberghe, D., et al., Non-symbiotic Bradyrhizobium ecotypes dominate North American forest soils. The ISME journal, 2015. 9(11): p. 2435-2441.
Addison, S.L., et al., Novosphingobium nitrogenifigens sp. nov., a polyhydroxyalkanoate-accumulating diazotroph isolated from a New Zealand pulp and paper wastewater. International Journal of Systematic Evolutionary Microbiology, 2007. 57(11): p. 2467-2471.
Baldani, J., et al., Characterization of Herbaspirillum seropedicae gen. nov., sp. nov., a root-associated nitrogen-fixing bacterium. International Journal of Systematic Evolutionary Microbiology, 1986. 36(1): p. 86-93.
Bedmar, E., E. Robles, and M. Delgado, The complete denitrification pathway of the symbiotic, nitrogen-fixing bacterium Bradyrhizobium japonicum. 2005, Portland Press Ltd.
Proctor, M.H. and P. Wilson, Nitrogen fixation by gram-negative bacteria. Nature, 1958. 182(4639): p. 891-891.
Huang, H.K. and S. Tseng, Nitrate reduction by Citrobacter diversus under aerobic environment. Applied microbiology biotechnology, 2001. 55(1): p. 90-94.
Kumar, V. and R. Gera, Isolation of a multi-trait plant growth promoting Brevundimonas sp. and its effect on the growth of Bt-cotton. 3 Biotech, 2014. 4(1): p. 97-101.
Zhang, D., et al., Removal of ammonium in surface water at low temperature by a newly isolated Microbacterium sp. strain SFA13. Bioresource technology, 2013. 137: p. 147-152.
Ghignone, S., et al., The genome of the obligate endobacterium of an AM fungus reveals an interphylum network of nutritional interactions. The ISME journal, 2012. 6(1): p. 136-145.
Bonfante, P., R. Balestrini, and K.J.N.p. MEND GEN, Storage and secretion processes in the spore of Gigaspora margarita Becker &Hall as revealed by high‐pressure freezing and freeze substitution. 1994. 128(1): p. 93-101.

Download PDF

Version 1

posted

You are reading this latest preprint version

Diversity of Endo and Exo-Bacteria Associated With Fungi Isolated From Plant Rhizospheres: A Pilot Study

Status:

Version 1

Abstract

Figures

1. Background

2. Materials And Methods

2.1. Media

2.2. Isolation of fungi and their associated bacteria from soil using modified microcosm fungal highway columns

2.3. DNA extraction and quality control

2.4. Sequencing and bioinformatics

2.4.1. Identification of Fungal and Exo-bacterial Isolates

2.4.2. Quantification and identification of the fungal endobacterial community

2.5. Confrontation assays to determine fungal-bacteria interactions

2.6. Scanning Electron Microscopy (SEM)

2.7. Fluorescence in situ Hybridization (FISH)

3. Results And Discussion

3.1. Fungal isolation from highway column samplings: relationship with types of plants and media

3.2. Linking fungal and bacterial isolates from the same columns

3.3. Bacterial-fungal interactions: reconstruction of the microbial associations in the soil

3.4. Endo-hyphal microbiome and bacterial-fungal specificity

4. Conclusions

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1