Animal models
To prevent the immunological rejection of the human cell transplant, severely immunodeficient NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice were used. Immunodeficient wild type (WT)/NSG mice were purchased from Charles River Laboratories. The mice were mated with Dmd-null mice [37] to generate immunodeficient Dmd-null/NSG mice, as previously described by Zhao et al. [30]. These mice were used as the DMD disease mouse model in this study. All WT and DMD mice were housed and bred under the same environmental conditions.
For the ATP dynamics study, we used GO-ATeam2 transgenic C57BL/6J male mice (paper under preparation), which enable ATP-level monitoring in living animals [38]. GO-ATeam2 is a fluorescent ATP probe developed by Nakano et al. [39], which uses green and orange fluorescent proteins as Förster resonance energy transfer (FRET) pairs. GO-ATeam2 heterozygous male mice were mated with immunodeficient NSG homozygous Dmd-null heterozygous female mice to create Dmd-null heterozygous females and WT male mice (both heterozygous for GO-ATeam2 and NSG), which were subsequently mated to create the GO-ATeam2 homozygous NSG homozygous Dmd-null (ATPtg Dmd-null/NSG) and WT (ATPtg WT/NSG) male mice used in further experiments. For genotyping, genomic DNA was extracted from mouse tails, and genomic PCR was performed using the Fw-Rv primer pairs listed in Table 1. We analyzed ATP levels in GO-ATeam2 transgenic mice after mouse generation and cell transplantation.
Table 1
List of primers used for genotyping
Target | | Primer pairs | Predicted product size |
Dmd | Wild type | Fw | TGGGCAAGAGTGAATTTTCC | 437bp |
Rv | ACCACCCACTTCAGGTTGAG |
Knock-out | Fw | GAATTCAGCGAGAGCCTGAC | 453 bp |
Rv | GATGTTGGCGACCTCGTATT |
NSG | | Fw | GTGGGTAGCCAGCTCTTCAG | |
Wild type | Rv | CCTGGAGCTGGACAACAAAT | 269 bp |
Knock-out | Rv | GCCAGAGGCCACTTGTGTAG | 349 bp |
GO-ATeam2 | Wild type | Fw | ATTCTGCTTACATAGTCTAACTCGC | 330 bp |
Rv | TGGGCAGGCTTAAAGGCTAA |
Transgenic | Fw | AGAGCCTCTGCTAACCATGTTCATGCCTTC | 342 bp |
Rv | GTGACACTAAGTCAAACGCGAAA |
Immortalized human myoblasts culture
Immortalized human Hu5/KD3 myoblasts [36] were provided by Dr. Naohiro Hashimoto (National Center for Geriatrics and Gerontology, Japan). They were cultured under 37°C and 10% CO2 conditions on 100 mm collagen type I-coated culture dishes (4020-010, Iwaki). The culture medium was Dulbecco’s Modified Eagle Medium (DMEM; 08488-55, Nacalai Tesque) supplemented with 0.5% penicillin–streptomycin mixed solution (09367-34, Nacalai Tesque), 1% L-glutamine (16948-04, Nacalai Tesque), 20% fetal bovine serum (554–02155 then 556-33865, Biosera), and 2% Ultroser G (15950-017, Sartorius). Cells were passaged when they reached full confluence according to the following protocol: Cells were rinsed with Dulbecco’s phosphate-buffered saline (D-PBS; 14249-24, Nacalai Tesque), detached, and dissociated into single cells by adding 2 mL of 2.5 g/L-trypsin/1 mmol/L-EDTA solution (35554-64, Nacalai Tesque) per dish, then centrifugated (190 × g, 5 min, 4°C), resuspended, counted, and seeded at density of 3–5 × 105 cells per dish. Frozen stocks were created in a Bambanker serum-free cryopreservation medium for long-term cell storage (CS-02-001; Nippon Genetics) to ensure experimental reproducibility.
Cell transplantation in DMD mouse model
After cell passages, cell suspensions containing 8–10 × 106 Hu5/KD3 cells (average) were centrifuged (200 × g, 5 min, 4°C), resuspended into 80–100 µL of fresh DMEM, and transferred in 1 mL 27Gx½ syringes (Myjector SS-10M2713, Terumo). Five-week-old Dmd-null/NSG mice were anesthetized by inhalation of 5% isoflurane (1119701G1084, AbbVie, M090AEC, MSD Animal Health K.K.). Their calves were shaved and cleaned with 70% ethanol. The transplantation protocol consisted of two longitudinal intramuscular injections of the Hu5/KD3 cell suspension parallel to the mouse calcaneal tendon in the middle third of each head of the right and left gastrocnemius muscles. Cell transplantation procedures were repeated twice weekly for 3 weeks, with a total of either five or six transplantation sessions, such that the average number of transplanted cells per muscle was adjusted to 50 × 106 cells. To prepare DMD mouse muscles in a regeneration-favorable environment and to maximize cell engraftment potential (paper under preparation), a muscle pre-conditioning exercise was conducted the day before one in two transplantation experiments. The protocol is described in detail in the following section.
Transcutaneous electrical stimulations on mouse skeletal muscles
Under 5% isoflurane (1119701G1084, AbbVie, M090AEC, MSD Animal Health K.K.) inhalation, calf-shaved mice were placed in the lateral decubitus position. The entire lower limb was blocked (knee joint at 60° and ankle joint at 90°), and the foot was fixed on a foot pressure sensor. One electrode (EK-1510SUS, Bio Research Center and PHT2R, Physio-Tech) was placed at the proximal extremity of the calcaneal tendon, and the other was placed 4.5 mm above, on the fleshy part of the gastrocnemius muscle. Electrodes were connected to a biphasic electronic stimulator and an isolator (SEN-3401 and SS-203J, Nihon Kohden) according to the system designed by Itoh et al. [40], such that electrical stimulation resulted in tetanic isometric contraction of the triceps surae muscle. The ankle plantar flexion torque was transmitted from the sensor to a data logger (Midi Logger GL240, Graphtec Corporation) and analyzed using the associated software. 5 V stimuli were used for maximal contractions, and parameters were chosen following the results of Itoh et al. (100 Hz frequency, 1.0 ms duration, 650 ms train duration, and 5.0 mA current). The muscle pre-conditioning exercise before transplantation consisted of one set of 50 repeated isometric contractions (one contraction per second) at 40% of the maximal contraction torque, which was conducted by adjusting the stimulus current value. The parameters were set as follows: 40 Hz frequency, 2.0 ms duration, and 250 ms train duration.
Exercises to generate skeletal muscle fatigue in DMD mice
Two methods were used to induce muscle fatigue in the mouse triceps surae muscles. The first was chosen to be functional, using a 6-lane rodent treadmill (47300-001, Ugo Basile srl), and consisted of a 15-min horizontal constraint treadmill running at 9 m/min speed. The second was an electrical stimulation method used for the ATP imaging study. One set of 50 repeated isometric contractions (one contraction per second) at 10% of the maximal contraction torque to accustom the muscle to repeated contractions, followed by one set of 50 repeated isometric contractions (one contraction per second) at 40% of the maximal contraction torque to generate muscle fatigue, was performed on the gastrocnemius muscles of mice under anesthesia.
In vivo skeletal muscle function assessment outcomes
Muscle maximal-strength function was evaluated using electrically stimulated ankle plantar flexion maximal isometric contraction torque (MCT) assessment at rest. The average of two or three MCT values was used for a more accurate analysis.
Muscle fatigue function was evaluated by generating muscle fatigue according to the previous paragraph and by calculating the muscle fatigue ratio as follows: \(\frac{MCT after muscle fatigue}{MCT at rest}\). As it required anesthesia, MCT at rest was assessed 1–2 days before the treadmill running session or the electrically stimulated repeated isometric contraction session, whereas “MCT after muscle fatigue” outcome was assessed right after the muscle-fatigue session. Mice that stopped running before 15 min because of dyspnea were excluded from the analysis.
Muscle harvest and muscle tissue sample preparation
Mice were euthanized by carbon dioxide gas inhalation right after the last functional evaluation.
For histological analysis, triceps surae muscles were harvested and fixed on cork stands using tragacanth gum (206–02242, Fujifilm Wako). They underwent quick deep freeze in 2-methylbutane (isopentane; 166–00615, Fujifilm Wako) cooled by liquid nitrogen for 1 min and were stored at -80°C for long-term preservation. Muscle samples were sectioned from proximal to distal in a cryostat (Leica CM 1850 and Leica CM 1950, Leica) to obtain 10–14-µm-thick slices on adhesive glass slides (APS-02, APS-03, APS-04, and APS-05, Matsunami). The central part of the muscle, characterized by the largest diameter, was visually identified; a 1.0–1.8 mm muscle portion was sectioned proximally, and a 300–400 µm was sectioned distally. Sample slides were stored at -80°C.
In view of electron microscopy analysis, mice triceps surae muscles were roughly sectioned with a blade and incubated at 4°C in the fixation liquid provided by Tokai Electron Microscopy Inc., which contained 2% paraformaldehyde, 2% glutaraldehyde in 0.1 M phosphate buffer (PB; pH 7.4). After overnight incubation at 4°C, samples were sent to Tokai Electron Microscopy Inc., which conducted further sample preparation steps, observation, imaging, and analysis. According to their protocol description, samples were rinsed, then secondary fixed with 2% osmium tetroxide in 0.1 M phosphate buffer for 2 h at 4°C. After dehydration in graded ethanol from 50–100%, the samples were placed twice in propylene oxide (PO) for 30 min at room temperature and then in a 7:3 mixture of PO and resin (Quetol-812, Nissin EM Co) for 1 h at room temperature. The day after, samples were embedded in fresh resin and heated for 48 h at 60°C. Ultrathin 70 nm sections were prepared by ultramicrotomy (Ultracut UCT, Leica) with diamond knives and copper grids.
To proceed to western blot analysis, mice triceps surae muscles were lysed in radioimmunoprecipitation assay (RIPA) buffer (08714-04, Nacalai Tesque) with protease inhibitor cocktail (25955-11, Nacalai Tesque) diluted in Milli-Q® ultrapure water (IQ 7005, Merck KGaA). First, muscle samples were quickly and carefully homogenized with Bio-Gen PRO2000 (PRO Scientific), then SDS solution (from the RIPA buffer set) was added, and sonication was applied during 4 min 30 s (15 s intervals) at 4°C (Bioruptor, Cosmo Bio Co). Muscle lysates were collected from supernatants after 15 min centrifugation (20400 × g) at 4°C and protein quantification was assessed using Pierce BCA assay kit (23227, Thermo Fisher Scientific) using an EnVision multilabel plate reader (2104, Perkin Elmer).
Fluorescent immunohistochemistry analysis
After muscle tissue sample preparation, the cryosections were stained according to the following protocol. After air-drying, they were fixed with acetone (00310 − 95, Nacalai Tesque) for 7 min at -30°C, washed twice with D-PBS (11482-15, Nacalai Tesque) for 5 min each, blocked with Blocking One solution (03953-95, Nacalai Tesque) for 1 h at room temperature, and incubated with the appropriate primary antibodies diluted in Can Get Signal immunostain Solution B (NKB-601, Toyobo) as referenced in Table 2. Primary antibodies were washed with D-PBS supplemented by 0.2% Triton X-100 (PBS-T; 35501-15, Nacalai Tesque) for 10 min for 3 times, then muscle tissue samples were incubated with the appropriate secondary antibodies and with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) diluted in Can Get Signal immunostain Solution B (NKB-601, Toyobo) as referenced in Table 2. Secondary antibodies were washed once with PBS-T for 5 min and then twice with D-PBS for 5 min. Finally, muscle tissue samples were mounted with Vectashield antifade mounting medium with DAPI (H-1200, Vector Laboratories) under a protective micro-cover glass (No.1, Matsunami) and temporarily stored at 4°C under a light shield until analysis.
Table 2
List of antibodies and dyes used for immunohistochemistry (IHC) and western blot (WB)
| Target molecule | Host species and isotype (clonality) | Dilution ratio | Incubation conditions | Reference |
Primary antibodies | Mouse and human dystrophin | Rabbit IgG (polyclonal) | 1 : 200 (IHC) or 1 : 500 (WB) | 4°C, 1 (IHC, WB) or 2 overnight (IHC) | ab15277, abcam |
Human and mouse Laminin-2 (α-2-chain) | Rat IgG1 (monoclonal) | 1 : 50 (IHC) | 4°C, 1 or 2 overnight (IHC) | ALX-804-190, Alexis |
Human and mouse myosin heavy chain type I | Mouse IgG2b (monoclonal) | 1 : 200 (IHC) | 4°C, overnight (IHC) | BA-D5, Developmental Studies Hybridoma Bank |
Human and mouse myosin heavy chain type IIA | Mouse IgG1 (monoclonal) | 1 : 200 (IHC) | 4°C, overnight (IHC) | SC-71, Developmental Studies Hybridoma Bank |
Mouse myosin heavy chain type IIB | Mouse IgM (monoclonal) | 1 : 200 (IHC) | 4°C, overnight (IHC) | BF-F3, Developmental Studies Hybridoma Bank |
Human and mouse mitochondrial OXPHOS complexes (① anti-CI subunit NDUFB8 ; ② anti-CII-30kDa ; ③ anti- CIII-Core protein 2 ; ④ anti-CIV subunit I ; ⑤ anti-CV alpha subunit ) | ① Mouse IgG1 (monoclonal) ② Mouse IgG2a (monoclonal) ③ Mouse IgG1 (monoclonal) ④ Mouse IgG2a (monoclonal) ⑤ Mouse IgG2b (monoclonal) | 1 : 1000 (WB) | 4°C, overnight (WB) | ab110413, abcam ① ab110242 ② ab14714 ③ ab14745 ④ ab14705 ⑤ ab14748 |
Secondary antibodies | Rabbit IgG (H + L), Alexa Fluor® 488 conjugated | Goat IgG (polyclonal) | 1 : 500 (IHC) | Room temperature, 1 hour (IHC) | A11034, Thermo Fisher Scientific |
Rabbit IgG (H + L), Alexa Fluor® 568 conjugated | Goat IgG (polyclonal) | 1 : 500 (IHC) | Room temperature, 1 hour (IHC) | A11036, Thermo Fisher Scientific |
Rabbit IgG (H + L), peroxidase conjugated | Goat IgG (polyclonal) | 1 : 20000 (WB) | Room temperature, 1 hour (WB) | PI-1000, Vector Laboratories |
Rabbit IgG, biotinylated | Goat IgG (polyclonal) | 1 : 500 (IHC) | Room temperature, 1 hour (IHC) | BA-1000, Vector Laboratories |
Rat IgG (H + L), Alexa Fluor® 647 conjugated | Goat IgG (polyclonal) | 1 : 500 (IHC) | Room temperature, 1 hour (IHC) | A21247, Thermo Fisher Scientific |
Rat IgG (H + L), Alexa Fluor® 568 conjugated | Goat IgG (polyclonal) | 1 : 500 (IHC) | Room temperature, 1 hour (IHC) | A11077, Thermo Fisher Scientific |
Rat IgG (H + L), Alexa Fluor® 488 conjugated | Goat IgG (polyclonal) | 1 : 500 (IHC) | Room temperature, 1 hour (IHC) | A-11006, Thermo Fisher Scientific |
Mouse IgG2b (γ2b), Alexa Fluor® 488 conjugated | Goat IgG (polyclonal) | 1 : 500 (IHC) | Room temperature, 1 hour (IHC) | A21141, Thermo Fisher Scientific |
Mouse IgG1 (γ1), Alexa Fluor® 488 conjugated | Goat IgG (polyclonal) | 1 : 500 (IHC) | Room temperature, 1 hour (IHC) | A21121, Thermo Fisher Scientific |
Mouse IgM (mu chain specific), biotinylated | Goat IgG (polyclonal) | 1 : 100 (IHC) | Room temperature, 45 min (IHC) | BA-2020, Vector Laboratories |
Mouse IgG, peroxidase conjugated | Horse | 1 : 20000 (WB) | Room temperature, 1 hour (WB) | PI-2000, Vector Laboratories |
DAPI | Adenine-thymine-rich regions in DNA | - | 1 : 5000 (IHC) | Room temperature, 1 hour (IHC) | D1306 Thermo Fisher Scientific |
Myosin heavy chain type IIB was stained combining conventional immunohistochemistry with alkaline phosphatase (AP) enzyme-based coloration systems, according to the following steps: fixed muscle tissue samples underwent 15 min blocking with 10% normal goat serum (NGS) in PBS-T, overnight incubation with primary antibody diluted in 15% NGS in PBS-T (Table 2), washing, 45 min incubation with biotinylated secondary antibody, washing, 30 min incubation with Vectastain ABC-AP reagent (AK-50000, Vector Laboratories), washing, and a final 7-min incubation with ImmPact Vector Red AP substrate working solution (SK-5105, Vector Laboratories). For the last step, the red coloring reaction was monitored under a microscope and stopped by plunging the sample slides into Milli-Q® ultrapure water (IQ 7005, Merck KGaA). The previously described fluorescent immunostaining protocol was used to detect and analyze other proteins in the same samples.
Other histochemistry analysis
To study skeletal muscle damage, Evans blue dye (EBD; E2129-10G, Sigma-Aldrich) was dissolved in D-PBS (11482-15, Nacalai Tesque) to prepare a 10 mg EBD/mL D-PBS solution. Under 5% isoflurane (1119701G1084, AbbVie, M090AEC, MSD Animal Health K.K.) inhalation, 100 µL of EBD solution were intravenously injected in the mouse penile vein using 1 mL 27Gx½ syringe (Myjector SS-10M2713, Terumo), one day before the last functional evaluation and muscle harvest. EBD macroscopically stains the damaged myofibers in blue [41]. To localize EBD at the cellular level, cryosections were observed under a fluorescence microscope equipped with 568 nm activation filters, as EBD emits reddish fluorescence when exposed to green light. Thus, because damaged myofibers can be detected microscopically using red fluorescence, they could be studied in combination with other immunohistochemical protocols.
Muscle tissue samples were stained with hematoxylin (purple nuclei) and eosin (pink cytoplasm) for histological analysis. The fixed sample slides were plunged into Mayer’s hemalum solution (1.09249.0500, Sigma-Aldrich) for 3 min, rinsed under a continuous water stream for 20 min, immersed in a 0.5% aqueous eosin Y solution (1.09844.1000, Sigma-Aldrich) for 6 min, and finally rinsed under a continuous water stream for 3 min. After 15 min air-drying, samples were mounted on a clean bench with one drop of Mount Quick (Daigo Sangyo) and protected using a micro-cover glass (No.1, Matsunami).
Fibrosis was studied by collagen type I and II staining under the following protocol: after 30 min of air-drying, the fixed samples were mounted with Picrosirius Red F3BA (Solution B; 24901B-250, Polysciences Inc.) for 90 min, followed by 0.1 N hydrochloride acid (Solution C; 24901C-250, Polysciences Inc.) twice for 1 min. Thereafter, the slides were plunged into Milli-Q® ultrapure water (IQ 7005, Merck KGaA) for 1 s and into 70% ethanol (14712-05, Nacalai Tesque) in Milli-Q® ultrapure water for 30 s. After an additional 20 min of air-drying, the samples were mounted on a clean bench using one drop of Mount Quick (Daigo Sangyo) and protected using a micro-cover glass (No.1, Matsunami).
Muscle samples were sent to Tokai Electron Microscopy Inc. for mitochondria observation using transmission electron microscopy (TEM). According to the manufacturer’s protocol, ultrathin muscle samples sectioned by ultramicrotomy were placed in 2% uranyl acetate for 15 min at room temperature and stained with a lead stain solution (Sigma-Aldrich) for 3 min at room temperature.
Mitochondrial activity was analyzed in muscle tissue samples using reduced nicotinamide adenine dinucleotide-tetrazolium reductase (NADH-TR) oxidative enzyme staining, complementary to dystrophin staining. After air-drying, muscle tissue samples were incubated for 30 min at 37°C with β-nicotinamide adenine dinucleotide (N8129, Sigma-Aldrich) and nitro blue tetrazolium (D0844, Tokyo Chemical Industry) diluted in 0.05 M Tris-HCl buffer (35436-01, Nacalai Tesque). The reaction was stopped by successive quick immersion in 60%, 90%, 60%, and 0% acetone (00310 − 95, Nacalai Tesque) in Milli-Q® ultrapure water (IQ 7005, Merck KGaA). Dystrophin was then stained using the AP enzyme-based coloration method to detect red fluorescence, as described in the previous paragraph. Finally, after washing for 5 min and air-drying for 5 min, the samples were mounted with Aqua-Poly/Mount solution (18606-20, Polysciences Inc.) under a protective micro-cover glass (No. 1, Matsunami) and stored at room temperature until analysis.
Western blot analysis
For western blot analysis, proteins from muscle lysates (preparation described in previous paragraph; 100 µg for dystrophin detection, 20 µg for mitochondrial complexes) were mixed with 10% NuPAGE sample reducing agent (10x; NP0004, Thermo Fisher Scientific), 25% NuPAGE LDS sample buffer (4x; NP0007, Thermo Fisher Scientific), and Milli-Q® ultrapure water (IQ 7005, Merck KGaA). After protein denaturation (except for mitochondrial complexes), muscle lysates were loaded with Protein Ladder One Plus (19593-25, Nacalai Tesque) in NuPAGE 3–8% Tris-Acetate gels (NW04122BOX, Thermo Fisher Scientific) for dystrophin detection or in Bolt 4–12% Bis-Tris Plus gels (EA0375BOX, Thermo Fisher Scientific) for mitochondrial complex detection. A mitochondrial extract from rat heart tissue lysate (ab110341, Abcam) was used as a positive control for mitochondrial complex detection. Protein separation by electrophoresis was conducted in mini-gel tanks (A25977; Thermo Fisher Scientific) with the corresponding SDS running buffer (LA0041 or B0002; Thermo Fisher Scientific) under the following settings: 150 V, 300 mA, 60 min. Dry transfer was performed on PVDF membranes (IB401002; Thermo Fisher Scientific) using an iBlot gel transfer device (IB1001; Thermo Fisher Scientific). After rinsing with Tris-buffered saline (TBS; 12748-31, Nacalai Tesque) supplemented with 0.05% Triton X-100 (TBS-T; 35501-15, Nacalai Tesque), the membranes were blocked with Blocking One solution (03953-95, Nacalai Tesque) for 1 h at room temperature and incubated with the appropriate primary antibodies diluted in Can Get Signal immunoreaction enhancer solution 1 (NKB-101, Toyobo) as referenced in Table 2. Primary antibodies were washed with TBS-T for 10 min 3 times, then the membranes were incubated with the appropriate secondary antibodies diluted in Can Get Signal immunoreaction enhancer solution 2 (NKB-301, Toyobo), as shown in Table 2, and washed again with TBS-T for 10 min 3 times. Membranes were mounted with SuperSignal West Femto Maximum Sensitivity Substrate (34094 or 34095, Thermo Fisher Scientific), and proteins were detected using Amersham ImageQuant 800 (IG800, Cytiva) in chemiluminescence mode. After imaging, membranes were washed and stained with Coomassie brilliant blue staining (CBB; 11642-31, Nacalai Tesque) for 5 min, rewashed with Milli-Q® ultrapure water (IQ 7005, Merck KGaA), and dried. A second detection in colorimetric mode was performed to evaluate the total protein amount per lane. Quantitative analysis after western blot experiments was conducted using ImageJ software, and the ratios of the proteins of interest were normalized to the ratios of the total detected proteins.
In vivo live imaging of ATP levels
ATP imaging experiments were performed in the Yamamoto Laboratory (National Cerebral and Cardiovascular Center, Osaka, Japan) equipped with a fluorescence macro-microscope for live imaging, as described by Choi et al. [42]. Under anesthesia, one leg of the mice was attached to a home-made foot holder connected to a force transducer. Thereafter, gastrocnemius muscle was exposed, placed under the objective lens, and electrically stimulated via skin electrodes attached parallelly to the muscle long axis. Ten images per second of ATPtg Dmd-null/NSG (randomly transplanted into the right or left leg) and ATPtg WT/NSG mouse gastrocnemius muscles were captured while undergoing muscle fatigue created by electrically stimulated repeated isometric contractions. The detailed protocol for repeated contractions and electrical stimulation parameters has been described in the previous paragraphs.
Image analysis
Stained muscle tissue samples were examined under a confocal laser scanning microscope (LSM710, Zeiss) and then imaged with a 10× objective for quantitative analysis (HS All-in-one fluorescence microscope BZ-X700, Keyence) and a 20× objective to obtain higher quality images for qualitative analysis (LSM900, Zeiss and BZ-X800, Keyence). Quantitative analysis was performed using the BZ-X Analyzer software (Keyence). For dystrophin and EBD analyses, 2 slides were selected for each DMD muscle (1 for WT muscles) at less than 50 µm proximo-distal from the middle of the muscle. The number of dystrophin-supplemented myofibers and EBD-positive muscle cross-sectional area (CSA) were analyzed, and the maximal value was retained as measurement. Myosin heavy chain staining for myofiber-type analysis was performed on slides that were proximodistally close to the slide with the highest number of dystrophin-positive fibers out of the two previously counted. Laminin analysis was performed to study single myofiber CSA, minor axis, number, whole muscle tissue CSA, total muscle CSA, and ratio calculations. The staining intensity of NADH-TR was analyzed using BZ-X Analyzer software (Keyence). For electron microscopy analysis, lead-stained muscle tissue samples were imaged using a transmission electron microscope (100 kV of acceleration voltage; JEM-1400Plus, JEOL Ltd.) equipped with a CDD camera (EM-14830RUBY2, JEOL Ltd.) by Tokai Electron Microscopy, Inc. ATP imaging was performed using MetaMorph software (Molecular Devices, USA), as described by Choi et al. [38, 42]. The time-point for ATP-level evaluation at rest was chosen just before the start of repeated muscle contractions, while the time-point for ATP-level evaluation after muscle fatigue was chosen after the stop of the contraction session, just before “MCT after muscle fatigue” was evaluated. The ATP level ratio was calculated as follows: \(\frac{ATP level after muscle fatigue}{ATP level at rest}\).
Statistical analysis
Data are presented as the mean ± standard error of the mean. Statistical comparison between three groups (mostly for WT, untreated DMD, and dystrophin supplemented-DMD mice) or more was performed by one-way analysis of variance (ANOVA) followed by a multiple comparisons test using post-hoc Tukey honestly significant difference test on Prism 9 software (GraphPad). Statistical comparisons between the two groups were performed using the Student’s t-test. Spearman’s correlation test, Shapiro–Wilk normality test, and receiver operating characteristic (ROC) curve analysis were performed using modified R Commander software (EZR version from Jichi Medical University Saitama Medical Center, Japan) to clarify the link between the number of dystrophin-supplemented fibers and functional outcomes. A p-value of less than 5% was considered statistically significant for all statistical analyses. In the figures, “*” indicates 0.01 ≤ p < 0.05, “**”0.001 ≤ p < 0.01, “***”0.0001 ≤ p < 0.001, and “****”p < 0.0001; “N.S.” indicates that the difference was not statistically significant.