Patient samples
Patient samples collected from 31 AML patients and 20 corresponding healthy volunteers between 2017 and 2018 are from the First Hospital Affiliated to Nanjing Medical University and the First Hospital Affiliated to Soochow University. Peripheral blood mononuclear cells (PBMCs) and bone marrow mononuclear cells (BMMCs) were isolated using density gradient centrifugation with Lymphoprep™ (Stemcell technologies, Canada) and written informed consent was obtained from each participant.
Cell culture and transfection
Leukemia cell lines K562, NOMO1 and HEL purchased from Cobioer (Nanjing, China) were maintained at 37°C with 5% CO2 in 1640 Medium, supplemented with penicillin/streptomycin (100 µg/ml) (PS, Gibco, Grand Island, USA), and 10% fetal bovine serum (Yeasen, Shanghai, China). HEK-293T was purchased from X-Y Biotechnology (Shanghai, China) and maintained at 37°C with 5% CO2 in DMEM Medium, supplemented with PS, 10% FBS. The cell lines used in this study were authenticated by STR profiling. Lentiviral shRNA vectors were co-transfected into 293T cells with the packaging vectors psPAX2 (Addgene) and pCI-VSVG (Addgene) using a calcium phosphate method to produce viable lentivirus. And KEL overexpressing lentivirus were synthesized by Hanbio Company (Shanghai, China). Cells were transfected with shRNA or the KEL overexpressing lentivirus according to the manufacturer’sinstructions. Transfection efficiency was determined by real-time quantitative PCR and western blot.
Cell Proliferation assay
To detect cell proliferation ability, CCK8 (cell counting kit-8) assays were performed and cells with different treatment were plated in 96 well plates. 10μl CCK8 solution (Beyotime, Shanghai, China) was added at pointed times, then the spectrophotometrically at 450nm was measured by automatic microplate reader (Synergy H1MF; BioTek, Winooski, USA) after incubated at 37°C for 3h. Experiments were run in triplicate.
Chromatin immunoprecipitation assays (ChIP)
ChIP assays were performed using the Magna ChIP A - Chromatin Immunoprecipitation Kit according to the manufacturer’s instruction (Cat. 17610, Millipore, USA). The antibodies for Histone H3 (Cat. ab1791) and H3 trimethyl Lys4 (H3K4me3, Cat. ab8580) were from Abcam and acetyl-histone H3 Lys27 (H3K27Ac, Cat. 4353T) was from Cell Signaling Technology. The ChIP primers were listed in Additional file 5: Table. S2. Quantification of immunoprecipitated DNA was performed using qPCR. ChIP data was calculated as a percentage relative to the input DNA from the equation 2[Input Ct − Target Ct] × 100 (%).
Electrophoresis mobility shift assay (EMSA)
To perform the electrophoresis mobility shift assay (EMSA), nuclear extracts were prepared with K562 cells using the NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific). Probes were designed according to previous study [6] and generated by Zoonbio Biotechnology. The sequence of biotin labeled probes are: 5' GCCACAGAAGATAGACAGATGGTA 3' (F), 5' TACCATCTGTCTATCTTCGTGTGGC 3' (R). Electrophoresis was performed with 8 percent non-denatured polyacrylamide gel and the gel was dried and subjected to autoradiography.
RNA isolation and Real-time fluorescence RT-qPCR
Total RNA was isolated using the Trizol method (Ambion, USA). cDNA was generated by HiScript reverse transcriptase (Vazyme, Nanjing, China). Gene expression was examined with the Hieff TM qPCR SYBR Green Master Mix (YEASEN, Shanghai, China). Primers used in this study are listed Additional file 5: Table. S2.
Animal studies
To evaluate the changes of related carcinogenic characteristics of KEL in vivo, 6-week-old male NOD-Prkdcem26Cd52Il2rgem26Cd22/Nju (T001475) mice were used. Mice were irradiated from X-ray source with a dose of 150 cGy and taken to detect the efficacy of myeloablative treatment. And the bone marrow cells of mice receiving irradiation significantly decreased. The K562 cells (2×106/200 µl) with or without KEL over-expression were injected into each irradiated recipient mice through the tail vein in 48h. PBS was injected as control. The weight and WBCs (white blood cells) were monitored closely. Luciferase signal intensity was detected at week 5. The mice were put to death after they met the euthanasia criteria or bear tumor for 8 weeks, then the immunohistochemical analysis and H&E staining were performed. Mice were euthanized by intraperitoneal injection of pentobarbital (150 mg/kg i.p.). All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC, approval No. NRCMM19).
Western blot
Proteins were obtained from cells lysed in RIPA protein lysate (Beyotime, Shanghai, China) supplemented with protease and phosphatase inhibitors (Roche). Quantification of protein was conducted with Bicinchoninic Acid Protein Assay Kit (Thermo Scientific, USA). Protein samples were separated by 4–12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes. Blocked in 5% skim milk for 2 h at room temperature, the membrane was in diluted primary antibody overnight at 4 °C. Washing with TBST, the membrane was then incubated with a secondary antibody. The band signals were visualized and quantified using the Quantity One system (Bio-Rad, Hercules, CA, USA). GAPDH and β-actin were selected to be the loading controls. All the antibodies employed in this study were listed in Additional file 6: Table. S3.
Luciferase assay
The KEL promoter sequences of 4 segments were synthesized (3 segments 600bp and 1 segment 500bp), and the vectors pGL3-KEL1,pGL3- KEL2,pGL3- KEL3,pGL3- KEL4 were constructed respectively. The promotor sequences were shown in Additional file 7: Table. S4. HEK 293T cell with 70-80% confluency was transfected using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) with the pKEL constructs or an empty pGL3vector, and pcDNA3.1/TAL1 or GATA1 or an empty pcDNA3.1 vector and pRL-TK Renilla luciferase reporter vector (Promega, Madison, WI, USA). Luciferase and renilla signals were determined 48 h after transfection using the Dual Luciferase Reporter Assay Kit (Promega, Madison, WI, USA) according to a protocol provided by the manufacturer. The relative luciferase activities were calculated based on Firefly/Renilla fluorescence. Three independent experiments were performed and the data are presented as mean ± SD.
Statistical analysis
GraphPad Prism 8.0 (GraphPad Software, Inc., La Jolla, CA, USA) was used for data analysis and imaging. Results were presented as the mean ± SD for at least three repeated independent experiments and calculated using Student's t-test. In all cases, a p value < 0.05 was considered as statistically significant.