FZD5 induces chemoresistance through ALDH1A1 in ovarian cancer

doi:10.21203/rs.3.rs-3875162/v1

Download PDF

Research Article

FZD5 induces chemoresistance through ALDH1A1 in ovarian cancer

https://doi.org/10.21203/rs.3.rs-3875162/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 27 Mar, 2024

Read the published version in Cell Communication and Signaling →

You are reading this latest preprint version

Chemoresistance is associated with tumor relapse and unfavorable prognosis. Multiple mechanisms underlying chemoresistance have been elucidated, including stemness and DNA damage repair. Here, the involvement of WNT receptor FZD5 in ovarian cancer (OC) chemoresistance was investigated. Function studies on OC cells showed that FZD5 contributes to epithelial phenotype maintenance, growth, stemness, homologous recombination (HR) repair, and chemoresistance. Mechanistically, FZD5 modulates the expression of ALDH1A1, a functional marker for cancer stem-like cells (CSCs), in a β-catenin-dependent manner. ALDH1A1 activates Akt signaling, further upregulating RAD51 and BRCA1 to promote HR repair. Taken together, these findings demonstrate that FZD5-ALDH1A1-Akt pathway is responsible for the survival of OC cells, and targeting this pathway can sensitize OC cells to DNA-damaging therapy.

Chemoresistance

Stemness

Homologous recombination repair

DNA-damaging therapy

Ovarian cancer

Ovarian cancer (OC) is a highly lethal disease. Chemotherapy remains one of the major therapies for OC. Enhancing the sensitivity to chemotherapy can prevent or delay OC relapse, and improve patient survival. Cancer stem-like cells (CSCs) are a small subpopulation of cancer cells with self-renewal and some other normal stem cell features. These cells are resistant to conventional chemotherapy and radiotherapy. In OC, ALDH-positive (ALDH⁺) cells exhibit stem-like characteristics and chemoresistance [1, 2]. Targeting ALDH1A1, a member in ALDH1 family, not only suppresses OC initiation and growth, but also sensitizes OC cells to chemotherapeutic drug platinum [3–5].

Homologous recombination (HR) is an important repair mechanism for DNA double-strand breaks (DSBs)[6, 7]. Some factors including recombinase RAD51 and breast cancer susceptibility gene 1/2 (BRCA1/2) play crucial roles in this process. As DSBs seriously threaten genome integrity and stability, HR defect, for example BRCA1/2 mutation, increases the risk of tumorigenesis. However, HR-deficient tumors are sensitive to DNA-damaging agents. On the contrary, HR-proficient tumors have enhanced HR repair capacity, and are more tolerant to DNA damage. Therefore, inhibiting HR repair is a feasible strategy to sensitize HR-proficient tumors to DNA-damaging drugs such as Cisplatin and PARP inhibitor (PARPi) [8, 9].

CSCs in general are resistant to DNA damage, which facilitates their survival upon chemotherapy and radiotherapy [10, 11]. ALDH1A1 downregulation or inhibition induces DNA damage, indicating that ALDH1A1 contributes to not only stemness but also DNA damage repair [5, 12]. In the present study we identified that ALDH1A1 is a downstream effector of FZD5-β-catenin pathway. Through ALDH1A1 and Akt, FZD5 promotes stemness and HR repair, thereby inducing OC cell chemoresistance.

2.1. Cell culture and transfection

OC cells OVCAR3, SKOV3 and CAOV3 were cultured in DMEM (Hyclone) containing 10% fetal bovine serum (FBS) in a humidified incubator with 5% CO₂ at 37℃. OVCAR3, SKOV3 and CAOV3 cells were transfected with shFZD5 lentivirus (GV112/hU6- MCS-CMV-Puromycin, Genechem, China) to stably knockdown FZD5 expression. Puromycin (2 µg/ml, Sigma) was used to select cells at 48 hours after infection. The target sequence for shFZD5-1 is 5′-CGGCATCTTCACGCTGCTCTA-3′, for shFZD5-2 is 5′-GGCCACCTTCCTCATCGACAT-3′, and for control is 5′-TTCTCCGAACGTGTCACGT-3′. FZD5-knockdowned cells was transfected with ALDH1A1 overexpression plasmid (GV219/CMV-MCS-SV40-Neomycin, Genechem, China), using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions.

2.2. Western blot

Cells are lysed using RIPA lysis buffer containing 1% PMSF for 1 hour on ice. The cell lysates were centrifuged at 12,000×g for 40 minutes at 4℃. The protein concentration of the supernatant was determined using a BCA assay. Total protein lysate (30µg) was separated by gel electrophoresis on a 12% SDS-PAGE gel and transferred to a PVDF membrane. The membranes were blocked in Tris-buffered saline-Tween 20 (TBST) containing 5% skimmed milk for 2 hours at room temperature. The membranes were incubated with primary antibodies at 4℃ overnight. Subsequently, the membranes were washed 3 times with TBST and then incubated with secondary antibodies for 2 hours at room temperature. The chemiluminescence (ECL) detection system (Tanon 5200, Shanghai, China) was applied for the imaging of the target protein expression. The following primary antibodies were used: FZD5 (Cell Signaling Technology, #5266, USA, 1:1000), E-cadherin (Cell Signaling Technology, #3195, USA, 1:1000), ALDH1A1 (Santa Cruz, sc-374076, USA, 1:500), BRCA1 (Cell Signaling Technology, #9010, USA, 1:1000), RAD51 (Abcam, ab133534, UK, 1:1000), active β-catenin (Cell Signaling Technology, #8814, USA, 1:1000), Akt (Cell Signaling Technology, #9272, USA, 1:1000), pAkt (Cell Signaling Technology, #9271, USA, 1:1000), pErk1/2 (Cell Signaling Technology, #4370, USA, 1:1000), and pJnk1/2 (Cell Signaling Technology, #9251, USA, 1:1000).

2.3. Immunofluorescence

Cells were inoculated on slides in 24-well plates at 40–50% confluence and grown in an incubator at 37℃ for 24 hours. Then the cells were fixed with paraformaldehyde for 20 minutes and washed with PBS 3 times. Cells were permeabilized with 0.5% Triton X-100 for 5 minutes at room temperature, then blocked with 5% donkey serum for 1 hour at room temperature and incubated with primary antibody at 4℃ overnight. Subsequently, the slides were incubated with fluorescent secondary antibody for 2 hours. The nuclei were stained with DAPI in the dark and visualized using a laser scanning confocal microscopy. The following primary antibodies were used: E-cadherin (Cell Signaling Technology, #3195, USA, 1:200), EPCAM (Immunoway, YM6053, USA, 1:100), γH2AX antibody (Cell Signaling Technology, #9718, USA, 1:400), and active β-catenin (Cell Signaling Technology, #8814, USA, 1:800).

2.4. Phalloidin staining

Cells were fixed with 4% paraformaldehyde at room temperature for 10 minutes. The slides were washed with PBS 3 times, and incubated with 0.5% Triton X-100. Then the slides were incubated with TRITC-conjugated Phalloidin solution (YEASEN, Shanghai, China) at room temperature for 30 minutes. The nuclei were stained with DAPI. Cell morphology was visualized by a laser scanning confocal microscopy.

2.5. Correlation analysis of gene expression

Gene expression at mRNA levels in a panel of human OC cell lines was investigated in CCLE database. Correlation analysis among genes, including FZD5, CDH1, EPCAM, ALDH1A1, ALDH1A2, ALDH1A3, ALDH1B1, ALDH1L1 and ALDH1L2, was performed by Pearson statistics.

2.6. Cell proliferation assay

Cells (OVCAR3: 10³; SKOV3: 2×10³; CAOV3: 10³) were resuspended with 100µl medium, seeded into 96 wells plates and incubated for the indicated length of time. Then cells were treated with a 10µl Cell Counting Kit-8 reagent (CCK8, Dojindo Molecular Technologies, Japan) and incubated at 37℃ for 4 hours. Absorbance values at 450 nm were measured at different time points using a microplate reader (Bio-Rad Laboratories, USA).

2.7. Colony formation

2×10³ cells were seeded and cultured in 3.5cm culture dishes for 2 weeks until visible colonies formed. Cells were then fixed with 4% paraformaldehyde for 20 minutes. Colonies were washed with PBS, stained with 1% crystal violet for 20 minutes, counted and photographed.

2.8. Cell cycle assay

1×10⁶ cells were collected, washed with PBS and fixed with 70% ethanol at 4℃ overnight. Then cells were treated with 500ul PI/RNaSeA staining solution (KeyGEN BioTECH, China) for 1 hour at room temperature in the dark. The samples were analyzed by an FACS Calibur Flow Cytometer (BD, USA).

2.9. Real-time PCR

RNAiso Plus (Takara, China) was added to the collected cells to extract total RNA following the standard instructions. After RNA quantification, reverse transcription was performed with the cDNA synthesis Kit (Takara, RR047A, China) with 1µg RNA. Then Real-time PCR was performed with a TB Green™ Premix Ex Taq II kit (Takara, China) and an ABI PRISM 7300 Sequence Detection system (Applied Biosystems, USA). GAPDH was used as internal control. Gene expression was analyzed by 2^−ΔΔ Ct method. The primers are listed in Table 1.

Table 1

Primers for real-time PCR
genes	Primers (5′–3′)
FZD5-forward FZD5-reverse ALDH1A1-forward ALDH1A1-reverse RAD51-forward RAD51-reverse BRCA1-forward BRCA1-reverse GAPDH-forward GAPDH-reverse	TCCTCTGCATGGATTACAACC GACACTTGCACACGAACG GACAATGCTGTTGAATTTGCAC AAGGATATACTTCTTAGCCCGC TGGCAGTGGCTGAGAGGTATGG GGTCTGGTGGTCTGTGTTGAACG AGGTCCAAAGCGAGCAAGAGAATC CTGTGGGCATGTTGGTGAAGGG CAGGAGGCATTGCTGATGAT GAAGGCTGGGGCTCATTT

Table 2

Abbreviations
OC HR CSCs PARPi GPCR EMT	ovarian cancer homologous recombination cancer stem-like cells PARP inhibitor G protein-coupled receptor epithelial-mesenchymal transition

2.10. ALDH⁺ subpopulation assay

1×10⁶ cells were suspended in 1ml ALDEFLUOR™ Assay Buffer (STEMCELL Technologies, USA). 5µl ALDEFLUOR™ Reagent was added in each tube. Then the mixture was divided into two equal parts. Diethylaminobenzaldehyde (DEAB) was added into one part as negative control. After incubation at 37℃ for 45 minutes and centrifugation, cells were re-suspended in 500µl ALDEFLUOR™ Assay Buffer. The samples were analyzed by an FACS Calibur Flow Cytometer (BD, USA).

2.11. Extreme limiting dilution analysis

Cells (100, 50, 25, 10/well) were cultured in complete MammoCultTM Human Medium (STEMCELL Technologies, USA) in 96-well ultra-low-attachment plates (Corning, USA) for 7 days. Stemness was evaluated in https://bioinf.wehi.edu.au/software/elda/.

2.12. HR repair assay

Cells were transiently co-transfected with DR-GFP and I-SceI plasmids (Genechem, China) using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. Then cells were cultured for 3 days. The percentage of GFP⁺ cells was analyzed by an FACS Calibur Flow Cytometer (BD, USA).

2.13. Cytotoxicity assay

After inoculation into 96-well plates at a density of 5000/well overnight, cells were treated with Cisplatin or Olaparib at different concentrations for 48 hours. Then cells were treated with 10µl CCK8 reagent (Dojindo, Japan) and incubated at 37℃ for 4 hours. Absorbance values at 450nm were measured using a microplate reader (Bio-Rad Laboratories, USA)

2.14. Tumorisphere toxicity assay

5×10³ cells were treated with or without Cisplatin (5µM) in complete MammoCultTM Human Medium (STEMCELL Technologies, USA) in 6-well ultra-low-attachment plates (Corning, USA) for 7 days. Tumor spheres were counted in randomly selected 5 fields.

2.15. Apoptosis assay

1×10⁶ cells were collected and washed with PBS. Annexin V-PE/7- AAD Apoptosis Kit (KeyGEN BioTECH, China) was used to analyze cell apoptosis. Cells were incubated in 500µL binding buffer with 5µL 7-AAD at room temperature in the dark for 15 minutes. The number of apoptotic cells was measured by an FACS Calibur Flow Cytometer (BD, USA).

2.16. Mice and in vivo study

Female BALB/c nude mice (5 ~ 6 weeks of age, 18–20 g) were purchased from Weitong Lihua (Beijing, China), and all mice were maintained in the SPF-grade facility of the Department of Animal Experimentation of China Medical University. All studies involving mice were approved by the Animal Ethics Committee of China Medical University. After resuspension with 100ul PBS, 1×10⁶ OC cells were injected subcutaneously into lateral flanks of the mice (n = 5 per group). Tumor volume was calculated by formula: V = 1/2×length×width². Tumor length and width were measured every 3 days using a vernier caliper. 4 weeks after inoculation, the mice were euthanized and the tumors were harvested. For in vivo chemo-sensitivity assay, mice were given Cisplatin (5mg/kg, intraperitoneal injection) for five consecutive days, once the tumor volume reached approximately 50mm³.

2.17. Statistical analysis

Data were presented as mean ± SD and were analyzed using GraphPad Prism 9. Differences were analyzed by two-sided Student’s t-test, one-way or two-way ANOVA. P value < 0.05 was considered significant.

3.1. FZD5 maintains epithelial phenotype

Our group previously found that FZD5 is implicated in the maintenance of epithelial phenotype in gastric cancer and bladder cancer [13, 14]. To explore whether FZD5 functions similarly in OC, three epithelial OC cell lines were stably transfected with FZD5 shRNA lentiviruses. FZD5 knockdown reduced the expression of E-cadherin, a key marker of epithelial phenotype (Fig. 1A, B). FZD5 knockdown also downregulated the expression of EPCAM, a marker of both epithelial and stem-like phenotypes (Fig. 1C). Consistently, FZD5 knockdown induced a morphologic change from epithelial-like to mesenchymal-like (Fig. 1D). Moreover, CCLE database analysis indicated that FZD5 is positively correlated with CDH1 (the gene encoding E-cadherin) and EPCAM at mRNA levels in OC (Fig. 1E; Fig. S1).

3.2. FZD5 promotes cell growth

Epithelial phenotype is related to OC cell proliferation[15]. Therefore, the role of FZD5 in OC cell growth was investigated. As shown by CCK8 and Colony formation tests, FZD5 knockdown slowed down cell proliferation, and reduced the formed cell colonies (Fig. 2A, B; Fig. S2). FZD5 knockdown decreased S-phase fraction while increased G1-phase fraction, indicating that FZD5 affects the entry of cells into S-phase (Fig. 2C). SKOV3 cells were inoculated into immune-deficient mice to further evaluate the effect of FZD5 on cell growth. It was found that xenograft tumors from FZD5-knockdowned cells grew more slowly than those from control cells (Fig. 2D, E). Together, these results demonstrate that FZD5 facilitates OC growth.

3.3 FZD5 induces stem-like properties

Our previous study revealed that FZD5 modulates ALDH⁺ stem-like cells in breast cancer[16]. To identify the ALDH1 family member targeted by FZD5 in OC, correlation analysis was performed using CCLE database. Among 5 members in ALDH1 family, including ALDH1A1, ALDH1A2, ALDH1A3, ALDH1B1, ALDH1L1 and ALDH1L2, FZD5 is positively correlated with ALDH1A1 (Fig. S3). Then ALDH1A1 expression was examined in OV cells. As expected, FZD5 knockdown downregulated ALDH1A1 at both mRNA and protein levels (Fig. 3A, B). Consistent with this finding, FZD5 knockdown diminished ALDH⁺ stem-like subpopulations (Fig. 3C, D). Extreme limiting dilution analysis (ELDA) further showed that FZD5 knockdown attenuated OC cell stemness (Fig. 3E-G).

3.4. FZD5 enhances HR repair capacity

ALDH1A1 is involved in DNA damage repair in OC [5, 12, 17]. Therefore, whether FZD5 plays a role in this process was determined. After treatment with DNA-damaging drug Cisplatin, FZD5-knockdowned cells displayed more γ-H2AX staining compared to control cells, demonstrating that FZD5 knockdown impaired DNA repair upon DNA damage (Fig. 4A, B). To assess whether FZD5 modulates HR repair, OC cells were co-transfected with I-SceI and DR-GFP plasmids. Fraction of GFP⁺ cells in FZD5-knockdowned cells is significantly lower than that in control cells, indicating that FZD5 knockdown disrupted HR repair (Fig. 4C, D). Mechanistically, FZD5 knockdown reduced the expression of RAD51 and BRCA1, two key factors involved in HR repair (Fig. 4E, F).

3.5. FZD5 endows OC cells with chemoresistance

Both stemness and HR repair are related to therapeutic resistance. Therefore, the role of FZD5 in chemoresistance was subsequently evaluated. Compared to control cells, FZD5-knockdowned cells exhibited a higher sensitivity to Cisplatin (Fig. 5A, Fig. S4A). HR-deficient cells are sensitive to PARP inhibitors (PARPi) due to synthetic lethal. Indeed, FZD5 knockdown sensitized OC cells to Olaparib (Fig. 5B, Fig. S4B). FZD5 knockdown synergized with Cisplatin to inhibit mammosphere formation, indicating that targeting FZD5 also can increase the sensitivity of ovarian CSCs to DNA-damaging agents (Fig. 5C). Moreover, FZD5 knockdown remarkably increased Cisplatin-induced apoptosis (Fig. 5D). Finally, FZD5 knockdown synergized with Cisplatin to suppress the growth of xenograft tumors (Fig. 5E, F).

3.6. ALDH1A1 is a downstream effector of FZD5

FZD5 mediates β-catenin -dependent and -independent pathways [18]. In OC cells, FZD5 knockdown downregulated the expression of active β-catenin, indicating that FZD5 can activate β-catenin pathway (Fig. 6A, B; Fig. S5). To inquire whether FZD5 modulates ALDH1A1 dependent on β-catenin, OC cells were transfected with siRNAs targeting CTNNB1, the gene encoding β-catenin. CTNNB1 knockdown downregulated ALDH1A1 at both mRNA and protein levels (Fig. 6C). To determine whether ALDH1 mediates FZD5-induced HR repair and chemoresistance, ALDH1A1 were overexpressed in FZD5-knockdowned cells. It was found that ALDH1 overexpression restored the expression of RAD51 and BRCA1, and the capacity of DNA damage repair (Fig. 6D, E). Furthermore, FZD5-knockdowned cells with ALDH1A1 overexpression regained the resistance to Cisplatin and Olaparib (Fig. 6F).

3.7. FZD5-ALDH1A1 pathway activates Akt signaling

To elucidate the downstream signaling of FZD5-ALDH1A1 pathway, the phosphorylation of Akt, Jnk and Erk was analyzed in OC cells. FZD5 knockdown repressed the phosphorylation of Akt, but had no effect on that of Jnk and Erk (Fig. 7A). Overexpression of ALDH1A1 in FZD5-knockdowned cells restored the expression of phosphorylated Akt (pAkt) (Fig. 7B). Furthermore, treatment with NCT-501, an ALDH1A1 inhibitor, reduced the expression of pAkt in a dose-dependent manner in OC cells (Fig. 7C). To investigate whether Akt signaling is related to HR repair, OC cells were treated with Akt inhibitor MK-2206. It was found that treatment with MK-2206 decreased the expression of RAD51 and BRCA1, as well as the capacity of DNA damage repair (Fig. 7D, E). These results indicate that FZD5-ALDH1A1-Akt pathway is responsible for HR repair in OC cells (Fig. 7F).

Frizzled (FZDs) belong to the superfamily of seven-transmembrane G protein-coupled receptor (GPCR), containing a highly conserved cysteine-rich domain (CRD). Extracellular WNT molecules bind to CRD to trigger both canonical β-catenin pathway and various β-catenin-independent pathways. There are 10 members, FZD1-FZD10, in human FZD family. FZDs are involved in many human diseases. They affect almost every aspect of tumor development, including tumorigenesis, growth, metastasis, chemoresistance, and recurrence [18]. This study for the first time reported the role of FZD5 in OC chemoresistance.

We found that FZD5 sustains epithelial phenotype of OC cells through modulation of E-cadherin and EPCAM. It is well known that E-cadherin functions as a negative regulator of epithelial-mesenchymal transition (EMT), thus blocking tumor cell invasion and migration. However, studies also revealed that E-cadherin facilitates tumor progression[19, 20]. In OC, E-cadherin promotes cell proliferation and chemoresistance [15, 21]. EPCAM is an epithelial and stem-like dual marker, and EPCAM-high/positive OC cells are more tolerant to chemotherapy than EPCAM-low/negative ones[22].

There are two types of CSCs in breast cancer, mesenchymal-like and epithelial-like [23, 24]. Mesenchymal-like CSCs are CD24⁻CD44⁺, quiescence, and motile due to high expression of mesenchymal markers such as Vimentin. Epithelial CSC are ALDH⁺ and EPCAM⁺, proliferative, and immotile because of high expression of E-cadherin. Ovarian CSCs similarly exhibit heterogeneity[25]. A subpopulation of ovarian CSCs express CD44 and TGFβ1, and are characterized by EMT[26, 27]. As a negative regulator of TGFβ1 signaling, SMAD7 maintains epithelial phenotype of ovarian CSCs, and promotes the colonization at metastatic sites by inducing mesenchymal-epithelial transition (MET) [28].

Our study revealed that FZD5 upregulates E-cadherin and EPCAM, as well as ALDH1A1, indicating that FZD5 maintains epithelial-like CSCs in OC. Consistently, FZD5 promotes cell growth, stemness and chemoresistance. We further found that ALDH1A1 induces HR repair via Akt, which upregulates HR factors RAD51 and BRCA1. ALDH1A1 was also shown to activate Akt signaling in non-small cell lung cancer (NSCLC) and esophageal squamous cell carcinoma (ESCC)[29, 30]. However, the mechanism by which ALDH1A1 induces Akt phosphorylation is unknown.

In summary, FZD5 induces stemness and HR repair, thereby endowing OC cells with the resistance to DNA-damaging agents. Mechanistically, FZD5 promotes ALDH1A1 expression in a β-catenin-dependent manner. ALDH1A1 then activates Akt signaling, upregulating RAD51 and BRCA1 to enhance HR repair. Taken together, these findings demonstrate that FZD5-ALDH1A1-Akt pathway contributes to OC chemoresistance, and targeting this pathway has a potential to sensitize OC cells to DNA-damaging therapy.

Funding

This work was supported by National Natural Science Foundation of China (82172826) and the

Educational Department of Liaoning Province (LJKZ0760).

Conflict of interest statement

The authors declare that there are no conflicts of interest.

Ethics approval

All aspects of this study were approved by the Institutional Research Ethics Committee of China Medical University.

Data Availability

Data will be made available on request.

Wang Y, Zhao G, Condello S, Huang H, Cardenas H, Tanner EJ, Wei J, Ji Y, Li J, Tan Y, et al. Frizzled-7 Identifies Platinum-Tolerant Ovarian Cancer Cells Susceptible to Ferroptosis. Cancer Res. 2021;81(2):384–99.
Guo F, Yang Z, Sehouli J, Kaufmann AM. Blockade of ALDH in Cisplatin-Resistant Ovarian Cancer Stem Cells In Vitro Synergistically Enhances Chemotherapy-Induced Cell Death. Curr Oncol. 2022;29(4):2808–22.
Landen CN Jr., Goodman B, Katre AA, Steg AD, Nick AM, Stone RL, Miller LD, Mejia PV, Jennings NB, Gershenson DM, et al. Targeting aldehyde dehydrogenase cancer stem cells in ovarian cancer. Mol Cancer Ther. 2010;9(12):3186–99.
Yokoyama Y, Zhu H, Lee JH, Kossenkov AV, Wu SY, Wickramasinghe JM, Yin X, Palozola KC, Gardini A, Showe LC, et al. BET Inhibitors Suppress ALDH Activity by Targeting ALDH1A1 Super-Enhancer in Ovarian Cancer. Cancer Res. 2016;76(21):6320–30.
Nwani NG, Condello S, Wang Y, Swetzig WM, Barber E, Hurley T, Matei D. A Novel ALDH1A1 Inhibitor Targets Cells with Stem Cell Characteristics in Ovarian Cancer. Cancers (Basel) 2019, 11(4).
Sun Y, McCorvie TJ, Yates LA, Zhang X. Structural basis of homologous recombination. Cell Mol Life Sci. 2020;77(1):3–18.
Wright WD, Shah SS, Heyer WD. Homologous recombination and the repair of DNA double-strand breaks. J Biol Chem. 2018;293(27):10524–35.
Liu G, Yang D, Rupaimoole R, Pecot CV, Sun Y, Mangala LS, Li X, Ji P, Cogdell D, Hu L et al. Augmentation of response to chemotherapy by microRNA-506 through regulation of RAD51 in serous ovarian cancers. J Natl Cancer Inst 2015, 107(7).
Zhou Q, Huang J, Zhang C, Zhao F, Kim W, Tu X, Zhang Y, Nowsheen S, Zhu Q, Deng M, et al. The bromodomain containing protein BRD-9 orchestrates RAD51-RAD54 complex formation and regulates homologous recombination-mediated repair. Nat Commun. 2020;11(1):2639.
Vitale I, Manic G, De Maria R, Kroemer G, Galluzzi L. DNA Damage in Stem Cells. Mol Cell. 2017;66(3):306–19.
Pilzecker B, Buoninfante OA, Jacobs H. DNA damage tolerance in stem cells, ageing, mutagenesis, disease and cancer therapy. Nucleic Acids Res. 2019;47(14):7163–81.
Meng E, Mitra A, Tripathi K, Finan MA, Scalici J, McClellan S, Madeira da Silva L, Reed E, Shevde LA, Palle K, et al. ALDH1A1 maintains ovarian cancer stem cell-like properties by altered regulation of cell cycle checkpoint and DNA repair network signaling. PLoS ONE. 2014;9(9):e107142.
Dong D, Na L, Zhou K, Wang Z, Sun Y, Zheng Q, Gao J, Zhao C, Wang W. FZD5 prevents epithelial-mesenchymal transition in gastric cancer. Cell Commun Signal. 2021;19(1):21.
Na L, Wang Z, Bai Y, Sun Y, Dong D, Wang W, Zhao C. WNT7B represses epithelial-mesenchymal transition and stem-like properties in bladder urothelial carcinoma. Biochim Biophys Acta Mol Basis Dis. 2022;1868(1):166271.
Dong LL, Liu L, Ma CH, Li JS, Du C, Xu S, Han LH, Li L, Wang XW. E-cadherin promotes proliferation of human ovarian cancer cells in vitro via activating MEK/ERK pathway. Acta Pharmacol Sin. 2012;33(6):817–22.
Sun Y, Wang Z, Na L, Dong D, Wang W, Zhao C. FZD5 contributes to TNBC proliferation, DNA damage repair and stemness. Cell Death Dis. 2020;11(12):1060.
Liu L, Cai S, Han C, Banerjee A, Wu D, Cui T, Xie G, Zhang J, Zhang X, McLaughlin E, et al. ALDH1A1 Contributes to PARP Inhibitor Resistance via Enhancing DNA Repair in BRCA2(-/-) Ovarian Cancer Cells. Mol Cancer Ther. 2020;19(1):199–210.
Sun Y, Wang W, Zhao C. Frizzled Receptors in Tumors, Focusing on Signaling, Roles, Modulation Mechanisms, and Targeted Therapies. Oncol Res. 2021;28(6):661–74.
Roque R, Costa Sousa F, Figueiredo-Dias M. Epithelial-mesenchymal interconversions in ovarian cancer: The levels and functions of E-cadherin in intraabdominal dissemination. Oncol Rev. 2020;14(2):475.
Hu QP, Kuang JY, Yang QK, Bian XW, Yu SC. Beyond a tumor suppressor: Soluble E-cadherin promotes the progression of cancer. Int J Cancer. 2016;138(12):2804–12.
Sun Y, Li S, Yang L, Zhang D, Zhao Z, Gao J, Liu L. CDC25A Facilitates Chemo-resistance in Ovarian Cancer Multicellular Spheroids by Promoting E-cadherin Expression and Arresting Cell Cycles. J Cancer. 2019;10(13):2874–84.
Tayama S, Motohara T, Narantuya D, Li C, Fujimoto K, Sakaguchi I, Tashiro H, Saya H, Nagano O, Katabuchi H. The impact of EpCAM expression on response to chemotherapy and clinical outcomes in patients with epithelial ovarian cancer. Oncotarget. 2017;8(27):44312–25.
Liu S, Cong Y, Wang D, Sun Y, Deng L, Liu Y, Martin-Trevino R, Shang L, McDermott SP, Landis MD, et al. Breast cancer stem cells transition between epithelial and mesenchymal states reflective of their normal counterparts. Stem Cell Reports. 2014;2(1):78–91.
Beerling E, Seinstra D, de Wit E, Kester L, van der Velden D, Maynard C, Schafer R, van Diest P, Voest E, van Oudenaarden A, et al. Plasticity between Epithelial and Mesenchymal States Unlinks EMT from Metastasis-Enhancing Stem Cell Capacity. Cell Rep. 2016;14(10):2281–8.
Hatina J, Boesch M, Sopper S, Kripnerova M, Wolf D, Reimer D, Marth C, Zeimet AG. Ovarian Cancer Stem Cell Heterogeneity. Adv Exp Med Biol. 2019;1139:201–21.
Mitra T, Prasad P, Mukherjee P, Chaudhuri SR, Chatterji U, Roy SS. Stemness and chemoresistance are imparted to the OC cells through TGFbeta1 driven EMT. J Cell Biochem. 2018;119(7):5775–87.
Zhang S, Balch C, Chan MW, Lai HC, Matei D, Schilder JM, Yan PS, Huang TH, Nephew KP. Identification and characterization of ovarian cancer-initiating cells from primary human tumors. Cancer Res. 2008;68(11):4311–20.
Li Y, Gong W, Ma X, Sun X, Jiang H, Chen T. Smad7 maintains epithelial phenotype of ovarian cancer stem-like cells and supports tumor colonization by mesenchymal-epithelial transition. Mol Med Rep. 2015;11(1):309–16.
Wei Y, Wu S, Xu W, Liang Y, Li Y, Zhao W, Wu J. Depleted aldehyde dehydrogenase 1A1 (ALDH1A1) reverses cisplatin resistance of human lung adenocarcinoma cell A549/DDP. Thorac Cancer. 2017;8(1):26–32.
Wang W, He S, Zhang R, Peng J, Guo D, Zhang J, Xiang B, Li L. ALDH1A1 maintains the cancer stem-like cells properties of esophageal squamous cell carcinoma by activating the AKT signal pathway and interacting with beta-catenin. Biomed Pharmacother. 2020;125:109940.
Supplement. figures.

No competing interests reported.

Blotsimages.pdf
supplementfigure1.pdf
Fig. S1. CCLE database analysis. FZD5 is positively correlated with EPCAM in OC.
supplementfigure2.pdf
Fig. S2. FZD5 knockdown inhibits cell growth. Growth of SKOV3 cells was determined by Colony formation. Mean±SD, n=3.
supplementfigure3.pdf
Fig. S3. CCLE database analysis. FZD5 is positively correlated with ALDH1A1 while not with ALDH1A2, ALDH1A3, ALDH1B1, ALDH1L1 and ALDH1L2 in OC.
supplementfigure4.pdf
Fig. S4. FZD5 knockdown sensitizes CAOV3 cells to chemotherapy (A) Viability of CAOV3 cells after treatment withCisplatin was analyzed by CCK8. Mean±SD, n=3. (B) Viability of CAOV3 cells after treatment with Olaparib was analyzed by CCK8. Mean±SD, n=3.
supplementfigure5.pdf
Fig. S5. FZD5 knockdown reduces active β-catenin expression.Active β-catenin expression in SKOV3 cells was detected by Immunofluorescence staining. Scalebar: 50μm.

Download PDF

Journal Publication

published 27 Mar, 2024

Read the published version in Cell Communication and Signaling →

Editorial decision: Revision requested
27 Feb, 2024
Reviews received at journal
20 Feb, 2024
Reviews received at journal
05 Feb, 2024
Reviewers agreed at journal
27 Jan, 2024
Reviewers agreed at journal
26 Jan, 2024
Reviewers invited by journal
25 Jan, 2024
Editor assigned by journal
24 Jan, 2024
Submission checks completed at journal
24 Jan, 2024
First submitted to journal
18 Jan, 2024

You are reading this latest preprint version

FZD5 induces chemoresistance through ALDH1A1 in ovarian cancer

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1. Cell culture and transfection

2.2. Western blot

2.3. Immunofluorescence

2.4. Phalloidin staining

2.5. Correlation analysis of gene expression

2.6. Cell proliferation assay

2.7. Colony formation

2.8. Cell cycle assay

2.9. Real-time PCR

2.10. ALDH+ subpopulation assay

2.11. Extreme limiting dilution analysis

2.12. HR repair assay

2.13. Cytotoxicity assay

2.14. Tumorisphere toxicity assay

2.15. Apoptosis assay

2.16. Mice and in vivo study

2.17. Statistical analysis

3. Results

3.1. FZD5 maintains epithelial phenotype

3.2. FZD5 promotes cell growth

3.3 FZD5 induces stem-like properties

3.4. FZD5 enhances HR repair capacity

3.5. FZD5 endows OC cells with chemoresistance

3.6. ALDH1A1 is a downstream effector of FZD5

3.7. FZD5-ALDH1A1 pathway activates Akt signaling

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1

2.10. ALDH⁺ subpopulation assay