Clinical Samples
A total of 22 ARDS patients (17 active ARDS patients and 5 control patients) were consecutively included in the present study, and BALF samples were collected from all participants after obtaining informed consent. All BALF samples were immediately stored at -80 °C after collection. The biological samples of ARDS patients and healthy donors were obtained under a protocol approved by the Institutional Research Ethics Committee of Zhongshan Hospital (ID: 2011-212), Shanghai, China. Informed consent was provided by all participants.
Mice
Male C57BL/6 mice, aged 8-12 weeks and weighing 18-22 g, were purchased from JSJ Laboratory Animals (Shanghai, China). The mice were kept in a controlled environment with a 12-hour light/dark cycle, provided with free access to mouse chow and water. The ambient temperature was maintained at 22-24 °C with humidity levels between 50-70%. After acclimatizing for one week, the mice were housed in specific pathogen-free conditions at the Animal Center of Zhongshan Hospital, Fudan University.
The mice were anesthetized by intraperitoneal injection of Avertin (Sigma-Aldrich). Subsequently, LPS from Escherichia coli 0111:B4 (5 mg/kg; cat#L4391, Sigma-Aldrich, St.Louis, MO, USA) dissolved in phosphate-buffered saline (PBS) to induce endometritis or only PBS with an equal volume was delivered intratracheally. The size of the lung was measured, and BALF were harvested for flow cytometry and cytokine analysis. Lung samples were collected, fixed in 4% paraformaldehyde, and embedded in paraffin. Additional lung samples were stored at -80 °C.
In some experiments, to inhibit NET formation, CI-amidine (20mg/kg, HY-100574A, MCE, China, i.p.) was given 24 h and 1 h before LPS stimulation, once daily. DPI (1mg/kg, D2926, Sigma-Aldrich, USA, i.p.) was given 0.5 h before LPS stimulation, once daily. Additionally, sivelestat (50mg/kg, HY-17443, MCE China) was administered at 3 h after LPS stimulation, twice a day. All experimental procedures were conducted in accordance with institutional guidelines and approved by the Animal Care and Use Committee of Zhongshan Hospital.
Isolation and Stimulation of Mouse Bone Marrow-derived Neutrophils
BMDNs were isolated by density gradient centrifugation using Ficoll-Paque PLUS (GE Healthcare, Tokyo, Japan). Total bone marrow cells were collected from tibias and femurs, and the RBCs were lysed. Mature neutrophils were purified by centrifugation for 30 min at 300 × g without braking on a Ficoll opaque PLUS. BMDNs were collected in the bottom layer. The total number of cells was counted. Collected neutrophils were seeded onto 4-well chamber slides (1 × 106 cells/mL) and cultured in RPMI 1640 supplemented with 10% FBS for 3.5 hours at 37 °C with stimulation from LPS (100 ng/ml), NE inhibitor AK0705 (20 μM). Cells were fixed, blocked, and incubated with primary antibodies overnight at 4 °C and then with secondary antibodies for 60 minutes at 25 ℃. After mounting with DAPI stain solution NETs could be observed under a FV3000 confocal microscope (Olympus).
Quantification of Cell-free DNA and NETs-DNA Complexes
Cell-free DNA was quantified using the Quant-iT PicoGreen double-stranded DNA (dsDNA) assay kit (Invitrogen, USA), following the manufacturer's instructions. BALF was added to each well, followed by a 10-minute incubation. MPO-DNA, NE-DNA, and citH3-DNA complexes were quantified using the Quanti-iT PicoGreen assay. Anti-MPO monoclonal antibody (ab25989, 1:1000; Abcam,), anti-NE antibody (ab68672, 1:1000; Abcam), and anti-citH3 antibody (ab5103, 1:1000; Abcam) were coated onto 96-well microtiter plates overnight at 4 °C. After blocking in 1% BSA for 90 minutes at room temperature, BALF was added to each well and incubated overnight at 4 °C. PicoGreen was used to detect cell-free DNA and NET-DNA complexes.
NET Detection and Quantification
After stimulation, neutrophils or BMDNs were fixed with 4% paraformaldehyde for 30 min at room temperature (RT) and washed three times with 1% PBS-Tween (PBST) for 15 min. After washing, the cells were blocked in 1% BSA at RT. Protein staining was performed using an anti-MPO antibody (ab208670, 1:100; Abcam), a mouse monoclonal anti-NE antibody (sc-55549, 1:50; Santa Cruz) overnight at 4 °C. After three washes, the cells were placed in florescent secondary antibodies (goat anti-rabbit Alexa Flour® 488 or 594) for 1 h incubation at RT. The cells were again washed three times with 1% PBST for 15 min. After desiccation, the cells were counterstained with 4'-6 diamidino-2-phenylindole (2 ug/mL, DAPI, Servicebio, Wuhan, China) for 8 min. After three washes, images were obtained using FV3000 confocal system (Olympus).
Analysis of Bronchoalveolar Lavage Fluid (BALF)
Following terminal anesthesia with avertin, the BALF was collected by 1 ml of PBS into the trachea and lungs through a 22-inch intravenous catheter. The supernatant of BALF was collected by centrifugation at × 500 g for 10 min at 4 °C and then stored at -80 °C for further analysis. Total numbers in BALF were counted using CellDrop® (DeNovix, Wilmington, DE, USA). Total protein levels in BALF were determined using the Enhanced BCA Protein Assay Kit (EpiZyme). According to the manufacturer’s protocols, cytokine levels in BALF or serum were detected using an enzyme-linked immunosorbent assay (ELISA) DuoSet kit (R&D System). Kits were used for measuring IL-6, TNF-α, IL-1β, and monocyte chemotactic protein-1 (MCP-1).
Neutrophil Elastase Activity Assay
NE activity was quantified neutrophil elastase activity assay kit (ab204730, Abcam). Standards or BALFs from mice were plated in a 96-well plate. 2 ul of neutrophil elastase substrate was added to each well, and measure output was on a fluorescent microplate reader at Ex/Em = 380/500 nm in a kinetic mode, every 2-3 minutes, for 10-20 minutes at 37 °C protected from light.
Pulmonary Edema Evaluation
After wiping out the blood, the lungs were excised and weighed as the wet weight, which was then fired in a 60 °C oven to obtain the constant dry weight. Lung inflammation score grading from 0 to 4 was calculated by two independent pathologists blinded to the groups as previously described. Pulmonary edema was calculated as lung wet-to-dry ratio.
Histology, Immunohistochemistry and Immunofluorescence of lung
Lung tissue sections were stained with H&E staining. The histopathology was assessed in a double-blind manner according to the following criteria [39]: the presence of exudates, hyperemia or congestion, neutrophilic infiltrates, intra-alveolar hemorrhage or debris, and cellular hyperplasia. Each item was graded on a four-point scale from 0 to 3: 0 (normal lungs), 1 (mild injury), 2 (moderate injury), 3 (severe injury). To detect neutrophils and macrophages in the lung tissue using immunochemistry, paraffin-embedded mouse lung sections were stained by antibodies against Ly6G (GB11229, 1:1000, Servicebio), F4/80 (GB11027, 1:1000, Servicebio). To detect NET formation in the lung tissue, lung tissues were removed and fixed in 4% paraformaldehyde at 4°C for 3 days, then dehydrated in 30% sucrose, and finally embedded in paraffin. The tissues were then cut into 5 μm-thick serial sections and incubated with anti-citH3 (ab5103, 1:200; Abcam), anti-MPO antibody (ab25989 or ab208670, 1:100; Abcam), and anti-NE (sc-55549, 1:50; Santa Cruz), and DAPI was used to detect DNA. Then stained with an Alexa Fluor® 488 or 594 conjugate secondary antibody (1:1000, dilution). Finally, slides were visualized using an Olympus FV3000 confocal microscope.
Lactate Dehydrogenase (LDH) Assay
The mouse BALF was collected, and then subjected to detection according to the instruction of LDH assay kit (Beyotime, Shanghai, China). The LDH activity was calculated in the samples. LDH activity (U/L) = [(measured optical density (OD) value – control OD value/standard OD value – blank OD value)] × concentration of the standard (0.22 μmol/mL) × 1000.
Qunatitative real-time reverse transcriptase-PCR (qRT-PCR)
Total RNA was isolated from lung tissues using TRIzol reagent (Byeotime) and quantified by NanoDrop (Thermo Fisher Scientific, Shanghai, China). The reverse transcription of RNA into cDNA was performed using the BeyoRT™ first strand cDNA synthesis kit (Beyotime). The qRT-PCR reactions on cDNA were carried out using SYBR Green PCR Master Mix (Solarbio, Beijing, China) and 0.2 μM primers and analyzed using the Applied Biosystems 7500HT Real-Time PCR System (Foster City, CA, USA). The PCR conditions were as follows: initial denaturation at 95 °C for 5 min, followed by 33 cycles of denaturation at 95 °C for 40 s, primer annealing at 52 °C for 30 s, and extension was conducted at 72 °C for 10 min. Data were normalized to GAPDH and expressed as fold change over control. Primer sequences were listed in Table 1.
Table 1 Sequences of Primers Used for Reverse Transcription Quantitative PCR
|
Gene (mouse)
|
Sequence (5'→3')
|
IL-6 in forward
|
5’- CTGCAAGAGACTTCCATCCAG - 3’
|
IL-6 in reverse
|
5’- AGTGGTATAGACAGGTCTGTTGG - 3’
|
TNF-α in forward
|
5’- CCCTCACACTCAGATCATCTTCT - 3’
|
TNF-α in reverse
|
5’- GCTACGACGTGGGCTACAG - 3’
|
IL-1β in forward
|
5’- GCAACTGTTCCTGAACTCAACT - 3’
|
IL-1β in reverse
|
5’- ATCTTTTGGGGTCCGTCAACT - 3’
|
MCP-1 in forward
|
5’- CTCTCTCTTCCTCCACCACCAT- 3’
|
MCP-1 in reverse
|
5’- AGCCGGCAACTGTGAACAG - 3’
|
GAPDH in forward
|
5’- ACATGGCCTCCAAGGAGTAAGAA- 3’
|
GAPDH in reverse
|
5’- GGGATAGGGCCTCTCTTGCT - 3’
|
Flow Cytometry
BALF leukocytes were stained for 30 min at 4 °C using fluorescently labeled antibodies: PerCP-conjugated anti-mouse CD45 (30-F11 clone, 557235, 1:100, BD), FITC-conjugated anti-mouse CD11b (M1/70 clone, 101206, 1:100, Biolegend), PE-Cy7-conjugated anti-mouse Ly6G (1A8 clone, 1:100, 560601, BD), PE-conjugated anti-mouse F4/80 (BM8 clone, 550992, 1:100, BD). All assays were performed by Arial II flow cytometers (BD Bioscience, San Jose, CA, USA) and analyzed with FlowJo software (version10.0, Three Star, Inc., Ashland, OR, USA).
Western Blotting
Mouse lungs and BMDNs were lysed in RIPA lysis buffer (EpiZyme) containing protease inhibitor cocktails (Roche Diagnostics, Mannheim, Germany) and phosSTOP (Roche Diagnostics). The protein lysates were separated on 10% or 15% SDS/PAGE gel and transferred onto a polyvinylidene fluoride membrane. Membranes and lung tissues were blocked with 3% bovine serum albumin (BSA; Sigma-Aldrich) for 1 h at room temperature and incubated with primary antibodies overnight at 4 °C. Upon washing the blots for 5 min with TBST (100mM Tris-HCl, pH7.5, 0.1% Tween 20) 3 times, blots were incubated with secondary antibodies at a dilution of 1:20000 for 2 h at room temperature. Followed by HRP-conjugated anti-rabbit IgG (Beyotime) or HRP-conjugated anti-mouse IgG (1:5000), and the signals were detected by ECL assays (Epizyme).
The following antibodies were used: Anti-MPO (ab25989, 1:1000; Abcam), Anti-NE (ab68672, 1:1000; Abcam), Anti-citH3 (ab5103, 1:1000; Abcam), Anti-NLRP3 (#13158, 1:1000; Cell Signaling Technology), Anti-Caspase-1 (#2225, 1:1000; Cell Signaling Technology), Anti-Cleaved Caspase-1 (#4199, 1:1000; Cell Signaling Technology), Anti-Caspase-11 (#14340, 1:1000; Cell Signaling Technology), Anti-Gasdermin D (#69469, 1:1000; Cell Signaling Technology), IL-1β (ab229696, 1:1000; Abcam), Anti-Erk1/2 (#4695, 1:1000; Cell Signaling Technology), Anti-pERK1/2 (#4370, 1:1000; Cell Signaling Technology), Anti-JNK (#9252, 1:1000; Cell Signaling Technology), Anti-pJNK (#4668, 1:1000; Cell Signaling Technology), Anti-p38 MAPK (#8690, 1:1000; Cell Signaling Technology), Anti-p-p38 MAPK (#4511, 1:1000; Cell Signaling Technology), Anti-Akt (#4691, 1:1000; Cell Signaling Technology), Anti-p-Akt (#13038, 1:1000; Cell Signaling Technology), Anti-mouse IgG HRP-linked (#7076, 1:1000; Cell Signaling Technology), and Anti-rabbit IgG HRP-linked (#7074, 1:1000; Cell Signaling Technology). Anti-GAPDH (ab8245, 1:1000; Abcam) was used as an internal control. The signals were detected by ECL assays (Epizyme). Bands were quantitated using ImageJ (v1.48 & v1.53c, Bio-Rad, USA), and results are expressed as fold change relative to the internal control.
Statistical analysis
All data were statistically analyzed using GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA). Quantitative data are expressed as the means ± SD (standard deviation). An independent-sample t-test was used to compare the two groups. One-way or two-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test for multiple comparisons. The correlation was determined using the Spearman correlation analysis. p value < 0.05 was considered statistically significant.