Hepatocellular carcinoma is the most prevalent form of liver cancer and accounts for the fourth most common malignant tumor in China[50]. Bearing the third highest cause of cancer-related mortality, HCC poses a gigantic threat on the public health[51]. Due to the smoldering onset and slowly progressive course, the early manifestations of HCC are difficult to detect which leads to the dilemma that a large proportion of HCC patients cannot be diagnosed properly until the mid-late stage, missing the best period for cures[52]. Moreover, the heterogeneity between HCC patients has been greatly appreciated recently. As displayed in the study of Gao et. al[53], differences in clinical features and prognosis of HCC patients can be finely demonstrated through transcriptomic and proteomic discrepancies. Thus, the individual variability suggests the clear demand for biomarkers more efficacious for HCC prognostic prediction, which is essential for guiding the treatment strategies.
A huge number of miRNAs have been reported to be involved in cancer onset and progression and are differentially expressed among various cancer tissues[54–56]. Through participating in various biological processes including modulating oxidative stress, enhancing Warburg effect, blocking apoptosis, etc, miRNAs play crucial roles in cancer onset, invasion and metastasis[57–59]. However, it is important to note the truth that miRNAs can serve as both oncogenes and tumor-suppressing genes depending on several parameters such as miRNA types and tumor classification[28–31, 34–36]. Owing to the characteristics above, miRNAs and their panels have been receiving ascending insights into their potential as prognosticators[60, 61].
Through literature research, we found that miR-18a has been reported up-regulated in several cancers in previous studies. Yuan et. al validated an activated Wnt/β-catenin signaling pathway mediated by up-regulated miR-18a, which elevated gastric cancer metastasis[30]. Similar tumor-promoting progresses corresponding to high miR-18a levels were unveiled in cancers including HCC. The study of Avencia et. al uncovered that up-regulated miR-18a led to a low SOCS5 level, contributing to the HCC tumorigenesis through enhancing the activity and stability of mTOR signaling pathway[34]. However, the underlying mechanism of miR-18a on the HCC prognosis, which is determinant to prognosticator screening, has not yet been revealed clearly. Hence, carrying out bioinformatic analysis on miR-18a might help to address this problem.
Our mature sequence identification of miR-18a depicted a well-conserved orthologous sequence UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGA across several species, underscoring the evolutionarily conserved and important functions.
Then by conducting GO analysis, we found that target genes of miR-18a were mainly functioning in the nucleus, and were enriched in biological processes involving cell cycle, transcription modulating, protein phosphorylation, etc. KEGG pathway analysis resulted in reliable enrichments of cell cycle, PI3K signaling pathway, Wnt signaling pathway, arginine biosynthesis, angiogenesis, etc. According to the constructed PPI network, ATM, CCND1, CCND2 and NR3C1 were recognized as hub genes, harboring critical functions downstream of miR-18a.
Our attentions may wish to temporarily focus on the pathways and crucial genes mentioned above. Protein phosphorylation plays a key role in protein function modulating. A phosphoproteomic study carried out by Ren et. al revealed a kinome reprogramming in HCC, characterized by elevated activity of MAPKs and PKCs, leading to a swifter growth of HCC cells[62]. Arginine metabolism is considered indispensable in some cancers and its biosynthesis maintains the unique liver functions such as urea cycle[63]. Thongkum et. al proved that blocking arginine synthesis might yield better therapeutic effects on HCC by impacting urea cycle and pyrimidine metabolism[64]. Hub genes including ATM, CCND1 and CCND2 identified by our PPI analysis have been the focus in investigations, and their links with HCC were already established in many previous studies based on the in-depth researches mainly into their cell cycle-promoting efficacy[65–68]. Taken together, potential impacts of miR-18a on HCC might exist, for multifaced ways such as metabolism, transcription, angiogenesis and protein phosphorylation crucial for HCC were suggested regulated by miR-18a based on our GO and KEGG analysis.
However, given the small number of researches directly focused on the association between miR-18a and HCC, we tried to obtain a rough estimate of the possible target gene-depend functions of miR-18a through investigating published studies in PubMed database. As expected, several target genes predicted in our analysis involving SOX6, NOTCH2, RORA, NEDD9 [33, 37–39], etc, have been validated to mediate the effects of miR-18a in multiple types of cell lines and tissues mainly through promoting proliferation and migration. Notably, in the study of Zheng et. al, it was demonstrated that miR-18a/NEDD9 axis played a directly promoting role in HCC progression, making the association between miR-18a and HCC more convincible.
For further exploring the value of miR-18a as an in-situ biomarker of HCC, TCGA data were acquired to support our analyses. The down-regulated gene CHRM2 was present in both TCGA DEGs in HCC and predicted target genes of miR-18a. Astonishingly, a significant prognostic influence of the muscarinic receptor, CHRM2, was observed through the Kaplan-Meier Plotter overall survival data in HCC that low level of CHRM2 meant a better prognosis. Actually, the correlation between CHRM2 and cancer has received little study at present. The establishment of the linkage between CHRM2 and non-small cell lung cancer was implemented by Zhao et. al through NF-κB signaling pathway[69]. However, in their study, inactivation of CHRM2 led to a suppressed NF-κB signaling pathway, finally weakened the epithelial-mesenchymal transition process, which indicated a tumor-promoting role of CHRM2. To explain this contradiction, proteins interacting with CHRM2 was identified and their KEGG enrichment suggested that they might be involved in PI3K/AKT signaling pathway and Ras signaling pathway, giving the possibility for CHRM2 of participating in the miR-18a-mediated cancer-related biological processes because of the targeting of miR-18a and the shared pathway with miR-18a. Indispensably, survival analysis of miR-18a was conducted and high miR-18a level was consistent with a significantly poor prognosis, suggesting miR-18a as a potential in-situ prognostic factor, which was comparatively apprehensible based on the results above. Despite the prognostic significance of CHRM2 and miR-18a in HCC, we should recognize the limitation of our study that mechanisms of CHRM2 in HCC remain largely unknown, and the pro-cancer effect of miR-18a lacks holistic uncovering. The boundedness of our study needs further in vivo and in vitro verifications hereafter.