Animals. The male rats used in this study weighed 200 ± 10 g (12 weeks old). The animals were housed in the laboratory environment for two weeks with easy access to water and food. The laboratory temperature was maintained at 22 ± 2°C, with a 12h light/12h dark cycle. The study was approved by the Research Ethics Committee of the University of Mohaghegh Ardabili (code: IR.UMA.REC.1400.029).
Experimental protocol. Thirty male Wistar rats were divided into six groups (n = 5 in each group). Group I was the control group, which received saline. Groups II and III included intact rats which receiving 20 or 40 µg chrysin. Group IV was the stress control group, which received saline. Groups V and VI were the stress-induced rats which received 20 or 40 µg chrysin (Cas No. 480-40-0, Co, USA). All the injections were given 30 min before stress induction via the third cerebral ventricle (ICV) in a volume of 3 µL. Behavioral tests were performed 2 h after the rats were exposed to stress.
Hypothalamic sample dissection. At the end of the study, the animals were sacrificed. The skull was broken to remove the brain. Then the ventral surface of the brain was placed upwards and a 4 mm thick slice containing the hypothalamus was dissected (from the front near the optic chiasma, from the back to the vicinity of the mammillothalamic system and laterally to the hypothalamic sulcus).
Surgical procedure. For the third cerebral ventricle (ICV) injection, the animals were first anesthetized by intraperitoneal injection of ketamine (80 mg kg− 1) and xylazine (10 mg kg− 1). Then, the animal's head was fixed in the Stereotactic apparatus. The cannula was implanted in the skull based on the coordinates of the Paxinos and Watson Atlas (AP = 0.84 mm, ML = 00, DV = 6.5mm) (Paxinos &Watson. 2006). The animals were kept in the laboratory for one-week recovery period. The injection was performed with a Hamilton syringe attached to a polyethylene tube 20.
Acute restraint stress and drug administration After the one-week recovery period, the rats were placed in a well-ventilated plastic tube (18 cm long and 5 cm wide) for acute restraint stress. Then, they were kept for 2 hours in a quiet room. Chrysin was injected into the rats 30 min before the induction of stress (Bali & Jaggi. 2015).
Behavioral Tests
Open field test. For stress assessment, the rats were placed in a square plastic box (length 60 cm, width 60 cm, height 40 cm) with the central zone (30 × 30 cm) (Pawlak & Schwarting. 2002). At the start of the experiment, each rat was slowly placed in the center of the box. The animal was allowed to search the box freely for 5 min. Animal behavior was recorded with a camera during this time. The time spent in the center and the number of entries into the center were assessed.
Forced swimming test. The rats were placed in a transparent plastic cylinder (diameter 35 cm, height 50 cm) filled with water (up to 30 cm) slowly with the tail in the water (Roque et al. 2020). All the animals were allowed to swim freely. The water temperature was maintained at 24 ± 1°C. During the experiment, the animal's behavior was recorded with a camera. The duration of immobility was assessed at 6 min (Fitzgerald et al. 2020). In a position of immobility, the animal remained silently in the water, but swimming was considered an active movement of the limbs.
Real-time polymerase chain reaction (RT-PCR). The total RNA was extracted from the hypothalamic samples using the TRIzol reagent according to the kit instructions. The RNA concentration was determined using a Nano Drop device. Then, cDNA was synthesized according to the kit instructions (Biotech rabbit, Germany). The synthesized cDNA was subjected to reverse transcription polymerase chain reaction (RT-PCR) performed with a SYBR Green I kit (Takara Bio Inc., Japan). A time cycle was defined for the RT-PCR: 95 ° C for 15 min of one cycle, followed by 40 cycles of denaturation at 95 ° C for 20s, annealing at 60 ° C for 15 s, and extension at 72 ° C for 10 s. The sequences used for forward and reverse primers are as follows: CRH forward: 5'- TGGATCTCACCTTCCACCTTCTG − 3' and reverse 5'- CCGATAATCTCCATCAGTTTCCTG − 3', CGRP forward: 5'- TCTAAGCGGTGTGGG
AATCT − 3' and reverse: 5'- TAGGGGTGGTGGTTTGTCTC − 3' and GAPDH forward: 5'-AAGTTCAACGGCACAGTAAG-3' and reverse: 5'-CATACTCAGCACCAGCATAC-3'. The CRH, CGRP and GAPDH amplified products were 103, 155 and 120 base pairs respectively. The fold change of each gene expression was calculated using Eq. 2−ΔΔCT.
Statistical analysis. The data were analyzed using SPSS 16 and one-way analysis of variance (ANOVA). Tukey's post-hoc test was used to determine the significance of the data between different groups. The results are presented as mean ± standard error of the mean (SEM). and p ≤ 0.05 was considered significant.