Mice
Animal experiments were performed with male adult mice (C57BL/6 background). Animals were maintained in specific pathogen-free animal facility, and experiments were performed according to protocols approved by the Animal Care Use Committee of the Sourasky Medical Center. Mice were housed with 12 h light cycles and a constant temperature of 220C and had ad libitum access to water and food. LysM∆Commd10 and Cx3cr1∆Commd10 mice were generated by crossing Commd10fl/fl with Lyz2cre/+(B6.129P2-Lyz2tm1(cre)Ifo, Stock No: 004781, Jackson Laboratory) or Cx3cr1cre/+(B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J) mice, respectively. Their individual Commd10fl/fl littermates served as control mice. Where indicated, mice were fed HFD (60% kcal fat, Research Diets, iD12492) for the indicated period.
Generation of BM chimeric mice:
BM recipient WT mice were irradiated with 950 rad using a TrueBeam linear accelerator (Varian Medical Systems). On the following day, the femur bones of donor mice (CD45.1 WT or CD45.2 Cx3cr1∆Commd10) were cut on both edges and BM cells were flushed out using a 26G needle containing sterile PBS -/-. Five million cells, a 1:1 ratio mixture of CD45.1 WT and CD45.2 Cx3cr1∆Commd10, were injected into the tail vein of the recipients. After 6 weeks of reconstitution, mice were fed HFD for 12 weeks.
Cell isolation and culture
ATM
Epididymal fat pads were surgically removed from mice, weighed, cut into small pieces, and subsequently incubated in digestion buffer [DMEM, 12.5 mM HEPES pH 7.4, 2% BSA and 10mg collagenase type II] for 25 min at 370 C in a shaking bath at 140 rpm. The digested tissue was filtered through a 100μM mesh and centrifuged at room temperature at 500 g for 5 min. The stromal vascular fraction (SVF) was used for flow cytometry analysis or further processed for ATM isolation using F4/80 magnetic beads (130-110-443, Miltenyi Biotec, CA, USA) (ATM purity was above 96%). ATM were immediately used for analysis or cultured at an assay-dependent concentration for 24 hours in RPMI medium containing 5% dialyzed FBS, 10mM glucose, 2mM glutamine, 1mM sodium pyruvate, ITS x100, penicillin (100 IU/ml), streptomycin (100 μg/ml), unless indicated otherwise, at 37°C in 5% CO2.
BMDM
BMDM were prepared by flushing BM from the femur and tibia and culturing in RPMI medium containing FBS (10%), penicillin (100 IU/ml), streptomycin (100 μg/ml) and macrophage-colony stimulating factor (M-CSF, 315-02-100, PeproTech Asia, Israel, 20 ng/ml), at 37°C in 5% CO2. Media was supplemented every 2-3 days. On day 6, macrophages were harvested and plated overnight at an assay-dependent concentration. Where indicated, BMDM were treated with 80 mg/ml BCS (B1125, Sigma-Aldrich, Israel) for 72 hours.
Cas9-expressing THP-1 cells
THP1 monocytes were maintained in RPMI growth medium containing 10% dialyzed FBS, penicillin (100 IU/ml), streptomycin (100 μg/ml), 10mM galactose, 2mM glutamine and 1mM sodium pyruvate, at low density. For experiments, monocytes were differentiated, at an assay dependent concentration, with 50 ng/ml phorbol 12-myristate 13-acetate (PMA, P8139, Sigma-Aldrich, Israel) for 24 hours. Cells were then allowed to rest in maintenance medium for another 72 h before further analysis.
CRISPR-Cas9 COMMD10 editing:Cas9-expressing THP-1 cells were seeded on 6 well plates at 3x104 cells per well in RPMI 1640 medium (01-100-1A, Sartorius, Israel) supplemented with 5% HI-FBS and 1% penicillin streptomycin (5 U/mL penicillin, 5 mg/mL streptomycin). On day 2, cells were transduced with a lentiviral sgRNA clone (5’ AAAGTTCCGGCAGAGAATTC 3’) for human COMMD10 gene or scrambled sgRNA (MOI 50) (GeneCopoeia, Maryland, USA) in complete medium containing 8 μg/mL polybrene (TR-1003-G, Sigma-Aldrich, Israel). After 24 hours, medium was changed to complete medium with 10% FBS. Five days after transduction, cells were single cell sorted by FACS into a 96 well plate containing complete medium with 20% FBS. Successful Commd10 gene editing was verified by Sanger sequencing (Hylabs, Israel) after Commd10 region amplification with Taq7 enzyme according to manufacturer’s instructions using primers: forward AATGTGAAGCCAGCAGCTT, reverse GCTAGTGGTGTGGTACATAAGA TATT.
Insulin tolerance test (ITT):
Two weeks before the end of the experiments, mice were subjected to 5 h fasting from 6:30-11:30 am and basal glucose levels were determined using the Accu-Check Performa Sensor, Roche, Switzerland). Subsequently, insulin (Actrapid, A10AB01, Novo Nordisk, UK) was injected intraperitoneally at a dose of 0.75 u/kg, and serum glucose was measured at indicated time points.
Glucose tolerance test (GTT):
One week before the end of the experiments, mice were subjected to 12 hours fasting from 18:30-6:30 am and basal glucose levels determined as for ITT. Subsequently, glucose was injected intraperitoneally at a dose of 1mg/kg, and serum glucose was measured at indicated time points. Serum insulin was measured at baseline and 30 minutes after glucose injection using an ELISA kit (EZRMI-13K, EMD Millipore, Missouri, USA).
Liver triglyceride measuring
Liver tissues (100mg) were harvested and homogenized in 5% NP-40. Lysates were heated to 100⁰C for 5 min and then cooled to room temperature twice. Triglycerides were measured using a ADVIA Chemistry XPT analyzer.
Protein immunoblotting
Total protein from 100mg epiWAT or two million ATM was extracted in ice-cold RIPA buffer containing protease and phosphatase inhibitors. Proteins were detected by immunoblotting using standard techniques. Antibodies used included: pAKT Ser473 (4060), pHSL Ser660 (4126), HSL (4107), PI3K P85 (4292), MDH2 (8610), NRF2 (12721), b-Tubulin (9F3) (2128) from Cell Signaling Technology, Inc. (MA, USA); AKT (SC-1619) PI3K P110 (SC-365404) PolII (SC-9001), Tom20 (SC-17764), b-ACTIN (SC-47778) from Santa Cruz Biotechnology (Texas, USA); CCDC93 (20861-1-AP), CCDC22 (16636-1-AP) from ProteinTech group (Rosemont, USA); COMMD10 (GTX121488) from Genetex (CA, USA); P97 (636801) from BioLegend (UK) and ATGL (10006409) Cayman chemical company (Michigan, USA). Membranes were incubated with HRP-conjugated secondary antibodies and subjected to chemiluminescent detection using the MicroChemi imaging system (DNR Bio-Imaging Systems, Israel). Densitometry was performed using ImageJ software (v1.51j, NIH, USA). Mitochondria fractionation was performed using mitochondria/cytosol fractionation kit (ab65320, Abcam, MA, USA) from 5 million ATM and 10 million THP1 derived macrophages, per manufacturer’s instructions. NRF2 subcellular fractionation from 4 million ATM was performed using NE-PER nuclear/cytoplasmic extraction kit (78835, Thermo Scientific) per manufacturer’s instructions. Equivalent protein amounts were loaded for both nuclear and cytoplasmic fractions.
Immunoprecipitation and mass spectrometry
Total ATM lysate: ATM from mouse eWAT after 12 weeks HFD were washed with ice-cold PBS and lysed with IP lysis/wash buffer (0.025M Tris, 0.15M NaCl, 0.001M EDTA, 1% NP-40, 5% glycerol pH 7.4). COMMD10 polyclonal antibody (costume production by Sigma-Aldrich, Israel) (10 mg) and mouse IgG control antibody (1-2000, Vector laboratories, CA, USA) were crosslinked to agarose beads (Pierce crosslinking immunoprecipitation kit, Thermo Scientific). Next, 1 mg lysate protein was loaded on the crosslinked beads and incubated overnight at 4⁰C, followed by 3 washes with the lysis/wash buffer and 3 washes with PBS containing protease inhibitors. Samples were eluted with 30ml sample buffer x1 and boiled at 95⁰C for 5 min. The protein samples were run on a 10% acrylamide gel and stained with Coomassie dye. Proteins from each sample were cut from the gel, cleaved with trypsin, and analyzed by LC/MS-MS using an Q Exactive HFX mass spectrometer (Thermo Fisher Scientific). The data was analyzed with MaxQuant53, 54 with FDR <0.01. Differential proteins were determined by t-test with at least 2-fold change, p-value <0.05. LC/MS-MS was performed as a service by the Smoler Proteomics Center, Technion, Israel. Mitochondrial lysate- mitochondria fraction from 40 million THP1 derived macrophage was isolated by mitochondrial/cytosol fractionation kit (ab65320, Abcam), mitochondria pellet was resuspended with 1% triton buffer (20mM Tris, 13.3mM NaCl, 1% triton, 2mM EDTA, protein inhibitor cocktail). About 2 mg mitochondrial protein was incubated with COMMD10 polyclonal antibody (costume production by Sigma-Aldrich, Israel) (10 mg) or mouse IgG control antibody (1-2000, Vector laboratories, CA, USA), overnight at 4⁰C, followed by 2 hours incubation with 25ml agarose beads (Pierce, Thermo Scientific), pellet was wash once with 1% triton buffer, 4 times with PBS, protein were eluted with 5% SDS in 50 mM Tris-HCl for 10 minutes. The proteins were reduced with 5 mM dithiothreitol and alkylated with 10 mM iodoacetamide in the dark. Each sample was loaded onto S-Trap microcolumns (Protifi, USA) according to the manufacturer’s instructions55. In brief, after loading, samples were washed with 90:10% methanol/1M triethylammonium bicarbonate. Samples were then digested with 250 ng trypsin for 1.5 hours at 47 °C. The digested peptides were eluted using 40 mM ammonium bicarbonate; trypsin was added to this fraction and incubated overnight at 37 °C. Two more elutions were made using 0.2% formic acid and 0.2% formic acid in 50% acetonitrile. The three elutions were pooled together and vacuum-centrifuged to dry. Samples were kept at −20 °C until analysis.Liquid chromatography: ULC/MS grade solvents were used for all chromatographic steps. Each sample was loaded using split-less nano-Ultra Performance Liquid Chromatography (10 kpsi nanoAcquity; Waters, Milford, MA, USA). The mobile phase was A) H2O + 0.1% formic acid and B) acetonitrile + 0.1% formic acid. Desalting of the samples was performed online using a reversed-phase Symmetry C18 trapping column (180 µm internal diameter, 20 mm length, 5 µm particle size; Waters). The peptides were then separated using a T3 HSS nano-column (75 µm internal diameter, 250 mm length, 1.8 µm particle size; Waters) at 0.35 µL/min. Peptides were eluted from the column into the mass spectrometer using the following gradient: 3% to 28% B in 50 min, 28% to 90% B in 5 min, maintained at 90% for 5 min and then back to initial conditions.
Mass Spectrometry: The nanoUPLC was coupled online through a nanoESI emitter (10 μm tip; FOSSILIONTECH; Madrid, Spain) to a quadrupole orbitrap mass spectrometer (Q Exactive Plus, Thermo Scientific) using a FlexIon nanospray apparatus (Proxeon). Data was acquired in data dependent acquisition (DDA) mode, using a Top10 method. MS1 resolution was set to 70,000 (at m/z 200), mass range of 375-1500 m/z, AGC of 1e6 and maximum injection time was set to 60 msec. MS2 resolution was set to 17,500 (at m/z 200), quadrupole isolation 1.7 m/z, AGC of 1e5, dynamic exclusion of 25 sec and maximum injection time of 60 msec. Data processing and analysis: Raw data was processed with MetaMorpheus v0.0.32056. The data was searched against the Swissprot human proteome database (downloaded on March 2023, 20,401 entries) appended with common lab protein contaminants and the default modifications. Quantification was performed using the embedded FlashLFQ57 and protein inference58 algorithms. The LFQ (Label-Free Quantification) intensities were extracted and used for further calculations using Perseus v1.6.2.359. Decoy hits were filtered out. The data was further filtered to include only proteins with at least 66% valid values in at least one of the groups. Protein expression imputation was done with a random low range normal distribution. A Student’s t-Test, after logarithmic transformation, was used to identify significant differences across the biological replica. Fold changes were calculated based on the ratio of geometric means of the different compared groups. Enriched pathways were analyzed with the Database for Annotation, Visualization and Integrated Discovery (DAVID), FC≥1.2, pFDR<0.05. Liquid chromatography was performed as a service by the De Botton Institute for Protein Profiling, Grand Israel National Center for Personalized Medicine, Weizmann Institute of Science, Israel.
OCR/ECAR measurement
Real-time measurements of OCR and ECAR were performed using a Seahorse XFe96 Extracellular Flux Analyzer (Agilent, CA, USA). ATM, BMDM, and THP1 derived macrophages were seeded for 24 hours at a density of 15x104, 8x104 and 2.5x104 cells per well, respectively, in Seahorse XFe96 Cell Culture Microplates (102978-100, Agilent, CA, USA). Cells were assayed using Seahorse XF Cell Mito Stress Test kit (103015-100, Agilent, CA, USA) with addition of the glycolysis inhibitor 2-deoxy-glucose (2-DG). OCR and ECAR were measured under basal conditions and after injection of final concentrations of 4 µM oligomycin (ATM, BMDM), 2 µM oligomycin (THP1 derived macrophages), 2 µM FCCP (ATM, BMDM), 1 µM FCCP (THP1 derived macrophages), 50 mM rotenone/ antimycin A, and 50mM 2-DG. The measured OCR and ECAR values were normalized to protein levels by lysing the cells and performing Lauri protein assay.
Glucose labeling and metabolite measurements
For metabolic analysis 0.4 million ATM cells/well were seeded in a 12 well plate. The cells were grown in physiological medium that is better suited for metabolomics experiments (DMEM-F12 W/O glucose W/O glutamine, 2.5 mg/ml Ascorbic acid phosphate, 5% dFBS, 10mg/l insulin, 5.5mg/l transferrin, 2mg/l ethanolamine, 1mg/ml glutathione, 0.0003mg/l ammonium metavanadate, 0.00025mM manganous chloride, 5mM glucose, 1mM glutamine, 0.25mM pyruvate, 0.1mM acetate). After 3 hours the medium was replaced to a medium with the same formulation only supplemented with 5mM 13C-Glucose (instead of standard glucose) for 18 hours. Cells were washed twice with ice-cold PBS and 300 ml/well metabolites extraction buffer was added (methanol:acetonitrile:water; 5:3:2). Samples were agitated for 10 min at 4°C, followed by 10 min at -80 and 10 min on ice. The resultant suspension was transferred to ice-cold microcentrifuge tubes and centrifuged at maximum speed for 10 min at 4°C. The supernatant was transferred into HPLC vials and stored at -80°C prior to analysis by LC-MS. The LC-MS metabolomics analysis was performed as described previously 60. Briefly, Thermo Dionex Ultimate 3000 high-performance liquid chromatography (HPLC) system coupled to Q- Exactive Orbitrap Mass Spectrometer (Thermo Fisher Scientific) was used with a resolution of 35,000 at 200 mass/charge (m/z) ratio, electrospray ionization, and polarity switching mode to enable both positive and negative ions across a mass range of 67 to 1000 m/z. HPLC setup consisted ZIC-pHILIC column (SeQuant; 150 mm × 2.1 mm, 5 μm; Merck). Five ml of biological extracts were injected. The compounds were separated with mobile phase gradient of 15 min, starting at 20% aqueous (20 mM ammonium carbonate adjusted to pH 9.2 with 0.1% of 25% ammonium hydroxide) and 80% organic (acetonitrile) and terminated with 20% acetonitrile. Flow rate and column temperature were maintained at 0.2 ml/min and 45°C, respectively, for a total run time of 27 min. All metabolites were detected using mass accuracy below 5 ppm. Thermo Xcalibur (Thermo Fisher Scientific) was used for data acquisition, TraceFinder 4.1 (Thermo Fisher Scientific) was used for analysis. The peak areas of metabolites were determined by using the exact mass of the singly charged ions. Its identity was confirmed by comparing experimental retention time to retention times predetermined by analysis of an in-house mass spectrometry metabolite.Data from each sample was normalized to its corresponding protein concentration.
Mitochondrial membrane potential measurement
About 100,000 ATM or 30,000 THP1 derived macrophages were seeded in black 96 well plate (Corning) overnight. Medium was replaced to growing medium containing 1mM TMRE (ab113852, Abcam) for 30 min, washed twice with PBS/0.2% BSA and immediately analyzed with BioTek Synergy 2 fluorescence plate reader using Ex/Em-530/590.
Glucose uptake
SVF fraction and BMDM were isolated and incubated with0.05mg/ml2-NBD-glucose (ab146200, Abcam) for 1 h. Cells were analyzed by flow cytometry by gating on ATM or BMDM.
Natural lipid content staining
SVF fraction was isolated and incubated with 1mM BODIPY (D3922) for 20min at room temperature. Cells were fixed with 2% PFH for 10 min. Cells were analyzed by flow cytometry by gating on ATM.
Measurement of intracellular and mitochondrial ROS
SVF fraction was isolated and incubated with 20μM 2′,7′-dichlorohydrofluorescein diacetate (DCFH-DA) (D6883, Sigma Aldrich, Israel) for 30min at 37°C or ATM were furthered isolated and incubated with 4mM mitoSOX (M36008, Invitrogen) for 30min at 37°C. Cells were analyzed by flow cytometry.
Measurement of mitochondria mass
SVF fraction was isolated and incubated with 1mM Mitotracker green FM (M7514) for 30 min at 37°C. Cells were analyzed by flow cytometry by gating on ATM.
Measurement of lactate
About 100,000 isolated ATM were seeded in 48 well plates for 24 hours. Medium was collected on ice and immediately frozen at -80°C until analysis. Cells were lysed on ice with 12.5ml of 0.6N HCl and 25ml of PBS for 5 min and then neutralized with 12.5ml of 1M Tris. Intracellular and secreted lactate level was determined using the lactate-GloTM assay (J5021, Promega).
Measurement of copper
For the detection of copper in ATM and BMDM, ultrasonic lysates of 2×106 cells were centrifuged and the supernatant was collected. Concentration of copper was detected using QuantiChromTM Copper Assay Kit (DICU250, BioAssay Systems, USA) according to the manufacturer’s instructions.
Confocal microscopy
THP1 derived macrophages were seeded (300,000/24 well plate) overnight on cover glass. On the following day, cells were fixed with 4% PFA for 10 minutes. Slides were permeabilized with 0.1% triton X100 for 10 minutes and then blocked in blocking solution (BlockAid Blocking Solution, B10710, ThermoFisher Scientific) for 45 min at room temperature, followed by overnight incubation with directly conjugated antibodies (ab209606, Alexa Fluor 647 Anti-TOMM20 [EPR15581-54], Abcam, CA,USA) or appropriate primary antibodies (monoclonal COMMD10 (costume med, Weizmann, Israel), CCDC22 (16636-1-AP) and ATP5A1 (66037-1-Ig) from Proteintech, UK) followed by 1 hour incubation with secondary antibodies. Subsequently, slides were washed and mounted with fluorescent mounting medium with DAPI. Images were taken with confocal microscope LSM700 (MicroImaging GmbH, Zeiss, Germany). Image processing was performed with ZEN 2011 SP7 software.
Quantitative RT-PCR
Total RNA was extracted from liver with TRIzol reagent, from epiWAT with RNeasy lipid tissue mini kit (74804, QIAGEN, Germany) and from cells with the RNeasy mini kit (74104, QIAGEN, Germany). RNA was reverse transcribed with a high-capacity cDNA reverse transcription kit. All PCR reactions were performed with SYBR Green PCR Master Mix kit and Applied Biosystems 7300 Real-Time PCR machine. Quantification of PCR signals of each sample was performed by the DCt method normalized to Rplp0 housekeeping gene. Gene-specific primers are listed in Supplementary Table 1.
Mitochondria DNA
Total DNA was isolated from 50,000 ATM using DNeasy mini kit (69504, QIAGEN, Germany). Quantitative RT-PCR of mitochondrial encoded genes was performed to estimate mitochondria number, results were normalized to nuclear Rp18s. primers used are mitochondria: Nd1 F-CTAGCAGAAACAAACCGGGC, R-CCGGCTGCGTATTCT ACGTT; Cox1 F- ACTTGCAAC CCTACACGGAGGTAA R- TCGTGAAGCACGATGTCAAGGGAT; nucleus: Rp18s F- ACCT GTCTTGATAACTGCCCGTGT, R- TAATGGCAGTGATGGCGAAGGCTA.
Flow cytometry analysis
SVF fraction of eWAT or isolated ATMs were analyzed with BD FACSCanto II (BD Bioscience). Flow cytometry analysis was performed using FlowJoTM software (Ashland, OR, Becton, Dickinson & Company USA). Cell sorting was performed using the BD FACSAriaTM FUSION or BD FACSAriaTM III cell sorters (BD Bioscience). Antibodies used for flow cytometry were: Anti-mouse CD45 APC/CY7(30-F11) Cat #103116, APC anti mouse CD45.1 (A20) Cat# 110713, FITC anti mouse CD45.2 (104) Cat# 109805, PE/Cy7 anti mouse CD11b (M1/70) Cat #101216, Pacific Blue anti mouse/human CD11b (M1/70) Cat #101224, PerCP/Cy5.5 anti mouse Ly6C (HK1.4) Cat# 128012, PE anti mouse CD115 (AF598) Cat# 135505, APC anti mouse CD64 (X54-5/7.1) Cat# 139306, APC anti mouse F4/80 (BM8) Cat# 123116, PerCP/Cy5.5 anti mouse CD31 Cat# 11-0091-82, APC anti mouse PDGFRa (CD140) Cat# 135908, PE anti mouse Sca1 Cat# 108107from BioLegend , PE anti mouse F4/80 (REA126) Cat# 130-116-499 from Miltenyi, FITC anti mouse CD9 Cat# 102420 from Invitrogen.
Bulk MARS-seq
A bulk adaptation of the MARS-Seq protocol 61, 62 was used to generate RNA-Seq libraries for expression profiling. Briefly, mRNA was purified from 100,000 cells of each sample using Dynabeads mRNA Direct purification kit (61011, ThermoFisher), barcoded during reverse transcription and pooled. Following Agencourct Ampure XP beads cleanup (Beckman Coulter), the pooled samples underwent second strand synthesis and were linearly amplified by T7 in vitro transcription. The resulting RNA was fragmented and converted into a sequencing-ready library by tagging the samples with Illumina sequences during ligation, RT, and PCR. Libraries were quantified by Qubit and TapeStation as well as by qPCR for mouse Actb gene. Sequencing was done on a Nextseq 75 cycles high output kit (Illumina). Bulk MARS-seq was performed as a service by The Crown Genomics Institute, Grand Israel National Center for Personalized Medicine, Weizmann Institute of Science, Israel.
Bioinformatics
Poly-A/T stretches and Illumina adapters were trimmed from the reads using Cutadapt; resulting reads shorter than 30bp were discarded. Remaining reads were mapped onto 30 UTR regions (1000 bases) of M. musculus, mm10 genome according to Refseq annotations, using STAR 63 with End-To-End option and outFilterMismatchNoverLmax was set to 0.05). Deduplication was carried out by flagging all reads that were mapped to the same gene and had the same UMI. Counts for each gene were quantified using htseq-count 64, using the gene transfer format above and corrected for UMI saturation. Differentially expressed genes (DEGs) were identified using DESeq265, with the betaPrior, cooksCutoff and independentFiltering parameters set to False. Raw P values were adjusted for multiple testing using the procedure of Benjamini and Hochberg. Pipeline was run using snakemake66. MouseMine bioinformatics tool67 and GSEA (Gene sets database: c5.all.v7.2.symbols.gmt) was used to determine pathway and gene ontology (GO) enrichments among the DEGs. Bioinformatics were performed by the Mantoux Bioinformatics Institute, Grand Israel National Center for Personalized Medicine, Weizmann Institute of Science, Israel. Statistical analysis
Statistical differences between two groups were determined using the unpaired two-tailed t-test with GraphPad, and for three groups using one-way Anova with GraphPad. Significance was defined if p-value was less than 0.05 as following: * p < 0.05; ** p < 0.01; *** p < 0.001.