A dual-targeting approach with anti-IL10R CAR-T cells engineered to release anti-CD33 bispecific antibody in enhancing killing effect on acute myeloid leukemia cells

doi:10.21203/rs.3.rs-3926499/v1

Download PDF

Research Article

A dual-targeting approach with anti-IL10R CAR-T cells engineered to release anti-CD33 bispecific antibody in enhancing killing effect on acute myeloid leukemia cells

https://doi.org/10.21203/rs.3.rs-3926499/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The introduction of immunotherapies, such as chimeric antigen receptors (CAR) T cells and bispecific antibodies (BsAbs), has significantly revolutionized the treatment landscape for acute myeloid leukemia (AML). In this study, we developed a dual-targeting approach with anti-IL10R CAR-T cells engineered to release CD33-targeted bispecific antibody to address the major challenges in T cell-directed therapies, including antigen loss and tumor heterogeneity that contribute to relapse.

Methods

T cells were transduced with lentiviral supernatants containing IL10R CAR.CD33 BsAb (CAR.BsAb)-encoding sequence, which incorporated the CD33-targeted bsAb and a second-generation IL10R CAR. The efficacy of the CAR.BsAb-T therapy against AML was evaluated both in vitro by cocultures of CAR.BsAb-T cells with leukemia cell lines or primary AML samples, and in vivo using a xenograft leukemia mouse model.

Results

The study demonstrated the effectiveness of the dual-targeting strategy in eliminating AML cell lines and primary cells expressing varying levels of CD33 and/or IL10R. The secreted anti-CD33 bsAb by IL10R CAR-T cells could amplify the activation and cytotoxicity of both IL10R CAR-T cells and untransduced bystander T cells against CD33 positive leukemia cells. In vivo study further confirmed that CAR.BsAb-T cells could effectively redirect T cells, reduce tumor burden, prolong mice survival, and exhibit no obvious toxicity. This strategy of local bsAbs delivery directly to tumor sites mitigates the pharmacokinetic issues commonly associated with the rapid clearance of bsAbs.

Conclusions

Overall, the engineering of a single construct targeting IL10R CAR, which subsequently secretes CD33-targeted bsAb, addresses the issue of immune escape due to the heterogeneous expression of IL10R and CD33, and are expected to provide better therapeutic effects for AML treatment.

Immunotherapy

AML

chimeric antigen receptor

secretion of T cell-redirecting bsAbs

CD33

IL10R

While significant advancements have been made in the treatment of AML through various small molecule targeted therapies and combination of agents, the overall prognosis for AML patients remains unfavorable[1]. The approval of CAR-T cell therapy for B cell malignancies by the US Food and Drug Administration (FDA) in 2017 marked a significant milestone in adoptive cellular immunotherapy, shifting it from laboratory research to clinical practice and introducing T cell-specific recognition and targeting of tumor cells[2, 3].

Targeting cell-surface tumor-associated antigens (TAAs) in AML with redirected T cells has proven to be a complex and challenging task[4–6]. The absence of a clearly defined "ideal" antigen target has hindered progress, as exemplified by gemtuzumab ozogamicin (GO), the first monoclonal antibody-based strategy that targets CD33 in AML[7, 8]. CD33 is absent in normal hematopoietic stem cells as a myeloid differentiation antigen[9], but expressed on the blast cells of most AML patients, including LSCs[10, 11]. Nevertheless, just as observed in CD19 CAR-T cell therapy [12, 13] and the sequential administration of blinatumomab [14], the absence of the target antigen is associated with relapse in treated patients, and similar challenges emerge in CD33-targeting immunotherapies due to both inherent and acquired antigenic modulation[15]. The absence or deletion of CD33 antigen in malignant hematopoietic cells would lead to resistance[16, 17]. Furthermore, studies have shown that CD33-targeting therapeutics may be the most effective in patients with "mature" LSCs[18]. The proposed theory of "resetting the clock to a premalignant stage" suggests that successful depletion of CD33⁺ cells will only eliminate transformed clones, but it allows pre-LSCs to remain, necessitating alternative methods for control or elimination[19].

Our previous studies revealed the role of IL-10 in enhancing the stemness of AML cells through the IL-10R/PI3K/AKT/OCT4 signaling pathway[20], and a ligand-based IL-10R targeting CAR-T cell was then developed, which showed significant cytotoxic effects on AML cells in both in vitro and in vivo settings[21]. We hypothesized that IL-10R CAR-T therapy could potentially eliminate residual CD33⁻ LSCs that might persist after the killing of more mature CD33⁺ AML blasts by CD33-targeting cellular immunotherapy.

Moreover, the bsAb targeted CD33 positive AML cells was developed, exhibiting strong preclinical effectiveness[22, 23]. The continuous infusion of CD33 bsAb in AML patients at early-stage focused on local CD33 targeted accumulation to optimize the pharmacokinetics of bsAb at the tumor site.

These advancements and challenges highlight the demand for advanced immunotherapeutic targeting strategies in the field of AML treatment. Beyond existing T cell redirection strategies like CAR-T cells [24] and bsAbs [25], attention is shifting towards the endogenous secretion of T cell-redirecting bsAb within the tumor microenvironment [26, 27]. In 2019, a sophisticated approach for immunotherapy in solid tumors was introduced, illustrating the synergistic combination of CAR-T cells and bsAbs[28] .

In this study, we propose to construct the anti-IL10R CAR-T cells that secrete CD33-targeted bsAb (Fig. 1a), using an epitope spreading strategy [27] to combat tumor heterogeneity and immune evasion through two different modes of attack. CAR.BsAb-T cells not only utilize anti-IL10R T cell-redirecting strategies but also release bsAb mediating the organization of a canonical immune synapse (IS) [29]between primary T cells and CD33⁺ cells. The resulting CAR.BsAb-T demonstrated enhanced function of IL10R CAR-T cells, particularly exhibiting cytotoxic effects mediated by bystander T cells. This dual targeting approach, integrating distinct toxicity mechanisms, offers a comprehensive, effective, and sustained anti-tumor activity, showing promise for AML therapy.

Cell lines and primary cells from AML patients

Human AML cell lines U937, Thp-1, Molm 13 and K562 were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS). Kasumi-1 cells were maintained in RPMI-1640 medium with 15% FBS. MV4-11 (FLT3-ITD/MLL-AF4) cells were cultured in Iscove’s modified Dulbecco’s medium (IMDM, Gibco, USA) supplemented with 10% FBS. All leukemia cell lines, obtained from the American Type Culture Collection (ATCC), were grown at cell densities of 0.5-1×10⁶ cells/ml and incubated at 37℃ with 5% CO₂ and high humidity.

To generate a CD33 knockout cell line, the CRISPR-Cas9 technology was employed. A guide RNA (atccctggcactctagaacc) was cloned into the lenti CRISPRv2 plasmid (Addgene, plasmid #52,961)[30]. U937 and Thp-1 cells were transfected with lentivirus and subjected to puromycin drug screening. Afterward, CD33⁻ single clones were sorted through flow cytometry(FCM) and subsequently cultured.

Bone marrow samples were obtained from primary AML were who were enrolled in the Institute of Hematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College (CAMS & PUMC), and the informed consents were signed. CD34⁺ blast cells were enriched if needed by the human CD34 MicroBead Kit (Cat.# 130046702, Miltenyi Biotec, Germany) from bone marrow mononuclear cells (BMMNCs) of primary AML patients. These cells were cultured in IMDM supplemented with 15% FBS, 100 ng/ml recombinant human Fms-like tyrosine kinase 3 ligand (rhFLT3-L), 100 ng/ml recombinant human stem cell factor (rhSCF), and 50 ng/ml recombinant human thrombopoietin (rhTPO).

Viral constructs

Lentivirus vectors were constructed using the PCDH-EF1α backbone, as previously described.[31] The CD33-targeted bsAb sequences, comprising the anti-human CD33 single-chain variable fragment (scFv) and anti-human CD3 scFv, were derived from the respective monoclonal antibody hybridoma clones HIM3-4/HI33a and HIT3a in our previous studies.[32, 33] These sequences were connected with different linkers.

For the generation of CAR.BsAb, second-generation CAR vectors were employed. These vectors encoded the interleukin-10 (IL-10) mature peptide, with 4-1BB and CD3ζ signaling domains, and CD33 bsAb with a C-terminal hexahistidine (6×His)-tag. The components were inserted into the expression vector, separated by a 2A self-cleaving peptide sequence.

Lentivirus production was carried out using HEK293T cells. Viral supernatants were purified through precipitation with PEG-8000 and NaCl. The resulting viral pellet was resuspended in KBM581 for human T cell infection.

CAR.BsAb-T cell production and detection of CD33 bsAb

Generation of CAR. BsAb-T Cell

Human CD3⁺ T-cells were isolated from healthy donors from Tianjin Blood Center using the human T Cells Enrichment Cocktail (STEMCELL, USA) following the manufacturer’s protocol. To generate CAR.BsAb-T cells, T-cells were activated on day 0 using CD3/CD28 Dynabeads (#11131D, Gibco, ) and cultured in lymphocyte medium KBM581 (Corning, USA) supplemented with 5% FBS and 50 IU/mL recombinant human IL-2 (Cat.# 200IL-500, RD Systems, USA). On day 1, T-cells were transduced with lentiviral supernatants and then cultured at cell densities ranging from 0.5 to 2×10⁶ cells/ml. On day 4, transduction efficiency was determined using FCM with an anti-human IL-10 antibody.

Purification and characterization of CD33 bsAb

The supernatants from different groups were subjected to purification using His-tag Purification Resin (Reductant & Chelator-resistant) (Beyotime, CHN). Further concentration of the eluted protein was achieved using a centrifugal filter device (Millipore, USA). Verification of CD33 bsAb at the anticipated molecular weight (~ 56 kDa) was confirmed via Western blot using an anti-His-tag antibody. Human T cells and CD33-positive Molm 13 cell lines were then incubated with the purified protein for 30 minutes at 4℃. Following two washes with PBS, cell-bound CD33 bsAb was detected using a PE/Cy7-labeled anti-His tag antibody.

1×10⁵ cells from different groups were plated in 96-well plates with 200 µL medium and incubated for 24 hours. Subsequently, Anti-His-tag mAb-Alexa Fluor®647 (#D291-A64, MBL, China) or APC-labeled human siglec-3/CD33 protein (#CD3-HA2H3, Acro, China) was added and incubated for 30 minutes at -4℃. After two washes with PBS, FCM was performed to detect the labeled proteins.

The levels of CD33 bsAb in the supernatants on days 4, 6, and 8 were quantified using the His-tag ELISA detection kit (Genscript, USA) following the manufacturer's instructions. Absorbance values were measured using an ELISA reader at a 450 nm channel.

T-cell phenotyping

T cells were co-incubated with Molm 13 target cells. The analysis of CD3⁺ T cells was conducted using FCM, focusing on activation and proliferation markers: CD69 expression at 6 hours and CD25 expression at 24 hours post-incubation, respectively. Additionally, the percentages of CD8⁺Lag3⁺PD-1⁺ cells were evaluated, along with the memory markers CD45RA and CCR7 at 48 hours.

Cytotoxicity Assays

T-cells, labeled with CFSE (#C34564, Invitrogen, USA) following the manufacturer's protocol, were incubated with PKH-labeled (#PKH26GL-1KT, SIGMA, USA) tumor targets at different effector (E) to target (T) ratios in KBM581 supplemented with 5% FBS without rh IL-2.

Degranulation Assay

2 × 10⁵ T cells were incubated with target cells at an effector-to-target (E:T) ratio of 1:1 in a 96-well plate supplemented with 100 IU/mL IL-2, anti-human CD107a antibody (H4A3), and 200µl medium. After 1 hour, 2µM Monensin (Cat.# 420701, Biolegend, USA) was added. After 6 hours of co-culture, the percentage of CD107a⁺ T-cells was analyzed using FCM.

Specific killing assay

To assess tumor cell elimination in co-culture system with total cell count of 4×10⁵. Effector cells and target cells were seeded at various E:T ratio, specifically 1:4 (0.8×10⁵: 3.2×10⁵), 1:2 (1.3×10⁵: 2.6×10⁵), 1:1 (2×10⁵:2×10⁵), and 2:1 (2.6×10⁵:1.3×10⁵) in a 24-well plate containing 1 ml culture medium. The percentage of residual target cells was determined using FCM at 24 and 48 or 36 hours. Dead cells were identified through DAPI staining, and cell killing was defined by the percentage of PKH⁺CFSE⁻ single target cells that stained negative for DAPI.

Tumor rechallenge assay

After culturing T cells for 8 days, 2×10⁵ target tumor cells and an equal number of effector cells were co-cultured, setting up four replicates. After 48 hours, all co-cultured cells were harvested, centrifuged, and the cell pellets were resuspended in fresh culture medium. Every 48 hours, on days 10, 12, and 14, 2×10⁵ fresh tumor cells were added into the system, repeating this process for three cycles. The percentage of residual target cells was then assessed using FCM in each round.

Detection of cytokine release

The co-culture supernatant from the specific killing assay at an E:T ratio of 1:1 was collected. The concentrations of interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 6 (IL-6), interferon-gamma (IFN-γ) and tumor necrosis factor-alpha (TNF-α) were quantified by the capture of microspheres encapsulated with cytokine-specific antibodies (#P420487, Cellgene Biotech, China) using FCM. This quantification was based on the fluorescence intensity of the complexes, expressed in pg/ml.

Effects of CD33 bsAb secreted from CAR.BsAb-T Cells

To evaluate the effects of the released CD33 bsAb, as previously reported, cell-impenetrable transwell membranes (0.4 µm pore size) was used and 2×10⁵ effector cells was added to the upper chamber.

Primary T cell proliferation assays

5×10⁵ human primary T cells stained with CFSE were added to the lower chamber and changes in fluorescence intensity were detected using FCM after a 72-hour incubation.

Specific killing assay

Untransduced (UTD)-T cells and target cells were seeded in the lower chamber at E:T ratio of 1:1 (2×10⁵:2×10⁵). The percentage of residual target cells was determined using FCM at 48 hours.

In vivo experiments

9-week-old NSG mice were used with the approval of the Institutional Animal Care and Use Committee of Peking Union Medical College. Mice were administered intravenous injections of 1×10⁶ Molm13^luc cells, engineered in our laboratory through the transfection of Molm 13 cells with luciferase, on day − 3. They were randomly assigned to three groups based on their weights and bioluminescence intensity on day 0. On day 1, mice received intravenous administration of 1×10⁷ VEC-T or CAR-T cells.To investigate the bystander T cell involvement, Molm13^luc cells inoculated mice received 5×10⁶ VEC-T or CAR-T cells on Day 1, followed by 5×10⁶ UTD-T cells on Day 4. Additionally, a control group was established, which received a CAR.BsAB-T treatment and subsequent PBS administration on Day 4.

Mice body weights were monitored weekly. For dynamic tumor burden monitoring, mice were intraperitoneally anesthetized with avertin, infused with D-luciferin (150 mg/kg body weight), and subjected to weekly bioluminescence imaging using Caliper IVIS Lumina II (Caliper Life Sciences, USA). Overall survival time was recorded.

Statistical analysis

The statistical analysis of the data was performed using GraphPad Prism 8.0. Data were presented as mean ± SEM. A two-tailed Student’s t-test was applied to compare parametrically distributed variables between two groups. For analyses involving three or more groups, a two-way ANOVA with Tukey’s multiple comparison test was employed. The Kaplan-Meier technique was used to estimate overall survival, Log-rank (Mantel- Cox) test was used to assess differences. Statistical significance is indicated by the symbols: *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Expression of IL10R and CD33 in bone marrow mononuclear cells of AML patients

Using flow cytometry (FCM), we assessed the expression of CD33, IL10RA and IL10RB in bone marrow mononuclear cells (BMMNCs) of newly diagnosed AML patients through a CD45/SSC double-parameter scatter plot gating method (Figure S1). The results showed that although the mentioned markers were co-expressed in the primary cells, the positive expression rates of IL10RA [(8.677 ± 8.124)%] and IL10RB [(33.38 ± 31.65)%] were lower than those of CD33 [(92.88 ± 8.214)%; vs IL10RA, p < 0.0001; vs IL10RB, p = 0.0019] (Fig. 1b). More notably, this underscores the significance of epitope spreading through targeting CD33 over the simplistic approach of solely targeting IL10R.

Construction of CAR.BsAb-T and verification of CD33 bsAb secretion

We fused the anti-human CD33 single-chain variable fragment (scFv) with the anti-human CD3 scFv derived from our previous study, and inserted them into our previously constructed second-generation IL 10R CAR, leading to the generation of the CAR.BsAb expression plasmid. As controls, we included vectors featuring the second-generation CAR but lacking the extracellular scFv (4-1BB Vector) (Fig. 1c).

T cells were transduced with the expression vectors, and the infection efficiency of Vector-T, IL10R CAR-T, and CAR.BsAb-T was assessed (Fig. 1d). Although the CAR-T antigen-binding region exhibited stable expression on the cell surface, CAR.BsAb-T cells demonstrated a lower mean fluorescence intensity (MFI) level of CAR compared to IL10R CAR-T cells (Fig. 1e).

Supernatant from Vector-T and CAR.BsAb-T was collected and purified using His-tag affinity chromatography. The result of Western Blot confirmed the secretion of CD33 bsAb (56kDa) (Fig. 1f). In addition, using FCM, the surface expression of a His-tag on Molm13 cells or T cells was detected after co-incubation with purified protein, which validate the binding characteristics of the bsAb with CD3 and CD33 antigens (Fig. 1g). The surface binding of CAR.BsAb-T cells to His-tag or APC-labeled human siglec-3/CD33 protein was detected by FCM, confirming the antigen-specific binding capability of secreted CD33 bsAb (Figure S2).

Additionally, we used ELISA to measure CD33 bsAb concentration in the supernatant. It showed an increase over time post-transduction, with the concentration stabilizing by day 8 (Fig. 1h).

FCM was used to gate AML blasts based on CD45^dim and SSC^low; subsequently, the expression of IL-10RA, IL-10RB, and CD33 in primary cells was analyzed.

FCM detected surface binding of CAR.BsAb-T cells to either His-tag or APC-labeled human Siglec-3/CD33 protein.

In vitro efficacy of CAR.BsAb-T in killing AML cells

To assess the activation initiation of CAR.BsAb-T, T cells from different groups were co-cultured with Molm 13. The activation and proliferation markers, CD69 at 6 hours (Fig. 2a) and CD25 at 24 hours (Fig. 2b), were evaluated using FCM. Compared to the control vector and IL10R CAR-T groups, the levels of early and late activation markers CD69 and CD25 in CAR.BsAb-T group increased, indicating the effective activation of CAR.BsAb-T cells.

Subsequently, co-cultures of leukemia cells, including THP-1, U937, MV4-11 and Molm 13 cells with Vector-T, IL10R CAR-T, and CAR.BsAb-T at varying effector-to-target (E:T) ratios were performed to evaluate antigen-specific cytotoxicity (Fig. 2c-d). These findings demonstrate that CAR.BsAb-T cells do effectively respond to antigen-positive myeloid leukemia cell lines. Moreover, at different time points, they enhance the specific killing effect of IL10R CAR-T to some extent.

The expression proportion of CD107a on the surface of T cells was detected 5h after co-culture at a 1:1 E:T ratio, demonstrating that CAR.BsAb-T induced a more intense degranulation effect (Fig. 2e).

The supernatant was collected after co-culturing at an E:T ratio of 1:1 for 48h, and the secretion of cytokines was detected by FCM (Fig. 2f). More strikingly, in co-culture with Molm13 leukemia cells, CAR.BsAb-T significantly increased the levels of IL-2, TNF-α and IFN-γ, but the level of IL-6, an important factor in cytokine release syndrome (CRS), showed no significant difference from that of IL10R CAR-T, indicating that CAR.BsAb-T increased the killing effect on target cells without causing significant side effects.

Effectiveness of CAR.BsAb-T in vitro lysis of primary AML cells

Primary BMMNCs were randomly selected from six AML patients as target cells (Fig. 3a, Table 1), thereby enabling a further evaluation of the cytotoxicity of CAR.BsAb-T cells against primary leukemia cells. In alignment with prior in vitro cytotoxicity assays on AML cell lines, CAR.BsAb-T cells demonstrated a specific lysis capability that correlated with antigen expression levels (Fig. 3b), and exhibited elevated degranulation levels in comparison to that of IL10R CAR-T cells (Fig. 3c).

In comparison to that of IL10R CAR-T, there was an obvious increase in IL-2 release, while the release of IFN-γ, TNF-α, and IL-6 showed no significant differences (Fig. 3d). FCM analysis showed a marked reduction in the proportion of the abnormal CD34⁺ cell population (Figure S3) within the residual target cells, underscoring the potential clinical applicability of CAR.BsAb-T cells in targeting leukemia stem cells in AML patients.

Table 1

Patient information
Patient ID	Disease	Sample type	CD33(%)	IL10RA(%)
P1	AML	BM	97.77	13.03
P2	AML	BM	99	12.14
P3	AML	BM	87.44	19
P4	AML	BM	93.17	14.21
P5	AML	BM	61.96	13.98
P6	AML	BM	47.36	5.66

Role of CAR.BsAb-T in immune escape

In AML cell lines, Kasumi-1 cells displayed lower surface expression levels of IL10RA and IL10RB compared to the previously mentioned cell lines (Fig. 4a). Co-culturing effector cells with Kasumi-1 at various E:T ratios revealed that CAR.BsAb-T enhanced the cytotoxic effect of IL10R CAR-T (Fig. 4b). The assessment of cytokine secretion in the culture system (Fig. 4c) further demonstrated that the combined strategy effectively addressed immune escape issues arising from lower antigen expression levels.

To model immune escape resulting from the loss of CD33, Thp-1 and U937 cell lines with CD33 knockout (Thp-1^CD33KO, U937^CD33KO) were constructed (Fig. 4d). Vector-T, IL10R CAR-T, CD33 bsAb-T, and CAR.BsAb-T were co-cultured with the aforementioned target cells at different E:T ratios. It was observed that CAR.BsAb-T partially improved the cytotoxic effect and cytokine release of CD33 bsAb-T, but was less potent than IL10R CAR-T (Fig. 4e-f), possibly due to lower surface CAR expression levels compared to IL10R CAR-T.

Myeloid-derived suppressor cells (MDSCs) are immature myeloid lineage cells with immunosuppressive properties that directly contribute to immune escape and promote tumor invasion through various non-immunologic mechanisms [34]. Early-stage MDSCs (eMDSCs) are characterized as lin⁻ (including CD3, CD14, CD15, CD19, CD56) HLA-DR⁻ CD11b⁺ [35]. By co-culturing effector cells with primary BMMNCs obtained from AML patients, the eradication effects of CAR.BsAb-T on eMDSCs could be observed within 36h. (Figure S4)

BMMNCs were cultured with effector T cells at a 1:1 E:T ratio for 36 hours, and representative FCM analysis of the residual proportion of eMDSCs [lin⁻ (including CD3, CD14, CD15, CD19, CD56) HLA-DR⁻ CD11b⁺] was conducted.

Sustained killing activity of CAR.BsAb-T against tumor cells through bystander T cells

To evaluate the effects of the released CD33 bsAb, as previously reported, cell-impenetrable transwell membranes (0.4 µm pore size) were utilized.[28] Effector cells were added to the upper chamber and human primary T cells to the lower chamber (Fig. 5a). After co-culturing for 72 hours, the lower chamber human primary T cells, stained with CFSE, exhibited a decrease in fluorescence intensity coinciding with the appearance of proliferation peaks. This suggests that T cells undergo proliferation and activation in response to CD33 bsAb stimulation. (Fig. 5b).

Next, we speculated whether the untransduced primary T (UTD-T) cells could be induced to exhibit cytotoxic activity. Therefore, the UTD-T cells and target cells Molm 13, U937, or U937^CD33KO at a 1:1 ET ratio were added to the lower chamber (Fig. 5c). It was observed that in the co-culture systems with Molm 13 and U937, these bystander UTD-T cells in the lower chamber could utilize the CD33 bsAb secreted in the upper chamber to exert significant specific cytotoxic effects, while no corresponding killing effect was observed in the U937^CD33KO co-culture system (Fig. 5d).

Cytokine levels in the co-culture system were examined, and showed a notable increase in Th1 cytokines IFN-γ and TNF-α, while no significant difference was observed in IL-2, indicating the antigen-specific cytotoxic effects of bystander UTD-T cells (Fig. 5e).

In order to simulate tumor recurrence in vivo, a rechallenge model involving repeated stimulation of tumor cells every 48 hours for a total of three rounds was implemented. The purpose of this model was to thoroughly evaluate the cytotoxic effects of the aforementioned CAR-T cells during disease recurrence (Fig. 5f). The results indicated that although a decrease in cytotoxicity was observed in CAR.BsAb-T after repeated antigen stimulation, it continued to enhance the enduring killing capacity of IL10R CAR-T. Particularly noteworthy is that, even after the third round of stimulation, the proportion of residual target cells decreased (Fig. 5g).

In vivo Efficacy of CAR.BsAb-T in anti-AML

NSG mice bearing cell line-derived xenograft (CDX) tumors were used to evaluate the in vivo efficacy of the aforementioned CAR-T constructs. These mice were injected with 1×10⁶ Molm 13 luciferase cells (Molm13^luc) on day − 3, followed by an intravenous injection of 1×10⁷ T cells on day 1. The regimen of in vivo anti-tumor effects of the CAR-T constructs was shown in Fig. 6a. The dynamic body weight changes of mice monitored on a weekly basis revealed that, from day 7 onwards, the control group exhibited a decline in body weight, leading to cachexia and rapid progression to death. In contrast, the CAR-T and CAR.BsAb treated experimental groups of mice maintained a stable trend. (Fig. 6b)

Imaging conducted at day 0, 7, 14, 21, and 28 post-transplantation using bioluminescence showed the in vivo infiltration of leukemia cells (Fig. 6c-d), with CAR.BsAb-T contributing to further reduction in the leukemia burden.

Analysis of the difference in survival time demonstrated that, compared to 4-1BB Vector-T, CAR.BsAb-T significantly extended the survival of mice (Fig. 6e).

To further investigated whether CAR.BsAb-T could stimulate bystander T cells to exert tumor killing effects in vivo just as observed in vitro study shown in Fig. 5D, a PDX mouse model was established using 1×10⁶ Molm 13^luc cells and then treated with 5×10⁶ different CAR-T cells. On the third day following this treatment, 5×10⁶ UTD-T cells were infused. Meanwhile, a CAR BsAb-T control group was established and only CAR.BsAb-T treatment (without UTD-T cell infusion) was given (Fig. 7a). Notably, by the 14th day, the 4-1BB Vector group exhibited a significant decrease in body weight and increased mortality due to tumor burden (Fig. 7b-c). At the same time, in the CAR.BsAb-T sequential administration with UTD-T group, a significant reduction in tumor burden and an extended survival period were observed, while no bystander effects were observed in the IL10R CAR-T and CAR.BsAb-T treatment only groups (Fig. 7d-e).

The latest developments in T cell-targeted therapies, including CAR-T cells and bsAb, have shown promise in overcoming existing challenges, as evidenced by encouraging preclinical outcomes. One of the primary challenges in T cell-directed therapies is the occurrence of antigen loss and tumor heterogeneity, both of which can contribute to the evasion of the effects of these therapies[36, 37] .

To address the issue of tumor heterogeneity, a proposed strategy involves targeting various tumor antigens, aligning with the concept of epitope spreading. In this regard, bicistronicity CAR-T cells that are designed to target both CD19 and CD22 are undergoing development in clinical settings[38, 39]. Similarly, combinatorial multi-targeted immunotherapies using bsAbs are being explored for the synergistic effects of targeting multiple antigens simultaneously, with the goal of improving treatment outcomes and minimizing the risk of tumor escape mechanisms. This approach is exemplified by an ongoing phase II trial (NCT03739814), which is evaluating the combination of blinatumomab with the anti-CD22 antibody-drug conjugate (ADC) inotuzumab ozogamicin[40].

Our results suggest that strategy of IL10R CAR.CD33 bsAb-T is effective in eliminating AML cell lines and primary cells expressing varying levels of CD33 and/or IL10R. The secreted CD33 bsAb enhances the activation and cytotoxicity of IL10R CAR-T cells and untransduced T cells towards tumor cells expressing CD33. In vivo experiments offer additional support, demonstrating that the CAR-T cells employing this combined targeting strategy effectively redirect T cells, reduce tumor burden, prolong mouse survival, and are not associated with obvious toxicity.

In this study, we set up a combined targeting strategy incorporating both CAR and bsAb. Firstly, this CAR.BsAb-T could produce a secretory form of bsAb, demonstrating superior anti-tumor efficacy compared to the corresponding second-generation CAR-T, especially in targeting cells with low antigen expression[41–44]. Secondly, our findings confirmed that this approach could recruit bystander effector cells, which had specificity in targeting tumor antigens.

Furthermore, previous studies have underscored various combined targeting strategies[28, 45], particularly the binding of secretory PDL-1 bsAb with HLA-G CAR-T cells, which effectively counteracting the upregulation of immune checkpoint proteins (ICP) [46]. Insights from clinical experiences have elucidated that the dual targeting of antigens is pivotal for the eradication of heterogeneous tumors and in eliciting sustained anti-tumor responses[47]. This experiment similarly adopted a combined strategy to augment the function of IL10 CAR-T or CD33 bsAb-T, thereby circumventing the escape of heterogeneous tumor cells.

However, a diminution in the functionality of CAR was observed during the experiment. This diminution could partly be attributed to the expression levels of CAR on the cell surface. Moreover, the strategy in this study involved the use of the natural ligand of IL-10R, rather than an scFv-based approach. Therefore, investigating the potential correlation in the target selection becomes imperative. On the other hand, recent studies have shown that two distinct antibody-based T cell-redirecting molecules, each bearing the same anti-CD19 clone (19-BiTE and the 19-CAR), result in divergent outcomes concerning immune synapse (IS) formation and signaling[48]. As a result, the influence of TCR-stimulated T cells on CAR-mediated cytotoxicity warrants further exploration in subsequent research phases.

Finally, the strategy of locally delivering bsAb via CAR-T cells, which directly target the tumor, addresses the pharmacokinetic challenges stemming from the rapid clearance of bsAbs, a consequence of their low molecular weight[49]. This approach significantly reduces the need for continuous systemic infusion, as evidenced in the referenced study[50]. In this experiment, the localized delivery method effectively diminishes systemic toxicity and concurrently mitigates the risk of CRS. However, a crucial area for future research is the development of quantitative methods for assessing the in vivo secretion of bsAb.

Overall, the notable findings in this study indicate that the IL10R CAR.CD33 bsAb-T therapy represents an effective strategy.

In summary, in this study, our objective was to address the issue of immune escape caused by the heterogeneous expression of IL10R and CD33, while enhancing the anti-tumor activity of T cell-redirecting bsAbs therapy targeting CD33. We developed a single vector targeting IL10R CAR, which subsequently secreted a CD33 bsAb that dual-targets CD3 and CD33 molecules. These engineered IL10R CAR.CD33 bsAb-T cells were designed to enhance the therapeutic intervention for AML.

CAR: chimeric antigen receptors

BsAbs: bispecific antibodies

AML: acute myeloid leukemia

LSCs: leukemic stem cells

CAR.BsAb: IL10R CAR.CD33 BsAb

FDA: Food and Drug Administration

TAAs: tumor-associated antigens

GO: gemtuzumab ozogamicin

FCM: flow cytometry

BMMNCs: bone marrow mononuclear cells

scFv: single-chain variable fragment

MFI: mean fluorescence intensity

E:T: effector-to-target

eMDSCs: Early-stage Myeloid-derived suppressor cells

UTD-T: untransduced primary T

CDX: cell line-derived xenograft

CRS: cytokine release syndrome

Funding

This work was supported by the National Key Research and Development Program (2021YFC2500300), National Natural Science Foundation of China (81830005, 82341213) and CAMS Innovation Fund for Medical Sciences (2021-I2M-1-041).

Author information

National Key Laboratory of Blood Science, National Clinical Research Center for Blood Diseases, Tianjin Key Laboratory of Cell Therapy for Blood Diseases, Haihe Laboratory of Cell Ecosystem, Institute of Hematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin 300020, China

Zhifeng Yan, Runxia Gu, Nianci Chen, Ting Zhang, Haotian Ma, Yingxi Xu, Shaowei Qiu, Haiyan Xing, Kejing Tang, Zheng Tian, Qing Rao, Min Wang, Jianxiang Wang

Tianjin Institutes of Health Science, Tianjin 301617, China

Zhifeng Yan, Runxia Gu, Nianci Chen, Ting Zhang, Haotian Ma, Yingxi Xu, Shaowei Qiu, Haiyan Xing, Kejing Tang, Zheng Tian, Qing Rao, Min Wang, Jianxiang Wang

The First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou 310006, China

Nianci Chen

Nanfang Hospital, Southern Medical University, Guangzhou 510515, China

Ting Zhang

Contributions

MW and JW conceived, designed and supervised the study, reviewed and approved the manuscript. ZY performed all the experiments, analyzed the data and wrote the manuscript. RG, YX, SQ, QR provided experimental design and guidance. NC, TZ and HM helped with the plasmids construction and mice experiments. HX, ZT and KT helped in blood samples preparation. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Min Wang and Jianxiang Wang.

Ethics declarations

This research was approved by the ethical committee in the Institute of Hematology and Blood Diseases Hospital, and all procedures were in accordance with the Helsinki Declaration. Written informed consent was obtained from each participant.

Availability of data and materials

The datasets used during the current study are available from the corresponding author on reasonable request.

DiNardo CD, Jonas BA, Pullarkat V, et al. Azacitidine and Venetoclax in Previously Untreated Acute Myeloid Leukemia. N Engl J Med. 2020;383:617–29.
Maude SL, Laetsch TW, Buechner J, et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. N Engl J Med. 2018;378:439–48.
Neelapu SS, Locke FL, Bartlett NL, et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. N Engl J Med. 2017;377:2531–44.
Coulie PG, Van den Eynde BJ, van der Bruggen P, Boon T. Tumour antigens recognized by T lymphocytes: at the core of cancer immunotherapy. Nat Rev Cancer. 2014;14:135–46.
Srivastava S, Riddell SR. Chimeric Antigen Receptor T Cell Therapy: Challenges to Bench-to-Bedside Efficacy. J Immunol. 2018;200:459–68.
Xie G, Ivica NA, Jia B, et al. CAR-T cells targeting a nucleophosmin neoepitope exhibit potent specific activity in mouse models of acute myeloid leukaemia. Nat Biomed Eng. 2021;5:399–413.
Ciotti G, Marconi G, Sperotto A, Giannini MB, Gottardi M, Martinelli G. Biological therapy in elderly patients with acute myeloid leukemia. Expert Opin Biol Ther. 2023;23:175–94.
Bross PF, Beitz J, Chen G, et al. Approval summary: gemtuzumab ozogamicin in relapsed acute myeloid leukemia. Clin Cancer Res. 2001;7:1490–6.
Godwin CD, Gale RP, Walter RB. Gemtuzumab ozogamicin in acute myeloid leukemia. Leukemia. 2017;31:1855–68.
Laing AA, Harrison CJ, Gibson BES, Keeshan K. Unlocking the potential of anti-CD33 therapy in adult and childhood acute myeloid leukemia. Exp Hematol. 2017;54:40–50.
Laszlo GS, Estey EH, Walter RB. The past and future of CD33 as therapeutic target in acute myeloid leukemia. Blood Rev. 2014;28:143–53.
Gardner RA, Finney O, Annesley C, et al. Intent-to-treat leukemia remission by CD19 CAR T cells of defined formulation and dose in children and young adults. Blood. 2017;129:3322–31.
Ruella M, Barrett DM, Kenderian SS, et al. Dual CD19 and CD123 targeting prevents antigen-loss relapses after CD19-directed immunotherapies. J Clin Invest. 2016;126:3814–26.
Myers RM, Taraseviciute A, Steinberg SM, et al. Blinatumomab Nonresponse and High-Disease Burden Are Associated With Inferior Outcomes After CD19-CAR for B-ALL. J Clin Oncol. 2022;40:932–44.
Labanieh L, Mackall CL. CAR immune cells: design principles, resistance and the next generation. Nature. 2023;614:635–48.
Liu Y, Wang S, Schubert ML, et al. CD33-directed immunotherapy with third-generation chimeric antigen receptor T cells and gemtuzumab ozogamicin in intact and CD33-edited acute myeloid leukemia and hematopoietic stem and progenitor cells. Int J Cancer. 2022;150:1141–55.
Wang QS, Wang Y, Lv HY, et al. Treatment of CD33-directed chimeric antigen receptor-modified T cells in one patient with relapsed and refractory acute myeloid leukemia. Mol Ther. 2015;23:184–91.
Bernstein ID, Singer JW, Smith FO, et al. Differences in the frequency of normal and clonal precursors of colony-forming cells in chronic myelogenous leukemia and acute myelogenous leukemia. Blood. 1992;79:1811–6.
Walter RB, Appelbaum FR, Estey EH, Bernstein ID. Acute myeloid leukemia stem cells and CD33-targeted immunotherapy. Blood. 2012;119:6198–208.
Xu Y, Mou J, Wang Y, et al. Regulatory T cells promote the stemness of leukemia stem cells through IL10 cytokine-related signaling pathway. Leukemia. 2022;36:403–15.
Chen N, Xu Y, Mou J, et al. Targeting of IL-10R on acute myeloid leukemia blasts with chimeric antigen receptor-expressing T cells. Blood Cancer J. 2021;11:144.
Laszlo GS, Gudgeon CJ, Harrington KH, et al. Cellular determinants for preclinical activity of a novel CD33/CD3 bispecific T-cell engager (BiTE) antibody, AMG 330, against human AML. Blood. 2014;123:554–61.
Zhang T, Chen ML, Liu XY, et al. [Preparation of CD33 targeted bispecific- and trispecific-T cell engagers and their cytotoxicity on leukemia cells]. Zhonghua Xue Ye Xue Za Zhi. 2022;43:376–82.
Barrett DM, Singh N, Porter DL, Grupp SA, June CH. Chimeric antigen receptor therapy for cancer. Annu Rev Med. 2014;65:333–47.
Brinkmann U, Kontermann RE. The making of bispecific antibodies. MAbs. 2017;9:182–212.
Alvarez-Vallina L. Genetic approaches for antigen-selective cell therapy. Curr Gene Ther. 2001;1:385–97.
Blanco B, Holliger P, Vile RG, Alvarez-Vallina L. Induction of human T lymphocyte cytotoxicity and inhibition of tumor growth by tumor-specific diabody-based molecules secreted from gene-modified bystander cells. J Immunol. 2003;171:1070–7.
Choi BD, Yu X, Castano AP, et al. CAR-T cells secreting BiTEs circumvent antigen escape without detectable toxicity. Nat Biotechnol. 2019;37:1049–58.
Davenport AJ, Cross RS, Watson KA, et al. Chimeric antigen receptor T cells form nonclassical and potent immune synapses driving rapid cytotoxicity. Proc Natl Acad Sci U S A. 2018;115:E2068–e2076.
Kim MY, Yu KR, Kenderian SS, et al. Genetic Inactivation of CD33 in Hematopoietic Stem Cells to Enable CAR T Cell Immunotherapy for Acute Myeloid Leukemia. Cell. 2018;173:1439–1453e1419.
An N, Tao Z, Li S, et al. Construction of a new anti-CD19 chimeric antigen receptor and the anti-leukemia function study of the transduced T cells. Oncotarget. 2016;7:10638–49.
Li S, Tao Z, Xu Y, et al. CD33-Specific Chimeric Antigen Receptor T Cells with Different Co-Stimulators Showed Potent Anti-Leukemia Efficacy and Different Phenotype. Hum Gene Ther. 2018;29:626–39.
Chen M, Liu X, Peng N, et al. Construction of CD19 targeted dual- and enhanced dual-antibodies and their efficiency in the treatment of B cell malignancy. Exp Hematol Oncol. 2023;12:64.
Li K, Shi H, Zhang B, et al. Myeloid-derived suppressor cells as immunosuppressive regulators and therapeutic targets in cancer. Signal Transduct Target Ther. 2021;6:362.
Bronte V, Brandau S, Chen SH, et al. Recommendations for myeloid-derived suppressor cell nomenclature and characterization standards. Nat Commun. 2016;7:12150.
Braig F, Brandt A, Goebeler M, et al. Resistance to anti-CD19/CD3 BiTE in acute lymphoblastic leukemia may be mediated by disrupted CD19 membrane trafficking. Blood. 2017;129:100–4.
Brudno JN, Kochenderfer JN. Recent advances in CAR T-cell toxicity: Mechanisms, manifestations and management. Blood Rev. 2019;34:45–55.
Qin H, Ramakrishna S, Nguyen S, et al. Preclinical Development of Bivalent Chimeric Antigen Receptors Targeting Both CD19 and CD22. Mol Ther Oncolytics. 2018;11:127–37.
Cordoba S, Onuoha S, Thomas S, et al. CAR T cells with dual targeting of CD19 and CD22 in pediatric and young adult patients with relapsed or refractory B cell acute lymphoblastic leukemia: a phase 1 trial. Nat Med. 2021;27:1797–805.
Shi Z, Zhu Y, Zhang J, Chen B. Monoclonal antibodies: new chance in the management of B-cell acute lymphoblastic leukemia. Hematology. 2022;27:642–52.
Iwahori K, Kakarla S, Velasquez MP, et al. Engager T cells: a new class of antigen-specific T cells that redirect bystander T cells. Mol Ther. 2015;23:171–8.
Blanco B, Compte M, Lykkemark S, Sanz L, Alvarez-Vallina LT. Cell-Redirecting Strategies to 'STAb' Tumors: Beyond CARs and Bispecific Antibodies. Trends Immunol. 2019;40:243–57.
Yin Y, Rodriguez JL, Li N, et al. Locally secreted BiTEs complement CAR T cells by enhancing killing of antigen heterogeneous solid tumors. Mol Ther. 2022;30:2537–53.
Liu X, Barrett DM, Jiang S, et al. Improved anti-leukemia activities of adoptively transferred T cells expressing bispecific T-cell engager in mice. Blood Cancer J. 2016;6:e430.
Porter CE, Rosewell Shaw A, Jung Y, et al. Oncolytic Adenovirus Armed with BiTE, Cytokine, and Checkpoint Inhibitor Enables CAR T Cells to Control the Growth of Heterogeneous Tumors. Mol Ther. 2020;28:1251–62.
Huang SW, Pan CM, Lin YC, et al. BiTE-Secreting CAR-γδT as a Dual Targeting Strategy for the Treatment of Solid Tumors. Adv Sci (Weinh). 2023;10:e2206856.
Majzner RG, Mackall CL. Tumor Antigen Escape from CAR T-cell Therapy. Cancer Discov. 2018;8:1219–26.
Ramírez-Fernández Á, Aguilar-Sopeña Ó, Díez-Alonso L, et al. Synapse topology and downmodulation events determine the functional outcome of anti-CD19 T cell-redirecting strategies. Oncoimmunology. 2022;11:2054106.
Sanz L, Blanco B, Alvarez-Vallina L. Antibodies and gene therapy: teaching old 'magic bullets' new tricks. Trends Immunol. 2004;25:85–91.
Mun SS, Meyerberg J, Peraro L, et al. Dual targeting ovarian cancer by Muc16 CAR T cells secreting a bispecific T cell engager antibody for an intracellular tumor antigen WT1. Cancer Immunol Immunother. 2023;72:3773–86.

No competing interests reported.

FigS1S4.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

A dual-targeting approach with anti-IL10R CAR-T cells engineered to release anti-CD33 bispecific antibody in enhancing killing effect on acute myeloid leukemia cells

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Introduction

Materials and Methods

Cell lines and primary cells from AML patients

Viral constructs

CAR.BsAb-T cell production and detection of CD33 bsAb

Cytotoxicity Assays

Effects of CD33 bsAb secreted from CAR.BsAb-T Cells

In vivo experiments

Statistical analysis

Results

Expression of IL10R and CD33 in bone marrow mononuclear cells of AML patients

Construction of CAR.BsAb-T and verification of CD33 bsAb secretion

In vitro efficacy of CAR.BsAb-T in killing AML cells

Role of CAR.BsAb-T in immune escape

Sustained killing activity of CAR.BsAb-T against tumor cells through bystander T cells

In vivo Efficacy of CAR.BsAb-T in anti-AML

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1