Effects of on TLRs/MyD88 related pathways with infected by spring viremia of carp virus (SVCV) in Common Carp

doi:10.21203/rs.3.rs-3926623/v1

Download PDF

Research Article

Effects of on TLRs/MyD88 related pathways with infected by spring viremia of carp virus (SVCV) in Common Carp

https://doi.org/10.21203/rs.3.rs-3926623/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Spring Viremia of Carp (SVCV) is a highly lethal viral infection that poses a significant threat to the survival and economic value of carp populations. The innate immune system serves as a robust defense mechanism against microbial intrusions. In this study, we delve into the intricate interaction between the Toll-like receptor (TLR) signaling pathway and SVCV.Our research findings unveil a noteworthy response to SVCV infection in EPC cells, characterized by an upregulation in the mRNA expression of key TLRs, namely TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9. These findings strongly suggest their pivotal role in triggering the immune response against SVCV. Furthermore, our investigation delves into the therapeutic potential of ST2825, a MyD88 inhibitor, in mitigating the impact of SVCV infection. We observe that ST2825 effectively suppresses the production of the MyD88 protein, resulting in a notable reduction in mRNA expression levels of SVCV-G. This inhibition extends to the modulation of immune-related genes such as IRAK1 and IRF7, showcasing its potential as a therapeutic intervention. Notably, the ST2825-treated group demonstrates a significant decrease in the rate of cell apoptosis, underlining its potential in mitigating the detrimental effects of SVCV infection. Additionally, our study explores the mRNA expression of TRAF6, IRAK1, IRF3, and IRF7 in renal tissue. We observe a substantial increase in their expression levels in both the ST2825 and SVCV groups when compared to the control group, shedding further light on the intricate interplay within the TLR/MyD88-associated pathways during SVCV infection. In conclusion, our research enhances our understanding of how SVCV infection influences the TLR/MyD88-associated pathways. These findings provide critical insights into SVCV development and lay the groundwork for potential disease control strategies and the development of innovative therapeutic approaches.

spring viremia of carp virus

TLRs

MyD88

ST2825

Spring Viremia of Carp Virus (SVCV), originally identified in Europe(Fijan N, 1971), poses a substantial threat to the aquaculture industry, causing mortality rates as high as 90% among juvenile fish(Ahne, Bjorklund, Essbauer, Fijan, Kurath, Winton, 2002). Infected fish exhibit various symptoms, including reduced swimming capabilities(Ahne W, 2002), equilibrium issues, inflamed anuses(Wang, Zhang, Lu, Wang, Liu, Liu, Liu, 2017; Zhang, Gui, 2015), abdominal distension(Teng, Liu, Lv, Fan, Zhang, Qin, 2007), and visible hemorrhagic spots on their ocular orbs and dermal surface(Chen, Liu, Li, Zhang, 2008). Recognizing its severe impact, the World Organization for Animal Health has classified SVCV as a mandatory notifiable piscine contagion. The outbreak of SVCV is closely correlates with water temperature, with optimal conditions for the virus falling within the range of 16–17℃(Jiao, Wang, Qian, Li, 2023). Rarely does the disease manifest when water temperatures exceed 23℃ or fall below 10℃(Zheng, Zhang, Li, Zhang, Chen, Wang, Zhu, 2021). Furthermore, SVCV infection transmission is facilitated through excreta and parasitic invertebrates. Once infection takes hold, eradication from the afflicted ponds becomes an imposing challenge. Consequently, gaining profound insights into the molecular regulatory mechanisms of SVCV within host organisms is of utmost importance.

Innate immunity stands as the first line of defense in the immune system, with Pattern Recognition Receptors (PRRs) acting as molecular sentinels that identify invading pathogens within the host(Lu, Gullett, Kanneganti, 2022). PRRs are distributed throughout the bloodstream, cell surfaces, endosomes, and the cytoplasm(Medzhitov, 2001). They can be broadly categorized into three classes: Nucleotide-binding Oligomerization Domain-like Receptors (NLRs), Retinoic Acid-Inducible Gene-like Receptors (RLRs), and Toll-like Receptors (TLRs). These receptor families collectively recognize Pathogen-Associated Molecular Patterns (PAMPs)(Guo, Chen, Zhang, Fang, Liu, Zhang, Zhu, Zhan, 2023).

Among them, Toll-like Receptors play a pivotal role in detecting a wide array of microbial patterns and orchestrating the activation of the innate immune system(Fu, Harrison, 2021). From an evolutionary perspective, TLRs emerge as integral components of the innate immune system, wielding critical importance in the host's defense against pathogenic invasions(Lien, Ingalls, 2002). However, imbalances in TLR signaling, especially the excessive release of inflammatory cytokines, have been associated with various diseases, including autoimmune disorders and chronic inflammation. The overactivation of TLRs invariably entangles itself in the pathogenesis of numerous inflammatory diseases. Therefore, the inhibition of the TLR signaling pathway has been postulated as an effective therapeutic strategy to curb unwarranted, disease-related inflammatory responses(Akashi-Takamura, Miyake, 2006).

Abdul Y et al.(Abdul, Abdelsaid, Li, Webb, Sullivan, Dong, Ergul, 2019) uncovered in their research that during the convalescent phase in diabetic animals, there emerges cerebral vascular degeneration and endothelial cell demise. This phase is marked by elevated expression of TLR4, MyD88, NF-κB, and IL-6. It is well-established that viruses, in a classic immunological cascade, are also adept at recognizing and binding to TLR4(Noreen, Shah, Mall, Choudhary, Hussain, Ahmed, Jalil, Raza, 2012). This interaction triggers the MyD88 adaptor, activating the nuclear transcription factor NF-κB, subsequently leading to the release of cytokines and an array of inflammatory proteins(Zhu, Han, Wang, Wang, Chen, Cai, Wu, Zhu, Liu, Han, Dong, Jia, Liu, 2023). MyD88 belongs to the Toll/IL-1R family and the death domain family of members, encoding a protein featuring three functional domains: the N-terminal death domain, a central region, and the C-terminal TIR domain(Deepika, Sreedharan, Paria, Makesh, Rajendran, 2014). In 2011, Pawapol Kongchum et al.(Kongchum, Hallerman, Hulata, David, Palti, 2011) identified two MyD88 gene sequences (GU809230 and GU809231) in common carp, denoted as MyD88a (ccMyD88a) and MyD88b (ccMyD88b). Amino acid sequence alignments revealed a high degree of conservation in carp MyD88 proteins. Studies by Min Liu et al.(Liu, Li, Zhao, Lin, Che, Xu, Wang, Xu, Niu, 2018) demonstrated that in Fusarium solani keratitis, BoxB plays a pro-inflammatory role in the corneal antifungal immune response through the HMGB1-TLR4-MyD88 signaling pathway. However, further investigation is required to determine whether MyD88 plays a role in SVCV replication.

The rapid expansion of global aquaculture and the ongoing progress of human society have led to a steady increase in the demand for protein consumption. this study aims to investigate the alterations in Toll-like Receptor (TLR) signaling pathways induced by SVCV infection in carp epithelial cells. Additionally, we explore the potential of the MyD88 inhibitor ST2825 in preventing these alterations, both in vivo and in vitro, while also validating the presence of the MyD88 protein. Our research aims to provide insights into the molecular regulatory mechanisms underlying the immune response to SVCV infection in carp, thereby contributing to the prevention and control of SVCV and its associated viral diseases.

2.1 Fish rearing conditions and ethical statements

Cyprinus carpio (length: 10.20 ± 3.5 cm, an average weight: 60 ± 1.5 g) were obtained from the Jilin Xinlicheng Reservoir in Changchun, China. Fish adapt to an experimental environment of 16.5 ± 1.5° C. The water pH exhibited a value of 7.0 ± 0.5, under the influence of the natural photoperiod. The fish were provided with food twice daily for a period of two weeks, with the amount being 2% of their body weight. Standard The experimental animal protocol used in this study followed the JLAU Animal Experiment Regulations (JLAU08201409) and the National Institutes of Health Guidelines for the Care and Use of Experimental Animals (National Institutes of Health Publication No. 8023).

2.2 Cell lines, virus, and reagents

EPC cells, obtained from the repository of the Fisheries Teaching and Research Office at Jilin Agricultural University in Changchun City, Jilin Province, China, were meticulously cultured under controlled conditions at 27.0 ± 0.5°C in a humidifed atmosphere with 5% CO2. They were maintained in Medium 199 (Gibico, USA) supplemented with 10% fetal bovine serum (Gibico, USA). Notably, SVCV was overseen by the Fisheries Teaching and Research Office at Jilin Agricultural University. Monoclonal mouse antibodies with His tags, goat anti-mouse secondary antibodies labeled with HRP, primary antibodies against β-actin, secondary antibodies against β-actin, and MyD88 were procured from Abmart Shanghai Co., Ltd. The BCA protein quantification kit was acquired from Solarbio Co., Ltd. ST2825 was obtained from MCE, USA. DMSO, the cell apoptosis assay kit, and the chromogenic solution were purchased from Invitrogen Corporation.

2.3 Determination of CCK-8 activity at different concentrations of ST2825

Following the experimental procedure outlined by Zhang et al.(Zhang, Li, Ge, Guo, Yang, 2011), cells were gently placed within a suspension of EPC cells in a 96-well plate, with each well containing 100µL. They were cultured at a temperature of 27℃ under an environment enriched with 5% carbon dioxide for a duration of 24 hours. Subsequently, the 5 µmol/L, 10 µmol/L, 20 µmol/L ST2825 inhibitor was introduced, and the cells were allowed to incubate further. After a 24-hour cultivation period, 10µL of CCK solution was added, followed by a 14-hour incubation. Optical density (OD) was then monitored at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader (Eon, BioTek Instruments Inc., USA).

2.4 Virus TCID₅₀ assay

By inoculating virus solutions containing M199 culture medium (10^− 1 to 10^− 10), 100 µL of the respective virus dilutions were introduced into each well, with 16 wells reserved for negative controls. The assessment of cellular damage was determined using the TCID₅₀ method, calculated through the Karber formula:

LgTCID50 = L - d(s − 0.5)

L: represents the logarithm of the highest dilution.

d: stands for the difference between logarithmic dilutions.

s: represents the sum of lesion pore ratios.

2.5 Challenge experiment

The experiment was divided into three groups: the control group, the ST2825 group, and the SVCV group, each comprising 30 fish. In the SVCV group, a 200 µL solution of TCID₅₀ virus was injected, while the control group and the ST2825 group received an equivalent volume of PBS. After 12 hours, the ST2825 group of fish received a 200 µL injection of ST2825, with a dosage of 10 µg, while the other experimental groups received an equivalent volume of PBS via intraperitoneal injection. The ST2825 group received daily injections. On days 1, 3, 5, and 7, the carp were dissected, and their kidneys were aseptically collected, rapidly immersed in liquid nitrogen, labeled, and stored at -80℃.

2.6 Real-Time PCR examination

Total RNA was extracted from kidney and EPC cells using the Trizol method (Invitrogen). RNA concentration was determined using RNA2000c (Thermo Fisher Scientific, Foster City, USA), and the concentrations were adjusted to 1000 ng using the All Formula Gold reverse transcription kit (All Formula Gold, Beijing, China). Subsequently, complementary DNA (cDNA) was synthesized. The PCR reaction system was consistent with Dai J et al. The primer sequences for each gene are listed in Table 1. Real-time PCR was performed using the Biosystems® 7500 Real-Time PCR System (Thermo Fisher Scientific, Foster City, CA, USA) with SYBR Green Master Mix (Takara, Dalian, China).

Table 1

Primer sequence in this study
Primer	Sequence(5’-3’)	Sequence(3’-5’)
β-actin	TGAAGATCCTGACCGAGCGT	GGAAGAAGAGGCAGCGGTTC
TLR2	GAACCTTGTAGGAAACCCAT	CCCATCTAAGCCATTCTTGT
TLR3	CTGTCTTCCTTGCTTTTGTACTCG	CCCAGTTTAGCAGATTTCAGTTTGT
TLR4	TAGCATCCCACTTCATGTTC	GCTGTCAATGTCAAAGTCTG
TLR7	GGGAATGCAATGAGCCAGA	GAAGAGAACATCAAATCCAGACGA
TLR8	AGCTATTTTCCAAGGACG	CGATAAGATTATGGCTCAAG
TLR9	TTCCCCTCCTGAAGCAT	CCCTGACTGCCTTATTACTCG
IRF3	GTCACCATCCTCCAGCAGATCAAC	CCAGCGTCATTCTCCACCAACTC
IRF7	TCTGAGCTGAGAGGAGAGCCAATC	CTCTGAATGCTGTCCAGGATGCG
TRAF6	TCTCCGCTCGGCAGTACAGAC	CCTCAAGCAGCACCTCGTTGTC
IRAK1	AGGCTTCCACACCTTCAGTCTCC	TCCTCTGAACACCACTCCGAACC
SVCV-G	TGCTGTGTTGCTTGCACTTATCT	TCAAACKAARGACCGCATTTCG
MyD88	AGGTGCAAGAGGATGGTGGTAGTC	GGCTGAGTGCGAACTTGGTCTG

2.7 Western blot

Cellular and kidney tissue proteins were extracted using a strong protein lysis buffer (RIPA:PMSF:protease inhibitor:phosphatase inhibitor = 100:1:1:1) from Soleberg Bioscience and Technology Co., Ltd., Beijing, China. The lysates were obtained by centrifugation at 12,000 × g for 30 minutes. The protein concentration was determined using the BCA protein quantification assay kit (Abbkine Scientific Co., Georgia, USA). Samples were separated by SDS-PAGE after collection. Gel electrophoresis was performed, followed by gel cutting and wet transfer. The membrane was blocked with 5% skim milk at 37°C for 30 minutes and then incubated at 4°C with primary antibodies against β-actin (1:1000) and MyD88 (1:1000). HRP-conjugated sheep secondary antibodies (1:3000) were applied at 37°C for 30 minutes, and chemiluminescent substrate was used for signal detection.

2.8 Annexin VFITC dyeing

The control group and cells infected with SVCV were treated with pre-cooled PBS solution and centrifuged at 4°C at 1000×g for 5 minutes. Subsequently, cells were treated with 20 µmol/L ST2825 for 12, 24, and 48 hours. The cell concentration was adjusted to 1×10⁶ cells/ml by re-suspending in 1× binding buffer working solution. Then, 100 µL of the cell suspension was transferred to a new tube, and 5 µL of Annexin V-FITC and 5 µL of propidium iodide (PI) were added. The mixture was gently mixed, incubated for 15 minutes in the dark, and observed under a fluorescence microscope to capture apoptotic cell images.

2.9 Statistical analysis

All experimental results were assessed using the mean and standard deviation. Relative quantitative data were analyzed through the 2^−ΔΔCt method. Statistical analyses were performed using SPSS 20.0 (IBM, USA) and GraphPad Prism 8.0.2 (GraphPad Software, La Jolla, CA, USA), and p-values < 0.05 were judged as significant.

3.1 ST2825 Optimal Concentration Screening

Figure 1 illustrates that the inclusion of ST2825 effectively suppressed MyD88 expression. Notably, both concentrations of 10 µmol/L and 20 µmol/L of ST2825 demonstrated inhibitory effects on MyD88, with the latter exhibiting the most pronounced inhibition. Consequently, 20 µmol/L was selected as the subsequent concentration for inhibition.

3.2 Analysis of TLRs gene expression after SVCV infection of EPC cells

Relative to the control group, the expression of TLR2 in EPC cells exhibited an increase at 6h and 12h, reaching its peak at 48h, with significant difference (P < 0.05) (Fig. 2A). TLR3 expression reached its zenith at 12h (P < 0.05) (Fig. 2B). Although TLR3 expression decreased at 24h and 48h, it remained significantly higher than the control. TLR4 expression in EPC cells infected with SVCV was increased at 12h, 24h, and 48h compared to the control (Fig. 2C). TLR7 expression significantly increased in EPC cells infected with SVCV compared to the control, peaking at 6h (Fig. 2D). TLR8 expression in EPC cells infected with SVCV peaked at 6h and subsequently decreased (Fig. 2E). TLR9 expression in EPC cells infected with SVCV exhibited a progressive increase over time compared to the control group (Fig. 2F). These findings indicate an overall elevation in the expression of Toll-like receptors (TLRs) in EPC cells following SVCV infection.

3.3 Analysis of MyD88 and SVCV-G transcript levels in vivo

As depicted in Fig. 3A, MyD88 exhibited elevated expression levels in the kidneys following SVCV infection in carp, whereas its expression was notably down-regulated in the ST2825 treatment group. The transcript levels of SVCV-G peaked on the 1rd (Fig. 3B), gradually declining by the 3rd day but maintaining a relatively high. However, with the introduction of ST2825, the transcript levels of SVCV-G exhibited a substantial decrease compared to those in the SVCV group, with a noticeable statistically significant difference (P < 0.05).

3.4 Analysis of transcript levels of IRAK1,TRAF6,IRF3 and IRF7 in vivo after ST2825 treatment

Further detection of immune genes IRAK1 (Fig. 4A), TRAF6 (Fig. 4B), IRF3 (Fig. 4C), and IRF7 (Fig. 4D) in carp kidneys. The findings indicated that the amount of IRAK1 mRNA showed an initial increase and subsequent reduction after SVCV infection, with the highest level of expression observed at 5 d. Significantly, the level of IRAK1 expression in the ST2825 group was notably lower compared to the SVCV group. At 1 d, 3 d, and 5 d, the expression of TRAF6 in the ST2825 group showed no significant difference compared to the SVCV group, whereas at 7 days, it was notably lower than that in the SVCV group. At 3 d and 5 d, the expression of IRF3 lower in the ST2825 group compared to the SVCV group (P < 0.05). Additionally, IRF7 expression was down-regulated in the ST2825 group compared to the SVCV group (P < 0.05).

3.5 Analysis of MyD88 and SVCV-G transcript levels in EPC cells after ST2825 treatment

The mRNA levels of MyD88 and SVCV-G were monitored at 3h, 6h, 12h, 24h, and 48h. Notably, 1% DMSO exhibited no significant impact on the cells. MyD88 transcript levels were found to be upregulated in EPC cells stimulated by SVCV infection, reaching peak expression at 24h. The introduction of ST2825 markedly down-regulated MyD88 expression compared to the SVCV group (Fig. 5A). In comparison to the control group, the transcript levels of the SVCV-G gene initially increased and subsequently decreased, displaying significant differences (P < 0.05) (Fig. 5B), with the highest expression observed at 12h. Following the addition of ST2825, the SVCV-G transcript levels showed no significant differences at 3h and 6h but demonstrated a notable down-regulation (P < 0.05) at 12h, compared to the SVCV group.

3.6 Effect of MyD88 inhibition on transcript levels of IRAK1, TRAF6, IRF3 and IRF7 in EPC cells

Figure 6 demonstrates that the transcription level of TRAF6 (Fig. 6A) was notably increased in the SVCV group compared to the control group, with the maximum expression observed at 12 h. The expression of IRF7 (Fig. 6B) exhibits a biphasic pattern, initially rising and subsequently declining, reaching its peak at 24 h. The expression level of IRAK1 (Fig. 6C) peaked at 12 h. The expression of IRF3 (Fig. 6D) has a pattern of initial augmentation followed by diminution, reaching its peak level at 12 h. The transcription level of TRAF6 in the ST2825 group showed a substantial drop after 48 h compared to the SVCV group (P < 0.05). The expression of IRF7 exhibited a biphasic pattern, initially increasing and subsequently decreasing. However, the expression levels at each time point were markedly diminished in the SVCV group. The expression levels of IRAK1 and IRF3 were considerably reduced (P < 0.05).

3.7 Effect of MyD88 inhibition on apoptotic cell death levels

EPC cells that were infected with SVCV were treated with ST2825. Afterward, all cells were collected for flow cytometry examination at 12 h, 24 h, and 48 h. The results revealed that the control group exhibited an apoptosis rate of 3.56% after 12 h, but the SVCV group showed an apoptosis rate of 4.69% and the ST2825 group had an apoptosis rate of 4.05% (Fig. 7A). The control group exhibited an apoptosis rate of 4.56% after 24 h, whereas the SVCV group showed an apoptosis rate of 10.76% and the ST2825 group had an apoptosis rate of 5.05% (Fig. 7B). The control group had an apoptosis rate of 6.46% at 48 h, while the SVCV group had an apoptosis rate of 15.68% and the ST2825 group had an apoptosis rate of 12.35% (Fig. 7C). The rate of apoptosis in cells infected with SVCV is positively correlated with the duration of time across different time intervals. During the same time frame, the ST2825 group demonstrated a decrease in the rate of cell death in comparison to the SVCV group.

Carp is one of the important economic fish species in China(Dai, Zhang, Du X, Zhang, Li, Guo, Li, 2018), is abundant in nutrients including carbohydrates, animal protein, fatty acids, vitamins, and polyunsaturated fatty acids(Arulkumar, Paramasivam, Rajaram, 2017; Santos, Caldas, Primel, Tesser, Monserrat, 2016). Furthermore, it also comprises of trace elements such as copper, zinc, iron, and selenium. At the same time, it is easy to adjust to changes in the environment(Mesquita, Borcato, Huntingford, 2015). The innate immune response is crucial. The TLR pathway has been extensively studied in the context of antiviral treatment. Toll-like receptors play a vital role in the innate immune system by recognizing certain molecular patterns associated with infections. The Toll-like receptor (TLR) displays prominent characteristics in both invertebrates and vertebrates(Yu, Wang, Zhao, Zhou, Yang, Guan, 2014). However, there is a dearth of study about the alterations in TLR after viral stimulation in carp. In 2003, Cyril Jault et al. (Jault, Pichon, Chluba, 2004) discovered 19 Toll-like receptor (TLR) genes by using zebrafish as an experimental model. The Toll-like receptors (TLRs) responsible for activating the host's antiviral immune responses are TLR2, TLR3, TLR4, TLR7, TLR8, TLR9, TLR13, and TLR22. TLRs have the ability to activate various pathways in signal transduction by enlisting distinct adapters for each TLR. Toll-like receptors (TLRs) have the ability to trigger the activation of NF- κ B and AP1, which in turn leads to the production of inflammatory cytokines. Additionally, TLRs can activate IRF3 or IRF7, resulting in the synthesis of I-IFN. This activation initiates antiviral responses within both the innate and adaptive immune systems(Shan, Liu, Jiang, Zhu, Li, Xing, Yang, 2018). According to our research, the expression levels of TLR2 and TLR9 peak at 48 h after SVCV infection, whereas TLR3 and TLR4 reach their greatest levels at 12 h, and TLR7 and TLR8 reach their maximum levels at 6 h. This suggests that following SVCV infection, alterations occur in the TLR pathway within the body. These findings align with the results of Shengzhen Jin et al.(Jin, Zhao, Wang, Su, Wang, Ding, Li, Xiao, 2018), who provided evidence that TLR can initiate subsequent immunological signaling pathways.

MyD88 is an adaptable protein that triggers subsequent immune responses in TLR. Plays a crucial role in the host's immunological response to infection and inflammation(Dinarello, 1996). The MyD88-dependent pathway engages with the IL-1R-related protein kinase IRAK4 via its death domain, resulting in the subsequent activation of IRAK1(Suzuki, Suzuki, Duncan, Millar, Wada, Mirtsos, Takada, Wakeham, Itie, Li, Penninger, Wesche, Ohashi, Mak, Yeh, 2002). Afterwards, IRAK1 and IRAK4 will interact with TNF receptor related factor 6, leading to the activation of TGF kinase 1, which can initiate NF- κB activation. The activation of B and IRFs induces the synthesis of many antiviral agents, including I-IFNs, inflammatory cytokines, and chemokines. ST2825 is a specialized compound that blocks the process of MyD88 dimerization. The MyD88-TIR domain's 7-peptide structure in the BB ring is targeted for drug development research. This structure is crucial for the homodimerization of MyD88 and its interaction with receptors. By blocking the homodimerization of MyD88 and recruiting IRAK1 and IRAK4, drug development aims to interfere with this process(Loiarro, Capolunghi, Fanto, Gallo, Campo, Arseni, Carsetti, Carminati, De Santis, Ruggiero, Sette, 2007). Our study revealed that the application of ST2825 in a laboratory setting effectively suppresses the production of MyD88, resulting in a decrease in the transcription of SVCV-G and a decrease in the expression of IRF7 and IRAK1. This ultimately leads to a reduction in cell apoptosis. This is comparable to the findings of research 102, which showed suppression of TLR4/MyD88/NF- κ. The B signalling pathway has the ability to suppress the activity of the inflammatory cytokine TNF- α. The upregulation of IL-6 and downregulation of p65 and caspase-3 mitigated cell death induced by cerebral ischemia. While the expression levels of TRAF6 and IRF3 did not show any notable variation, it is hypothesized that they may be associated with the signalling pathways of MyD88 dependent and MyD88 independent pathways in the TLR signalling pathway.

TRAF6 has the ability to control the MAPK family and impact cell proliferation in the MyD88 independent pathway. Our analysis revealed that the utilization of ST2825 to inhibit MyD88 resulted in a significant reduction in the transcription level of IRAK1 in carp kidneys, as compared to the SVCV group. Nevertheless, the transcription level of TRAF6 did not exhibit any substantial alteration. The decline in transcription activity of the SVCV-G gene suggests that blocking MyD88 could stimulate the body to engage alternate signaling pathways for antiviral responses or reduce the synthesis of inflammatory components, leading to a drop in viral transcription.

Upon infecting the host, the virus has the ability to stimulate the transcription of many genes, including type I IFN. IRF3 and IRF7 play crucial roles as transcription factors in signal transduction pathways. IRF3 is present in many tissues of healthy organisms and is structurally expressed. It is found in an inactive form in the cytoplasm. Honda et al.(Honda, Yanai, Negishi, Asagiri, Sato, Mizutani, Shimada, Ohba, Takaoka, Yoshida, Taniguchi, 2005) showed that mice without the IRF7 gene were more vulnerable to viral infection than those lacking MyD88, and found that the transcription factor IRF7 generated IFN in the virus triggered MyD88 independent pathway and TLR activated MyD88 dependent pathway- α/β The expression is crucial. Highlighting the significance of IRF7-mediated activation of systemic IFN response in the context of antiviral medications for congenital infections. Our research findings align closely with this. Following the inhibition of MyD88 by ST2825, the transcription level of IRF7 in carp kidneys was notably decreased in comparison to the SVCV group (P < 0.05).

In summary, this study sheds light on the alterations in Toll-like Receptor (TLR) signaling pathways induced by Spring Viremia of Carp Virus (SVCV) infection in carp epithelial cells and the potential of the MyD88 inhibitor ST2825 in preventing these alterations. We have shown that SVCV infection leads to an upregulation of various TLRs in carp cells, indicating an active immune response. Moreover, the inhibition of MyD88 using ST2825 effectively suppressed MyD88 expression, reduced the transcription of SVCV-G, and modulated the expression of key immune genes such as IRAK1, IRF3, IRF7, and TRAF6. This led to a decrease in cell apoptosis, suggesting that MyD88 inhibition may play a crucial role in mitigating the inflammatory response and viral replication associated with SVCV infection.

Author contribution

XJ carried out design of the study, implementation of the experiment and drafted the manuscript. ZYG participated in design of the study and performed the statistical analysis. JD participated in its design and coordination and helped to draft the manuscript. ADQ improved the manuscript. YHL supervision and Funding acquisition. All authors read and approved the final manuscript.

Funding

This work was supported by Jilin Science and Technology Development Program Key R&D Projects (20230202076NC), Jilin Province Modern Agricultural Industry Technology Demonstration and Promotion Project (202301401), Jilin Province Outstanding Young and Middle-aged Talent Project in Science and Technology Innovation and Entrepreneurship (2024), National Key Research and Development Project (2023YFD2401003).

Data availability

No data was used for the research described in the article.

Ethics Approval

Stringent adherence to guidelines for the ethical care and use of laboratory animals, including the principles of the '3Rs' (Replacement, Reduction, Refinement) and the rules established by the National Research Council, is observed throughout all animal experiments. Jilin Agricultural University Animal Ethics Committee gave its approval to every animal experiment.

Consent to participate

Consent was obtained from individual participants.

Consent for publication

All authors review and approve the manuscript for publication.

Conflict of interest

The authors declare no competing interests.

Abdul, Y., Abdelsaid, M., Li, W., Webb, R.C., Sullivan, J.C., Dong, G., Ergul, A., 2019. Inhibition of Toll-Like Receptor-4 (TLR-4) Improves Neurobehavioral Outcomes After Acute Ischemic Stroke in Diabetic Rats: Possible Role of Vascular Endothelial TLR-4. MOL NEUROBIOL 56, 1607-1617.
Ahne W, B.H., 2002. Essbauer S,et al. Spring viremia of carp (SVC). DIS AQUAT ORGAN 3, 261-272.
Ahne, W., Bjorklund, H.V., Essbauer, S., Fijan, N., Kurath, G., Winton, J.R., 2002. Spring viremia of carp (SVC). DIS AQUAT ORGAN 52, 261-272.
Akashi-Takamura, S., Miyake, K., 2006. Toll-like receptors (TLRs) and immune disorders. J INFECT CHEMOTHER 12, 233-240.
Arulkumar, A., Paramasivam, S., Rajaram, R., 2017. Toxic heavy metals in commercially important food fishes collected from Palk Bay, Southeastern India. MAR POLLUT BULL 119, 454-459.
Chen, Z.Y., Liu, H., Li, Z.Q., Zhang, Q.Y., 2008. Development and characterization of monoclonal antibodies to spring viraemia of carp virus. VET IMMUNOL IMMUNOP 123, 266-276.
Dai, J., Zhang, L., Du X, Zhang, P., Li, W., Guo, X., Li, Y., 2018. Effect of Lead on Antioxidant Ability and Immune Responses of Crucian Carp. BIOL TRACE ELEM RES 186, 546-553.
Deepika, A., Sreedharan, K., Paria, A., Makesh, M., Rajendran, K.V., 2014. Toll-pathway in tiger shrimp (Penaeus monodon) responds to white spot syndrome virus infection: evidence through molecular characterisation and expression profiles of MyD88, TRAF6 and TLR genes. FISH SHELLFISH IMMUN 41, 441-454.
Dinarello, C.A., 1996. Biologic basis for interleukin-1 in disease. BLOOD 87, 2095-2147.
Fijan N, P.Z.S.D., 1971. Isolation of the viral causative agent from the acute form of infectious dropsy of carp., 125-138.
Fu, Y.L., Harrison, R.E., 2021. Microbial Phagocytic Receptors and Their Potential Involvement in Cytokine Induction in Macrophages. FRONT IMMUNOL 12, 662063.
Guo, B., Chen, J.H., Zhang, J.H., Fang, Y., Liu, X.J., Zhang, J., Zhu, H.Q., Zhan, L., 2023. Pattern-recognition receptors in endometriosis: A narrative review. FRONT IMMUNOL 14, 1161606.
Honda, K., Yanai, H., Negishi, H., Asagiri, M., Sato, M., Mizutani, T., Shimada, N., Ohba, Y., Takaoka, A., Yoshida, N., Taniguchi, T., 2005. IRF-7 is the master regulator of type-I interferon-dependent immune responses. NATURE 434, 772-777.
Jault, C., Pichon, L., Chluba, J., 2004. Toll-like receptor gene family and TIR-domain adapters in Danio rerio. MOL IMMUNOL 40, 759-771.
Jiao, X., Wang, L., Qian, A., Li, Y., 2023. Proteomic analysis of EPC cell replication effect of Hsp70 on SVCV infection at different temperatures. AQUACULTURE 576, 739875.
Jin, S., Zhao, X., Wang, H., Su, J., Wang, J., Ding, C., Li, Y., Xiao, T., 2018. Molecular characterization and expression of TLR7 and TLR8 in barbel chub (Squaliobarbus curriculus): Responses to stimulation of grass carp reovirus and lipopolysaccharide. FISH SHELLFISH IMMUN 83, 292-307.
Kongchum, P., Hallerman, E.M., Hulata, G., David, L., Palti, Y., 2011. Molecular cloning, characterization and expression analysis of TLR9, MyD88 and TRAF6 genes in common carp (Cyprinus carpio). FISH SHELLFISH IMMUN 30, 361-371.
Lien, E., Ingalls, R.R., 2002. Toll-like receptors. CRIT CARE MED 30, S1-S11.
Liu, M., Li, C., Zhao, G.Q., Lin, J., Che, C.Y., Xu, Q., Wang, Q., Xu, R., Niu, Y.W., 2018. Boxb mediate BALB/c mice corneal inflammation through a TLR4/MyD88-dependent signaling pathway in Aspergillus fumigatus keratitis. INT J OPHTHALMOL-CHI 11, 548-552.
Loiarro, M., Capolunghi, F., Fanto, N., Gallo, G., Campo, S., Arseni, B., Carsetti, R., Carminati, P., De Santis, R., Ruggiero, V., Sette, C., 2007. Pivotal Advance: Inhibition of MyD88 dimerization and recruitment of IRAK1 and IRAK4 by a novel peptidomimetic compound. J LEUKOCYTE BIOL 82, 801-810.
Lu, J., Gullett, J.M., Kanneganti, T.D., 2022. Filoviruses: Innate Immunity, Inflammatory Cell Death, and Cytokines. PATHOGENS 11.
Medzhitov, R., 2001. Toll-like receptors and innate immunity. NAT REV IMMUNOL 1, 135-145.
Mesquita, F.O., Borcato, F.L., Huntingford, F.A., 2015. Cue-based and algorithmic learning in common carp: A possible link to stress coping style. BEHAV PROCESS 115, 25-29.
Noreen, M., Shah, M.A., Mall, S.M., Choudhary, S., Hussain, T., Ahmed, I., Jalil, S.F., Raza, M.I., 2012. TLR4 polymorphisms and disease susceptibility. INFLAMM RES 61, 177-188.
Santos, R.A., Caldas, S., Primel, E.G., Tesser, M.B., Monserrat, J.M., 2016. Effects of lipoic acid on growth and biochemical responses of common carp fed with carbohydrate diets. FISH PHYSIOL BIOCHEM 42, 1699-1707.
Shan, S., Liu, R., Jiang, L., Zhu, Y., Li, H., Xing, W., Yang, G., 2018. Carp Toll-like receptor 8 (Tlr8): An intracellular Tlr that recruits TIRAP as adaptor and activates AP-1 pathway in immune response. FISH SHELLFISH IMMUN 82, 41-49.
Suzuki, N., Suzuki, S., Duncan, G.S., Millar, D.G., Wada, T., Mirtsos, C., Takada, H., Wakeham, A., Itie, A., Li, S., Penninger, J.M., Wesche, H., Ohashi, P.S., Mak, T.W., Yeh, W.C., 2002. Severe impairment of interleukin-1 and Toll-like receptor signalling in mice lacking IRAK-4. NATURE 416, 750-756.
Teng, Y., Liu, H., Lv, J.Q., Fan, W.H., Zhang, Q.Y., Qin, Q.W., 2007. Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China. ARCH VIROL 152, 1457-1465.
Wang, Y., Zhang, H., Lu, Y., Wang, F., Liu, L., Liu, J., Liu, X., 2017. Comparative transcriptome analysis of zebrafish (Danio rerio) brain and spleen infected with spring viremia of carp virus (SVCV). FISH SHELLFISH IMMUN 69, 35-45.
Yu, X., Wang, Y., Zhao, W., Zhou, H., Yang, W., Guan, X., 2014. Toll-like receptor 7 promotes the apoptosis of THP-1-derived macrophages through the CHOP-dependent pathway. INT J MOL MED 34, 886-893.
Zhang, Q., Gui, J.F., 2015. Virus genomes and virus-host interactions in aquaculture animals. SCI CHINA LIFE SCI 58, 156-169.
Zhang, Y., Li, Z., Ge, X., Guo, X., Yang, H., 2011. Autophagy promotes the replication of encephalomyocarditis virus in host cells. AUTOPHAGY 7, 613-628.
Zheng, Y.Y., Zhang, C., Li, Y., Zhang, P.Q., Chen, G., Wang, G.X., Zhu, B., 2021. Immersion immunization of common carp with bacterial ghost-based DNA vaccine inducing prophylactic protective immunity against spring viraemia of carp virus. J FISH DIS 44, 2021-2029.
Zhu, Y., Han, Q., Wang, L., Wang, B., Chen, J., Cai, B., Wu, C., Zhu, X., Liu, F., Han, D., Dong, H., Jia, Y., Liu, Y., 2023. Jinhua Qinggan granules attenuates acute lung injury by promotion of neutrophil apoptosis and inhibition of TLR4/MyD88/NF-kappaB pathway. J ETHNOPHARMACOL 301, 115763.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Effects of on TLRs/MyD88 related pathways with infected by spring viremia of carp virus (SVCV) in Common Carp

Status:

Version 1

Abstract

Figures

1. Introduction

2 Materials and methods

2.1 Fish rearing conditions and ethical statements

2.2 Cell lines, virus, and reagents

2.3 Determination of CCK-8 activity at different concentrations of ST2825

2.4 Virus TCID₅₀ assay

2.5 Challenge experiment

2.6 Real-Time PCR examination

2.7 Western blot

2.8 Annexin VFITC dyeing

2.9 Statistical analysis

3 Results

3.1 ST2825 Optimal Concentration Screening

3.2 Analysis of TLRs gene expression after SVCV infection of EPC cells

3.3 Analysis of MyD88 and SVCV-G transcript levels in vivo

3.4 Analysis of transcript levels of IRAK1,TRAF6,IRF3 and IRF7 in vivo after ST2825 treatment

3.5 Analysis of MyD88 and SVCV-G transcript levels in EPC cells after ST2825 treatment

3.7 Effect of MyD88 inhibition on apoptotic cell death levels

4 Disscussion

5 Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

Effects of on TLRs/MyD88 related pathways with infected by spring viremia of carp virus (SVCV) in Common Carp

Status:

Version 1

Abstract

Figures

1. Introduction

2 Materials and methods

2.1 Fish rearing conditions and ethical statements

2.2 Cell lines, virus, and reagents

2.3 Determination of CCK-8 activity at different concentrations of ST2825

2.4 Virus TCID50 assay

2.5 Challenge experiment

2.6 Real-Time PCR examination

2.7 Western blot

2.8 Annexin VFITC dyeing

2.9 Statistical analysis

3 Results

3.1 ST2825 Optimal Concentration Screening

3.2 Analysis of TLRs gene expression after SVCV infection of EPC cells

3.3 Analysis of MyD88 and SVCV-G transcript levels in vivo

3.4 Analysis of transcript levels of IRAK1,TRAF6,IRF3 and IRF7 in vivo after ST2825 treatment

3.5 Analysis of MyD88 and SVCV-G transcript levels in EPC cells after ST2825 treatment

3.7 Effect of MyD88 inhibition on apoptotic cell death levels

4 Disscussion

5 Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

2.4 Virus TCID₅₀ assay