Melatonin Reduce Morphine-Induced Hyperalgesia and Tolerance of Rats via melatonin-MT1-PKCγ Pathway.

doi:10.21203/rs.3.rs-39356/v1

Download PDF

Research

Melatonin Reduce Morphine-Induced Hyperalgesia and Tolerance of Rats via melatonin-MT1-PKCγ Pathway.

https://doi.org/10.21203/rs.3.rs-39356/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Morphine is commonly used for treating acute and chronic pain. However, its using is complicated with tolerance and hyperalgesia. Endogenous melatoninergic system is involved in development of tolerance and hyperalgesia induced by chronic morphine administration, but the precise mechanism remains unknown.

Methods: 18 male SD rats were randomly divided into Saline(Sal), Morphine(Mor) and Morphine+Chelerythrine (Mor+Che) group (n = 6, respectively). Each group were received twice-daily intrathecal injections of saline (10μl), morphine (15μg/10μl) or morphine (15μg/5μl)+ chelerythrine (5μg/5μl) for consecutive 9 days, respectively. MWT and TWL of all animals were recorded on day 1, 3, 5, 7, 9. The morphine tolerance was depicted as MPAE on day 1, 3, 5, 7, 9 and on day 10 which can be used to calculate for ED50 of each group. Then we determined the serum level of melatonin by ELISA and expression of MOR , MT1, MT2 and PKCγ by RT-qPCR and WB in spinal dorsal horn of three group rats.

Results: Comparing with Sal group, the Mor group exhibited a significant lower serum melatonin level and up-regulation of expression of the MT1, MT2 and PKCγ in the spinal dorsal horn. Co-administration of chelerythrine with morphine not only attenuates morphine-induced hyperalgesia and tolerance, but also increases the down-regulation of serum melatonin level) and reduces the up-regulation of expression of MT1 and PKCγ in spinal dorsal horn compared with Mor group.

Conclusion：Melatonin can reduce morphine-induced hyperalgesia and tolerance of rats via melatonin-MT1-PKCγ pathway.

Internal Medicine

Morphine-induced hyperalgesia

Morphine tolerance

Melatonin

Melatonin receptor

PKCγ

As one of classical opioid analgesics, morphine is relied as a mainstay for acute and chronic pain management. However, the prolonged use of morphine causes hyperalgesia and tolerance[1, 2]. Morphine-induced hyperalgesia, presents as exaggerated responses to nociceptive stimulation[3]. While morphine-induced tolerance renders the patient to require increase doses of morphine to achieve target level of analgesia[4]. Although there are various overlaps in mechanism between morphine-induced hyperalgesia and tolerance[5], the precise mechanisms involved are not yet fully understood.

Melatonin, one of neuroendocrine hormones produced by pineal gland, has various important physiological effects[6, 7]. Notably, growing body of literature has shown that melatonin exerts analgesic action though MT1 and MT2, especially the latter[8]. These receptors present with high density in the superficial lamina I–V and X where play an important role in pain modulation and transmission. Moreover, there are evidences that endogenous melatoninergic and opioidergic systems have crosstalk and both contribute to development of tolerance and hyperalgesia[9, 10]. Therefore, it is a promising approach to solve morphine-induced hyperalgesia and tolerance by researching their shared pathways.

Previously, we found MT1 decreased and PKCγ increased in the spinal dorsal horn of morphine-induced hyperalgesia and tolerance rats[11]. PKCγ is a main form of PKC family with crucial effects downstream of MOR[12]. It contributes to MOR desensitization which is one of main mechanisms underlying morphine-induced hyperalgesia and tolerance[13-15]. PKC can also be mediated by melatonin via MT1 and MT2[16]. Furthermore, several researches have indicated that melatonin delivery can decreased morphine-induced PKC activity or reduced expression of PKCγ[10, 17]. Thus, PKCγ may be the shared downstream of melatonin receptors and MOR. However, the definite pathway of melatonin mediating morphine-induced hyperalgesia and tolerance remains elusive. We hypothesized that melatonin reduces morphine-induced hyperalgesia and tolerance via melatonin-MT1-PKCγpathway and we tested this hypothesis with PKCγ antagonist chelerythrine in rats with morphine-induced hyperalgesia and tolerance.

This study was conducted according to National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978) and all the procedures were done after the approval of the Institutional Animal Experimental Ethics Committee of Sichuan University (Chengdu, China, Approval NO.2017041A).

2.1 Experimental animals

Adult male Sprague-Dawley rats weighing 230-300 g (n = 18) provided by Chengdu Dossy Biological Technology Co., Ltd (Chengdu, China) were housed in separate cage with food and water freely. The room has 24°C maintained temperature with a 12-hour light/darkness cycle. All experiments were performed during 8 am to 4 pm on each test day and all behavioral assessments were performed in the morning.

2.2 Intrathecal catheter implantation

The procedure of intrathecal (i.t.) catheter insertion was carried out as described in our pervious study[11]. In brief, pentobarbital sodium (60 mg/kg, i.p.) was used to anesthetize rats. Then cervical and lumbar dorsal skin was sterilized with povidone-iodine. An incision about 1.5cm on the middle line of lumbar skin (L4–S1) was made. The bilateral muscle along L5 spinous process was cut. Then the L5 spinous process was removed and the intervertebral membrane between L4 and L5 was exposed. The ligamentum flavum was then punctured by a 22gauge needle following a sterile polyethylene (PE-10) catheter was inserted into the subarachnoid space rostrally about 2cm length. The catheter was fixed to the muscle and anadesma, and the proximal ends of the catheter were tunneled underneath the skin and exist out to the cervical region. After injecting 5μl saline to ensure patency of the catheter, the tip of the catheter was sealed via fusing. The wounds were sutured layer by layer by 5-0 surgical sutures. The animals were allowed to recover for 3 days in individualized cages before use. The correct placement of the catheter was then verified by observing symmetrical lower limbs paralysis induced by intrathecal injection of 10μl 2% lidocaine and completely recovered from the spinal anesthesia on the fourth day after surgery. The animals showing any signs of prolonged motor impairment after the spinal anesthesia were excluded. The correct placement of the catheter in the subarachnoid space at the lumbar enlargement was confirmed by dissection at the end of experiment.

2.3 Drug and vehicle administration

Morphine hydrochloride (Shenyang First Pharmaceutical Factory, Shenyang, China) was dissolved in saline. Chelerythrine was dissolved in Dimethyl Sulfoxide (DMSO). Eighteen rats were divided randomly into three groups, Saline（Sal）, Morphine(Mor) and Morphine+ Chelerythrine (Mor+Che) (n=6, each). The Mor group received twice-daily i.t injections of morphine (15μg/10μl) followed by a flush of 10μl saline delivery into the subarachoid space for consecutive 9 days（twice a day at 9AM and 4PM, respectively) using a microinjection syringe (Gaoge, Shanghai, China). The Mor+Che group received twice-daily i.t injections of morphine (15μg/5μl) and chelerythrine (5μg/5μl) followed the same flush as Mor group. The Sal group received the same amount of 20μl saline, but no morphine, in the same fashion as done for the morphine group.

2.4 Behavioral assessments

Prior to the first behavioral test, rats were adapted to the testing environment for 3 h per day for consecutive 5 days. Habituation covers the process of moving rats from feeding room to the testing room and then they were kept in the testing equipment for 3 h. The behavioral test was implemented by a researcher blinded to the rat groups. Mechanical hindpaw withdrawal threshold and thermal withdrawal latency of all animals were recorded on the 1, 3, 5, 7, 9 day respectively during drugs injection. The baseline nociceptive thresholds (mechanical withdrawal threshold followed by thermal withdrawal latency) on right hindpaw of each group were determined prior to drugs administration on each designated test day. The thermal withdrawal latency was measured again 30min after the first drug or vehicle administration per day between 9:00 am to 10:00 am. After the final behavioral test, rats were euthanatized by anesthetization with pentobarbital sodium (60 mg/kg, i.p.) followed by cervical dislocation and the L3-L5 spinal cord were harvested.

2.4.1 Mechanical allodynia

Mechanical withdrawal threshold (MWT) was measured via a von Frey filament marked with a calibrated range of bending force (0.6, 1, 1.4, 2, 4, 6, 8, 10, 15, and 26 g) as described previously. Each rat was put into a plastic cage having a wire mesh bottom and allowed to acclimate for 30 min before measurement. A single von Frey filament was applied vertically to the region between feet pads in the aspect of right hind paw plantar for five times with an interval of 5 s. At least one distinct withdrawal response out of five applications was treated as a positive record. Filaments were used in an up-and-down rule in accordance with a negative or positive response to determine the hindpaw withdrawal threshold.

2.4.2 Thermal hyperalgesia

Thermal withdrawal latency (TWL) to radiant heat was determined according to a previously described method using a thermal testing apparatus (Ugo Basile, Plantar Test 37370, Italy). Rats were placed individually into plexiglas cubicles placed on a transparent glass surface and allowed to acclimate for 30 min before testing. The light beam from a projection bulb which was located below the glass was directed at the region between feet pads in the plantar aspect of right hindpaw. The period from the beginning of radiant heat stimulation to withdrawal of the hindpaw was regarded as hindpaw withdrawal latency. The baseline latency of about 12 s and a cut-off time of 20 s which was set to prevent thermal injury. Three trials with an interval of 5 min were made and scores from three trials were averaged to yield mean withdrawal latency. The measurements were implemented both before and 30 min after morphine administration.

2.4.3 Morphine tolerance

The morphine tolerance was depicted as the percentage of maximal possible antinociceptive effect (%MPAE) in the morning from day 1 to 9 and on day 10. The %MPAE was calculated as %MPAE= [(Test PWL-Basic PWL)/ (cutoff time-Basic PWL)] × 100. Cumulative dose-response curves were determined on day 10 after long-term morphine and saline administration according to previously described method[11]. Rats were firstly administrated with a low dose morphine (10μg) followed by antinociceptive effect assessment 30 minutes later through TWL test and then received a next dose (cumulative dosing increase by 2-fold) and were tested again 30 minutes afterward until the rats couldn’t feel the stimulation so that failed to move the hindpaw within the cutoff time.

2.5 ELISA

On day 10, all rats were deeply anesthetized with pentobarbital (60 mg/kg, i.p.). The blood was taken from ventriculus dexter in the afternoon to minimize fluctuation of the serum melatonin level. The blood was centrifuged at 1500rpm for 15min and the serum was obtained and placed in EP tubes wrapped with aluminum foil for protection from light and stored at −80 °C until use. The level of serum melatonin was assayed though a rat-specific ELISA kits (XL-Er1047, YonghuiBiological Technology Co., Ltd, Beijing) according to the manufacturer’s instructions.

2.6 Real-Time (RT)-PCR

A part of tissues harvested from each rat for preparation of western blot were used for RT-PCR. Firstly, the tissues were isolated for the total RNA extraction. Single-strand complementary DNA was designed using Primer Premier 6.0 and synthesized by Sangong Biotech (Shanghai,China). All complementary DNA samples were stored at -80°C before using. RT-PCR was performed using a PikoReal Real-Time PCR System (PIKORed 96, ThermoFisher, US). Relative messenger RNA (mRNA) levels were calculated according to the 2- △△CT method. Oligonucleotide primers were used as Table1.

Table 1． Sequences of primers for RT-PCR
Target gene	Forward primers	Reverse primers
β-actin	gaagatcaagatcattgctcct	tactcctgcttgctgatcca
MT1	tgtcgcttacaccgttgctccagat	ggcagcagcactgttcgtcacttca
MT2	tgatctccaactgccgcctccattc	agctgcacttgtccaaagcctctt
MOR	tctcttctgccatcggtctgcctgt	tacagccacgaccaccagcaccat
PKCγ	ggttcaccgccgatgccacgaatt	ctctgtatggtccacgccgcaaagg

2.7 Western blot

Pentobarbital (60 mg/kg, i.p.) was used to anesthetize rats in each group (n = 3/6) and decapitation was performed for rapid tissue harvesting. The L3-L5 segment of the spinal cord was first divided into the right and left side and then further separated into the dorsal and ventral horn, respectively. Tissue samples were homogenized in RIPA buffer (50mM Tris (pH 7.4),150mM NaCl,1% NP-40,0.1% sodium deoxycholate) and were allowed to homogenize for 10min on fragmentized ice. The samples were centrifuged at 4°C for 15 min at 12000rpm. The protein concentration of the supernatants was assayed via a BCA protein assay kit (KGP903, KenGEN BioTECH, Jiangsu, China). Supernatants (50μg) were warmed for 5 min at 100°C in loading buffer (50 mM Tris–HCl, 2 %SDS, 2 % β-mercaptoethanol, 8 % glycerol, and 0.1 % bromophenol blue) and resolved by SDS-PAGE on 10 % polyacrylamide gels. After gel electrophoresis, proteins were electrophoretically transferred to PVDF membranes (HYBOND, Inc.USA). The membranes were blocked via 5%BSA in Tris-buffered saline (TBST) with 0.1 % Tween 20 for 2 h and incubated overnight at 4 °C with a primary antibody to MOR(1:200, ab10275, Abcam, Cambridge, UK), MT1 (1:500, NBP1-71113, Novus Biologicals, US), MT2 (1:200, ab203346, Abcam, Cambridge, UK), PKCγ( 1:200,ab71558, Abcam, Cambridge, UK),β-actin (1:5,000)；Membranes were then incubated in HRP conjugated secondary antibody (1:5,000; ab6721 and ab6789, Abcam, Cambridge, UK) for 2-3 h at room temperature, visualized with TBST for 3 times (10min per time), and exposed onto X-films for 1–5 min. The X-films were scanned and the density of target bands was analyzed by Image Lab (BIO-RAD, US)

2.8 Statistical data analysis

Data are presented as mean ± SEM. The SPSS 16.0 (Chicago, IL) was used to conduct statistical analysis and the figures were presented by GraphPad Prism 6.0 software (La Jolla, CA, USA). Alteration of MWT, TWL and MPAE% of day1 to day 9 between groups were assessed with two-way analysis of variance (ANOVA) （group × day）followed by the Bonferroni post hoc test for multiple comparisons. The data of ELISA, western blot, RT-PCR of each group were compared by one-way analysis of variance (ANOVA) followed by the Bonferroni post hoc test for multiple comparisons. To examine the degree of morphine tolerance, the ED50 value of morphine in each group was determined via the formula calculated form linear curve estimation when y=0.5. The up-down reversals were used to get ED50 dose and 95% confidence intervals (95% CI) of morphine anti-nociception effect and the probit analysis was applied for the three groups. P-values <0.05 was considered statistically significant.

3.1 Effect of co-administration of chelerythrine with morphine on development of hyperalgesia.

The mechanical withdraw threshold (MWT) of Sal group remained unchanged over a period of 9 days. Administration of morphine alone or morphine plus chelerythrine lead MWT go down significantly starting from day 3 to the last test day. The MWT reduction tendency of Mor group moderated through test day 7 and day 9 whereas the MWT reduction tendency of Mor+Che group moderated through test day 5 to day 9. Comparing with that on day 1, MWT of Mor group was reduced by 96.10% on the day 9.On the other hand, MWT of Mor+Che group was only reduced by 60.16% on the day 9 comparing with that on day 1(Figure 1A).Meanwhile, thermal withdraw latency (TWL) showed almost no change during 9 days of course in the Sal group. TWL in Mor group showed significant reduction on day 3 and continued to decrease and it seemed reaching its steady state on day 9. On day 9, it was reduced by 65.41%. On the other hand, TWL in Mor+Che group also showed significant reduction on day 3 but it seemed reaching its steady state on day 5. On day 9, it was only reduced by 40.48%. (Figure 1B).

3.2 Effect of co-administration of chelerythrine with morphine on development of morphine tolerance

Our data show long-term intrathecal morphine delivery drives dose escalation of morphine to get maximal possible antinociceptive effect (MPAE), but co-administration of chelerythrine with morphine mitigates that effect (Figure 2A). MPAE of Mor group from day 3, 5, 7, 9 decreased 43.79% (p < 0.001), 79.01% (p < 0.001), 91.82% (p < 0.001), 97.04% (p < 0.001), whereas MPAE of Mor+Che group from day 3, 5, 7, 9 decreased 13.22% (p >0.05), 20.53% (p < 0.001), 32.43% (p < 0.001), 44.70% (p < 0.001), compared with the value on day 1 respectively. Chronic intrathecal morphine or co-administration of chelerythrine with morphine both produced a rightward shift in the cumulative dose response curve of morphine on day 10, but the rightward shift level of Mor+Che group is less than that of Mor group (Figure 2B). The morphine ED50 values of rats in three groups on day 10 were presented in Table 2. The ED50 for morphine, the morphine dose needs to produce 50% of the maximal anti-nociceptive effect of morphine, was 6.44μg, 26.04μg,15.30μg for Sal, Mor and Mor+Che group respectively. ED50 of Mor group was 4.03 times of that of Sal group and 1.70 times of that of Mor+Che group on day 10 (p<0.001). (Table 2)

Table 2. ED50 and 95% CI of morphine in Sal, Mor and Mor+Che group
	ED₅₀ (μg)	95% CI (μg)
Sal group	6.44	4.82 to 7.16
Mor group	26.04	23.29 to 28.30***
Mor+Che group	15.30	13.53 to 17.06***^###
The measurement was conducted on day 10 after completion of morphine delivery procedures for 9 consecutive days. ED50: the morphine dose that produced 50% of the maximal possible anti-nociception effect 95% CI: 95% confidence intervals. ***p<0.001, as compared with the Sal group on day 10, ### p<0.001, as compared with the Mor group on day10.

3.3 Effect of co-administration of chelerythrine with morphine on the serum melatonin level of rats with morphine-induced hyperaglesia and tolerance.

The level of serum melatonin was determined on day 10. The serum melatonin level in Mor was lower than that of Sal group(p=0.0036). Whereas the serum melatonin level in Mor+Che group was lower than Sal group(p=0.0425) but higher than Mor group(p=0.0425) (152.63±6.94 for the Sal group vs.92±4.86 for Mor group vs.120.03±9.78 for Mor+Che group). (Figure 3).

3.4 Effects of chronic intrathecal co-administration of chelerythrine with morphine on expression of MOR, MT1, MT2 and PKCγ in the spinal cord dorsal horn of rats with morphine-induced hyperaglesia and tolerance.

After intrathecal delivery of saline, morphine or morphine+ chelerythrine for 9 consecutive days, we measured mRNA of MOR, MT1, MT2 and PKCγ in rat’s spinal dorsal horn on day 10. The mRNA of MT1, MT2, PKCγ in Mor group were all higher than those of Sal group (p=0.0014, p=0.027, p=0.0008, respectively). There was no significant difference in mRNA levels of MOR between the Sal group, Mor group and Mor+Che group (p>0.05). (Figure 4). The mRNA of MT1, PKCγ in Mor+Che group were lower than those of Mor group (p=0.006, p=0.0005, respectively), but no significant difference in mRNA level of MT2 was shown between the Mor group and Mor+Che group (p>0.05). Beside that mRNA level of MT2 in Mor+Che group was higher than that of Sal group(p=0.0301), there was no significant difference in mRNA levels of MOR, MT1 and PKCγ between the two groups (p>0.05) (Figure 4).

Protein level of MOR, MT1, MT2 and PKCγ were determined using Western blot analysis. In Mor group, the protein level of MT1, MT2, PKCγwere higher than those in Sal group (p=0.0001, p=0.0108, p=0.0001, respectively). While the protein of MOR in Mor group showed no significant difference with that in Sal group (p>0.05). There was no significantly difference in protein level of MOR and MT2 between the Mor group and Mor+Che group (p>0.05). While the protein of MT1 and PKCγprotein in Mor+Che group reduced significantly compared with those in Mor group (p=0.0005, p<0.0001, respectively). The MT2 protein of Mor+Che group increased significantly（p=0.0078) while the PKCγ reduced significantly compared with Sal group（p=0.0002) .The MOR and MT1 protein of Mor+Che group showed no significantly difference with those in Sal group (p>0.05). (Figure 5).

In the present study, we found that intrathecal morphine for 9 consecutive days leads to morphine-induced hyperalgesia and tolerance in adult rats, and reduces the serum melatonin level, increased melatonin receptor MT1, MT2 and PKCγ in spinal dorsal horn of rats. Co-administration of chelerythrine with morphine not only reduces morphine-induced hyperalgesia and tolerance, but also increases the reduced serum melatonin level and down-regulates the higher level of MT1 and PKCγ. But no significant change of MT2 in spinal dorsal horn of rats was observed by co-administration with chelerythrine.

4.1 PKCγplays a crucial role in development of morphine-induced hyperalgesia and tolerance

As our previous study[11], intrathecal administrating morphine to rats for 5 consecutive days can result in behavior of hyperalgesia and tolerance. But in that study, the degree of morphine hyperalgesia and tolerance is not severe enough and the state has not stabilized. Because the rate and extent of development of morphine tolerance or hyperalgesia is related to the amount of morphine used and the duration of administration[18].It is helpful to observe changes of the indicators to be detected when the model is in a steady state. Therefore, we not only prolonged the duration of medication for 9 days, but also increased the dosage to 30 ug per day in our current study compared to 5 days and 20 ug per day of previous study. Our results show that, compared with Sal group, the force causing equal level of pain and TWL reduced in Mor group. The tendency of MWT and TWL of Mor group moderated through test day 7 and day 9 seeming to have reached severe enough hyperalgesia and a stable state. Co-administration of chelerythrine with morphine minimized morphine-induced hyperalgesia and tolerance. These results suggest PKCγ inhibitor chelerythrine can alleviate morphine-induced hyperalgesia and tolerance effectively.

Several studies have report the activation of PKCγ in the spinal dorsal horn plays an important role in the development of morphine-induced hyperalgesia and tolerance[14, 15], and this effect may act through mediating MOR phosphorylation[12]. There is no analgesic effect of chelerythrine itself[10]. Our results show that PKC inhibitor chelerythrine can significantly reduce morphine-induced hyperalgesia and tolerance, which is consistent with previous studies [14, 15, 19].

4.2 Melatoninergic system participates in morphine-induced hyperalgesia and tolerance at multiple levels.

Our result showed decreased serum melatonin level in rats with morphine-induced hyperalgesia and tolerance, which is consist with our previous study[11]. Shavali et al[20] found that melatonin exerted analgesic effect not through opioid receptors but via causing the release of beta-endorphin. Furthermore, analgesic effect of morphine decreases after excision of the pineal gland where is the main place secreting melatonin[21]. Studies have shown that melatonin can regulate pain through the endogenous pain-modulating system (PMS)[22]. Administration of exogenous melatonin can alleviate allodynia and hyperalgesia in neuropathic pain models[23], and this analgesic effect is dose-dependent[24, 25]. This indicates the decrease of melatonin level is associated with decreased MWT and TWL in rats. Thus, to a certain extent, reduction in serum melatonin level is involved in morphine-induced hyperalgesia and tolerance. But we didn’t point out the precise location it works. It can happen either at peripheral or central or both.

Melatonin receptors also involve in morphine-induced hyperalgesia and tolerance. Our study demonstrated increased MT1 and MT2 level in rats’ spinal dorsal horn with morphine-induced hyperalgesia and tolerance which is different with our pervious study that administration of morphine lead MT1 down-regulation but no change in MT2[11]. The development of tolerance and hyperalgesia can be affected by both duration and dose of morphine, because the varying of both pharmacokinetic and pharmacodynamic factors [18]. We therefore speculate the difference may due to the prolonged duration of morphine administration or the increased dose of morphine administered. It is suggested that the melatonin receptors’ level in the rats’ spinal dorsal horn of may have a dynamic fluctuation process at different stages in development morphine hyperalgesia and tolerance. Meanwhile, we speculate that this volatility change in MT1 is characterized by a decrease first and then an increase. Niles [26] and Bahna[27] et al. found that MT1 and MT2 were up-regulated in rats’ hippocampus after valproic acid induced neuropathic pain stimulation, suggesting that melatonin receptors are dynamically regulated by remodeling of pain-related nervous systems[23], which support our speculation. Furthermore, it suggests the MT1 and MT2 up-regulation is a feedback adjustment consequence to pain-related nervous system change due to morphine hyperalgesia and tolerance. Since the rat spinal dorsal MT2 level was not measured in the first five days of the study, it is not clear whether the MT2 level also reduced first and then increased as MT1 or directly increased.

4.3 Endogenous melatoninergic system involves in development of chronic morphine-induced hyperalgesia and tolerance through serum melatonin-MT1-PKCγ pathway

PKCγ,especially which in the spinal dorsal horn, plays an important role in development of morphine-induced hyperalgesia and tolerance[28, 29]. In the present study hyperalgesia and tolerance was observed with increased PKCγ in rats’ spinal dorsal horn, and was ameliorated by PKC antagonist treatment. This consist with previous studies demonstrated morphine hyperalgesia and analgesic tolerance can be attenuated by co-administration of morphine with inhibitors of PKC effectively[29, 30]. In addition, Wei et al[17] and Li et al[10]found that administration of exogenous melatonin can alleviate morphine-induced hyperalgesia or tolerance by inhibiting PKCγ activation or reducing the up-regulation of PKCγ expression. Our study showed blocking PKCγ increased the down-regulated serum melatonin level and reduced morphine-induced hyperalgesia and tolerance, suggesting PKCγ also involves in the mechanism underlying the effect of melatonin mitigates morphine-induced hyperalgesia and tolerance. Melatonin exerts its’ antinociceptive effects mainly through MT1 and MT2[25], and pervious report has demonstrated melatonin can activate PKC via its’ receptor MT1/ MT2[16]. However, we found blocking PKCγ only decreased MT1 but not MT2, indicating that melatonin attenuated morphine-induced hyperalgesia and tolerance probably via serum melatonin-MT1-PKCγ pathway.

Our study demonstrated that melatonin is involved in hyperalgesia and tolerance induced with long-term administering morphine and PKCγ antagonist chelerythrine minimize the severity of hyperalgesia and tolerance. It seems that melatonin can reduce morphine-induced hyperalgesia and tolerance of rats via melatonin-MT1-PKCγ pathway.

PKC: protein kinase C; MOR:μ-opioid receptor; MT: melatonin receptor; Sal: Saline;Mor:Morphine; Che: chelerythrine; mechanical withdraw threshold (MWT); thermal withdraw latency (TWL); maximal possible antinociceptive effect (MPAE)

Colvin LA, Bull F, Hales TG: Perioperative opioid analgesia-when is enough too much? A review of opioid-induced tolerance and hyperalgesia. Lancet 2019, 393:1558-1568.
Song L, Wang S, Zuo Y, Chen L, Martyn JA, Mao J: Midazolam exacerbates morphine tolerance and morphine-induced hyperactive behaviors in young rats with burn injury. Brain Res 2014, 1564:52-61.
Roeckel LA, Le Coz GM, Gavériaux-Ruff C, Simonin F: Opioid-induced hyperalgesia: Cellular and molecular mechanisms. Neuroscience 2016, 338:160-182.
Martyn J, Mao J, Bittner EA: Opioid Tolerance in Critical Illness. N Engl J Med 2019, 380:365-378.
Mercadante S, Arcuri E, Santoni A: Opioid-Induced Tolerance and Hyperalgesia. CNS Drugs 2019 .
Ismail SA, Mowafi HA: Melatonin provides anxiolysis, enhances analgesia, decreases intraocular pressure, and promotes better operating conditions during cataract surgery under topical anesthesia. Anesth Analg 2009, 108:1146-1151.
Srinivasan V, Pandi-Perumal SR, Spence DW, Moscovitch A, Trakht I, Brown GM, Cardinali DP: Potential use of melatonergic drugs in analgesia: mechanisms of action. Brain Res Bull 2010, 81:362-371.
Ambriz-Tututi M, Rocha-González HI, Cruz SL, Granados-Soto V: Melatonin: a hormone that modulates pain. Life Sci 2009, 84:489-498.
Lin SH, Huang YN, Kao JH, Tien LT, Tsai RY, Wong CS: Melatonin reverses morphine tolerance by inhibiting microglia activation and HSP27 expression. Life Sci 2016, 152:38-43.
Li S, Wu C, Zuo Y: Melatonin prevents morphine-induced hyperalgesia and tolerance in rats: role of protein kinase C and N-methyl-D-aspartate receptors. BMC Anesthesiol 2015, 15:12.
Fan Y, Liang X, Wang R, Song L: Role of endogenous melatoninergic system in development of hyperalgesia and tolerance induced by chronic morphine administration in rats. Brain Res Bull 2017, 135:105-112.
Bailey CP, Llorente J, Gabra BH, Smith FL, Dewey WL, Kelly E, Henderson G: Role of protein kinase C and mu-opioid receptor (MOPr) desensitization in tolerance to morphine in rat locus coeruleus neurons. Eur J Neurosci 2009, 29:307-318.
Bailey CP, Smith FL, Kelly E, Dewey WL, Henderson G: How important is protein kinase C in mu-opioid receptor desensitization and morphine tolerance. Trends Pharmacol Sci 2006, 27:558-565.
Granados-Soto V, Kalcheva I, Hua X, Newton A, Yaksh TL: Spinal PKC activity and expression: role in tolerance produced by continuous spinal morphine infusion. Pain 2000, 85:395-404.
Wu GJ, Wen ZH, Chang YC, Yang SN, Tao PL, Wong CS: Protein kinase C inhibitor chelerythrine attenuates the morphine-induced excitatory amino acid release and reduction of the antinociceptive effect of morphine in rats injected intrathecally with pertussis toxin. Life Sci 2006, 78:1801-1807.
Xu Z, Wu Y, Zhang Y, Zhang H, Shi L: Melatonin activates BKCa channels in cerebral artery myocytes via both direct and MT receptor/PKC-mediated pathway. Eur J Pharmacol 2019, 842:177-188.
Xin W, Chun W, Ling L, Wei W: Role of melatonin in the prevention of morphine-induced hyperalgesia and spinal glial activation in rats: protein kinase C pathway involved. Int J Neurosci 2012, 122:154-163.
Dumas EO, Pollack GM: Opioid Tolerance Development: A Pharmacokinetic/Pharmacodynamic Perspective. AAPS J 2008, 10:537-551.
Jin WY, Yu LC: Involvement of protein kinase C in morphine tolerance at spinal levels of rats. ACS Chem Neurosci 2010, 1:122-128.
Shavali S, Ho B, Govitrapong P, Sawlom S, Ajjimaporn A, Klongpanichapak S, Ebadi M: Melatonin exerts its analgesic actions not by binding to opioid receptor subtypes but by increasing the release of beta-endorphin an endogenous opioid. Brain Res Bull 2005, 64:471-479.
Lakin ML, Miller CH, Stott ML, Winters WD: Involvement of the pineal gland and melatonin in murine analgesia. Life Sci 1981, 29:2543-2551.
de Zanette SA, Vercelino R, Laste G, Rozisky JR, Schwertner A, Machado CB, Xavier F, de Souza IC, Deitos A, Torres IL, Caumo W: Melatonin analgesia is associated with improvement of the descending endogenous pain-modulating system in fibromyalgia: a phase II, randomized, double-dummy, controlled trial. BMC Pharmacol Toxicol 2014, 15:40.
Lin JJ, Lin Y, Zhao TZ, Zhang CK, Zhang T, Chen XL, Ding JQ, Chang T, Zhang Z, Sun C, Zhao DD, Zhu JL, Li ZY, Li JL: Melatonin Suppresses Neuropathic Pain via MT2-Dependent and -Independent Pathways in Dorsal Root Ganglia Neurons of Mice. Theranostics 2017, 7:2015-2032.
Chen WW, Zhang X, Huang WJ: Pain control by melatonin: Physiological and pharmacological effects. Exp Ther Med 2016, 12:1963-1968.
Wilhelmsen M, Amirian I, Reiter RJ, Rosenberg J, Gögenur I: Analgesic effects of melatonin: a review of current evidence from experimental and clinical studies. J Pineal Res 2011, 51:270-277.
Niles LP, Sathiyapalan A, Bahna S, Kang NH, Pan Y: Valproic acid up-regulates melatonin MT1 and MT2 receptors and neurotrophic factors CDNF and MANF in the rat brain. Int J Neuropsychopharmacol 2012, 15:1343-1350.
Bahna SG, Sathiyapalan A, Foster JA, Niles LP: Regional upregulation of hippocampal melatonin MT2 receptors by valproic acid: therapeutic implications for Alzheimer's disease. Neurosci Lett 2014, 576:84-87.
Lim G, Wang SQ, Sung B, Yang L, Mao J: Expression of spinal NMDA receptor and PKCgamma after chronic morphine is regulated by spinal glucocorticoid receptor. Journal of Neuroscience 2005, 25:11145-11154.
Mayer DJ, Mao J, Price DD: The development of morphine tolerance and dependence is associated with translocation of protein kinase C. Pain 1995, 61:365-374.
Mao J, Price DD, Mayer DJ: Experimental mononeuropathy reduces the antinociceptive effects of morphine: implications for common intracellular mechanisms involved in morphine tolerance and neuropathic pain. Pain 1995, 61:353-364.

Download PDF

Version 1

posted

You are reading this latest preprint version

Melatonin Reduce Morphine-Induced Hyperalgesia and Tolerance of Rats via melatonin-MT1-PKCγ Pathway.

Status:

Version 1

Abstract

Figures

1. Background

2. Methods

2.1 Experimental animals

2.2 Intrathecal catheter implantation

2.3 Drug and vehicle administration

2.4 Behavioral assessments

2.4.1 Mechanical allodynia

2.4.2 Thermal hyperalgesia

2.4.3 Morphine tolerance

2.5 ELISA

2.6 Real-Time (RT)-PCR

2.7 Western blot

2.8 Statistical data analysis

3. Results

4. Discussion

5. Conclusion

List Of Abbreviations

References

Supplementary Files

Status:

Version 1