2.1 Chemicals and reagents
Trillin, procured from Pufei De Biotech Co., Ltd. (Chengdu, China), was made into a 20 mM stock solution in DMSO, stored at -20°C, ensuring a final DMSO concentration under 0.1%. RPMI 1640 medium and DMEM were sourced from EallBio Biomedical Technology (Beijing, China), with Penicillin-Streptomycin from TransGen Biotech (Beijing, China). Fetal bovine serum was obtained from VivaCell Biosciences (Shanghai, China), and Lipofectamine 3000 from Invitrogen (Carlsbad, CA, USA). The miRNA reagents were synthesized by GENERAL Bio (Anhui, China), and various kits for protein quantification, extraction, qPCR, apoptosis detection, and others were acquired from Thermo Fisher (Waltham, MA, USA), Beyotime Co., Ltd. (Shanghai, China), Accurate Biology Co., Ltd. (Changsha, China), Advansta (Menlo Park, CA, USA), SEVEN Biotec, TIANGEN Biotech, KeyGEN BioTECH (Nanjing, China), Sigma (St. Louis, MO, USA), Jinshan Jinqiao (Beijing, China), and Promega (Madison, WI, USA).
2.2 Antibodies and other materials
Antibodies including COX-2, cleaved caspase-3, cleaved caspase-9, IKKα, IKKβ, p-IKKα/β, IκBα, p-IκBα, p50, p65, MAP3K11, β-actin, and secondary antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). Cytochrome c, p65, and p50 antibodies came from Santa Cruz Biotechnology (Shanghai, China), while Bax, Bcl-2, and Lamin B1 antibodies were sourced from Proteintech Group (Rosemont, IL, USA). Unless otherwise noted, other chemicals were purchased from Sigma Chemical Co. (St. Louis, MO, USA).
2.3 Cell culture
Human prostate cancer cell lines DU145 and PC3 were obtained from Procell Biological Company (Wuhan, China) and the Cell Centre of the Chinese Academy of Sciences (Beijing, China), respectively. DU145 cells were cultured in DMEM medium, while PC3 cells were maintained in RPMI-1640 medium, both supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS). These cells were incubated at 37°C in a humidified environment with 5% CO2.
2.4 Cell viability assay
In the study, DU145 and PC3 cells were seeded at defined densities in wells to attain 70% confluence. These cells were then treated with a range of Trillin concentrations (0, 1, 5, 10, 25, and 50 µM). After 12, 24, 48, or 72 hours of incubation, 10 µl of CCK-8 was added to each well, followed by a 2-hour incubation. The absorbance was then measured at 450 nm using a microplate reader (Tecan, Switzerland). This procedure was repeated multiple times to determine the IC50 values at 48 hours from the dose-response data.
2.5 Colony formation assay
DU145 and PC3 cells were initially seeded at 4,000 cells per well in six-well plates. Post-adherence, they were treated with Trillin at 0, 5, 10, and 20 µM for 48 hours. Afterwards, the medium was replaced with fresh one, and the cells were cultured until visible colonies formed. These colonies were then fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, air-dried, and imaged, allowing for a detailed analysis of Trillin's effects.
2.6 Wound healing assay
DU145 and PC3 cells were grown in 6-well plates to form a confluent monolayer, followed by serum starvation for 6 hours. A uniform wound was then created in the cell layer using a sterile pipette tip. The cells were treated with Trillin at concentrations of 0, 5, 10, and 20 µM in serum-free medium for 48 hours. Images were taken at 0 and 48 hours post-wounding with a Leica DMi1 microscope. Cell migration was assessed by analyzing five fields per wound, providing data on Trillin's effect on cell healing.
2.7 Transwell Invasion Assay
The matrix gel mixed with DMEM/1640 medium (1:10 ratio) is applied to an insert membrane and incubated at 37°C to solidify. DU145 and PC3 cells are prepared in serum-free medium with Trillin (0, 5, 10, 20µmol/L), added to the upper chamber at a density of 5×105 cells/mL. The lower chamber receives DMEM/1640 medium with fetal bovine serum and Trillin. After 24 hours, the upper chamber is cleared with a cotton swab, and the insert is fixed and stained with crystal violet. Post-washing, cells are imaged and counted under an inverted microscope.
2.8 Flow Cytometry
In this flow cytometry protocol, DU145 and PC3 cells are cultured in 6 cm dishes and treated with Trillin at concentrations of 0, 5, 10, 20µmol/L for 48 hours. After treatment, cells are washed with PBS, trypsinized without EDTA, and centrifuged to collect. After two PBS washes, cells are resuspended in binding buffer and stained with Annexin V-FITC and Propidium Iodide, then incubated in darkness at room temperature for 15 minutes to assess apoptosis using a cytoflex flow cytometer. For cell cycle analysis, cells treated with Trillin are fixed in ice-cold 70% ethanol for 12 hours at 4°C, then washed with ice-cold PBS, stained with propidium iodide solution, and incubated at 37°C in darkness for 30 minutes. The cell cycle is then analyzed using the cytoflex flow cytometer at a 488 nm wavelength.
2.9 Confocal immunofluorescence analysis
DU145 cells, seeded on coverslips, were treated with Trillin at 0, 10, and 20 µM for 48 hours. Post-treatment, the cells were fixed using 4% paraformaldehyde and permeabilized with 0.2% TritonX-100. Blocking was performed with 5% BSA, followed by overnight incubation at 4°C with primary antibodies targeting cytochrome c, p50, or p65. This was succeeded by application of secondary antibodies conjugated with either fluorescein isothiocyanate or rhodamine isothiocyanate. DAPI was used for nuclear staining. Fluorescent imaging was conducted using a Leica DM4 B confocal microscope to visualize the antibody interactions.
2.10 Western blot analysis
Proteins extracted from cell lysates or isolated through streptavidin-agarose pulldown assays were first separated on SDS-PAGE minigels and then transferred to PVDF membranes. These membranes were blocked using a 5% non-fat powdered milk buffer, followed by incubation with specific primary and secondary antibodies. Protein bands were detected through enhanced chemiluminescence (ECL) and their intensities were quantified using ImageJ software from the National Institutes of Health. Protein concentrations were ascertained using the BCA method.
2.11 qRT-PCR
Total RNA from DU145 and PC3 cells was extracted using Trizol (Accurate Biology, Hunan, China) and reverse transcribed with the Prime Script TM RT-PCR Kit (GENERAL Bio Inc, Anhui, China). Specific primers were used for amplifying cDNA: COX-2 (TACCCTCCTCAAGTCCCTGA, ACTGCTCATCACCCCATTCA), miR-145-5p mimics (GUCCAGUUUUCCCAGGAAUCCCU, AGGGAUUCCUGGGAAAACUGGAC), its inhibitor (AGGGAUUCCUGGGAAAACUGGAC), and MAP3K11 (GCCUUAGGAUAUUGCUGUUTT, AACAGCAAUAUCCUAAGGCTT) from GenePharma, Suzhou, China. PCR products were analyzed on 1.5% agarose gels, visualized under UV light, and quantified. qRT-PCR analysis was performed employing a SYBR Green kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA), and the quantification of gene expression was determined using the 2-△△Ct method. RNU6 (U6) was utilized as the internal standard in the experiments.
2.12 Cell Transfection
In the cell transfection assays, DU145 and PC3 cells were seeded in 6-well plates at 5×105 cells/ml and transfected at ~ 80% confluence using Lipofectamine 3000. The cells were separately transfected with has-miR-145-5p NC, mimics, and inhibitors. For siRNA transfection, 4 µg of MAP3K11 was used per well for 48 hours. Post-transfection, gene and protein expression levels were assessed through qRT-PCR or Western Blot.
2.13 Streptavidin-agarose pulldown assay
In this protocol, nuclear extract proteins (400 µg) were interacted with a 400 µl mixture, comprising 4 µg of biotinylated DNA probe and 40 µl of streptavidin-conjugated agarose beads, in PBSi buffer (PBS with 1 mM EDTA, 1 mM DTT, and a protease inhibitor cocktail). This incubation occurred at room temperature over 5 hours on a rotating shaker. Subsequent to the incubation, the beads were subjected to centrifugation for pellet formation, followed by dissociation in 50 µl of 2× Laemmli sample buffer. The dissociation process involved boiling at 100°C for 10 minutes. The resulting supernatant was then subjected to Western blot analysis for protein identification.
2.14 Dual-Luciferase Assay
In 293T cells, either the pGL3-NFκB plasmid or pGL3-Basic (negative control) is co-transfected in 6-well plates. Post-transfection, the cells are incubated at 37°C with 5% CO2 for 24 hours for optimal luciferase gene expression. Subsequently, they are treated with Trillin at 0, 5, 10, and 20µmol/L concentrations for 48 hours. The alterations in luciferase activity that ensue are quantified utilizing the Dual-Luciferase Reporter Assay System, and the firefly luciferase activity is normalized in reference to renilla luciferase activity.
2.15 TCGA-PRAD, public database reanalysis
For the analysis of miRNA-target gene interactions, five publicly available miRNA-mRNA databases were employed to predict potential target genes for miR-145-5p and ascertain common genes. These databases include PITA (https://genie.weizmann.ac.il/pubs/mir07/mir07_data.html), miRTarBase (http://mirtarbase.mbc.nctu.edu.tw/php/index.php), microT (https://dianalab.e-ce.uth.gr/html/dianauniverse/index.php?r=microT_CDS), TargetScan (https://www.targetscan.org/vert_80/) and PicTar (https://pictar.mdc-berlin.de). Additionally, the expression analysis of miR-145-5p target molecules in prostate cancer and normal tissues was conducted using TCGA data. This approach provided a comprehensive exploration of miR-145-5p target genes while referencing these online resources for data integration.
2.16 Animals experiments
This animal study, compliant with Dalian Medical University's Animal Care and Ethics Committee guidelines, utilized male NYG immunodeficient mice (4–6 weeks old) from the university's SPF Laboratory Animal Center. The mice were housed under controlled conditions. DU145 cells (1×107) in 100 µl PBS were subcutaneously injected into each mouse's right axillary fossa. Two weeks later, the mice were divided into three groups (n = 5 each) and treated daily for 14 days with either PBS (control), 10 mg/kg Trillin, or 20 mg/kg Trillin through intraperitoneal injections. Body weight and tumor volume were monitored bi-daily. After 30 days, the mice were euthanized; tumors were harvested, weighed, and preserved in 10% formalin for paraffin embedding. Tumor tissues underwent immunohistochemical staining for COX-2 and MAP3K11 expression analysis, observed with a Leica DM4 B fluorescence microscope. This study comprehensively assessed Trillin's therapeutic impact on tumor growth and gene expression.
2.17 Statistical analysis
Results from a minimum of three independent experiments are depicted as the mean ± standard deviation (SD). Prism 9 software was used for analysis. Statistical significance between the control and treatment groups was assessed utilizing either one-way ANOVA or Student's t-tests, depending on the experimental design. Significance was established with a p-value less than 0.05. Asterisks were used to denote significance: one asterisk (*) for P < 0.05, two asterisks (**) for P < 0.01, and three asterisks (***) for P < 0.001.