3.1 Creation and characterization of transgenic lettuce expressing recombinant Osmotin.
The expression vector, promotor, purification tags, regulatory elements, protein targeting, choice of plant, and transformation conditions always require prior planning and optimization. We have created lettuce transgenic lines (three independent lines) able to express the rOSM in leaf tissues (Fig. 1C), and integrated osmotin without codon optimization (one independent line) for expressional analysis (Fig. 2C). After vector construction, the agrobacterium pBI121 carrying OSM-His-KDEL were able to successfully integrate the transgene and created three independent transgenic events for codon and one for non-codon optimized osmotin expression. The PCR was carried out to confirm the integrity of transgene in each independent line by using forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’. All four transgenic events were confirmed with an expected amplicon of 360 bp (Fig. 1B). The plants expected to express the recombinant proteins were transferred to Magenta boxes containing an equal amount of selection (100 mg/L of kanamycin) and then transferred to the greenhouse after roots were developed. The plants were grown in the greenhouse and were fertile to produce > 2000 seeds per plant.
The extraction of TSP from plant tissues is the first step of downstream processing. The overall goal of this process is to extract recombinant proteins in an aqueous buffer environment to protect their functionality. To achieve the most suitable extraction buffer and conditions, we analyzed the impact of pH, Tween-20, protease inhibition cocktail (PIC), and ultrasonication on rOSM recovery from lettuce leaf crude extracts. The plant tissues collected from each transgenic line were subjected to total protein extraction and were confirmed with Western blot analysis and the protein size of ~ 30 kDa was detected in all lettuce lines (Fig. 1C). T1 seeds were also grown half-strength MS media supplemented with 100 mg/L kanamycin showed 100% germination in comparison to wild-type seeds which were able to regenerate 10–15% in the first 5 days, however, those also dried 10 days after sowing. All independent transgenic events confirmed its selection by expression of nptII genes confers kanamycin resistance. The plants were phenotypically similar in plant growth and development to wild-type plants and also potent to generate > 500 T1 seeds from each independent line.
3.2 Expression increased over time and generations.
The confirmation of homozygosity is important to utilize transgenic lines for different investigations. Therefore, to confirm the integration of transgene into subsequent generations, we investigated the expression of rOSM in three generations. All the generations were able to regenerate on half strength MS media with kanamycin (100 mg/L) confirming the integration of the selection maker in all three generations. Further, DNA extracted from all generations was also confirmed with PCR using primers (forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’; and the expected 360 bp band was amplified (Fig. 1B). Also, more importantly, we confirmed the expression of rOSM in all generations. The total protein extracted from leaf tissues was analyzed with western blot for confirmation of recombinant osmotin expression. The protein band of ~ 30 kDa band was observed in all three generations showing that all generations carry on the expression. Also, to find out whether the expression increases or decreases over generations, we performed ELISA-based quantitation using antibodies specific to His-tag. The ELISA analysis revealed that expression is increasing from T1 to T3 exhibiting an ascending pattern of protein expression (Fig. 2B). We also performed ELISA quantitation for plant tissues collected from lettuce over different time periods i.e., 10, 20, 40, 60, 80 and 100 days after generation (Fig. 1D). We observed that plants can accumulate rOSM, and showed an increased expressional pattern from 10–80 DAG, with a maximum expression of 127 mg/kg fresh weight (FW), however, the expression decreased at 100 DAG i.e., 80.6 mg/kg FW (Fig. 1D). For each analysis, the whole plant was collected and homogenized for quantitation. A time point increase in expression of osmotin-His was observed, where plants expressed at day 80 were almost three times of proteins at day 10 (Fig. 2A).
3.3 Protein extraction and codon optimization enhanced the total soluble protein recovery and expression of the recombinant protein.
To achieve a higher level of expression in lettuce plants, osmotin sequences were codon-optimized, where rare codons were replaced with preferred ones for higher expression in lettuce. The optimization and usage of preferred codons have been reported earlier in several publications to enhance protein translation by increasing mRNA stability and allowing tRNA to accommodate the tRNA pool in host cells38. After codon optimization, 98 of total 245 codons were optimized by replacement with more preferred codons using Nicotiana benthamiana as the codon usage host (Fig.S1). The osmotin sequence optimized for expression in lettuce has been shown to effectively increase recombinant protein expression in leaf tissues. An ELISA-based quantitation with anti-His antibodies showed higher intensity of rOSM for optimized sequences indicating that the codon optimization system is effective in enhancing its expression (Fig. 2C).
An efficient extraction protocol is critical for extracting all recombinant proteins produced in plant tissues in order to achieve a higher overall yield. We also considered the possibility that rOSM-his recovery is difficult due to intrinsically disordered characteristics of plant material, we also investigated the impact of surfactant i.e., tween-20, protein inhibition cocktail, and ultrasonication on protein extraction using the highest expressional line LS-rOSM-10. The TSP and target protein concentration in the crude extracts were evaluated with Bradford assays and ELISA, respectively. The total soluble proteins were extracted with and without tween-20. The addition of tween-20 had a significant impact on extracting total proteins. The Bradford assay data showed that the addition of 1% (v/v) tween-20 enhanced the extraction of TSP up to 2 folds (Fig. 3A). Tween-20 helped to degrade the lipid biolayer and break down all cellular organelles including ER, and therefore the ER targeted Osmotin could be extracted into an extraction buffer. The addition of tween-20 was also validated with western blot showing higher recovery of target protein. The impact of ultrasonication of plant extracts was also evaluated. Ultrasonication has been used in several studies where it could enhance TPS recovery. Therefore, we analyzed ultrasonication on TSP and found that 5s to 10s (5s on, 10s off) have a positive impact on total protein extraction up to two rounds. The further sonication for the third and fourth rounds negatively impacted the extraction of TSP, and we observed a decline in TSP (Fig. 3B). Ultrasonication generates a considerable amount of heat, and therefore, we kept our samples on ice while ultrasonication to avoid the heat that can possibly degrade proteins. Also, the impact of PIC has been demonstrated in several studies that help recombinant proteins avoid degradation. We analyzed the addition of PIC in the extraction buffer in a 1:100 ratio and compared it to the extraction buffer with no PIC added. The addition of PIC in the extraction buffer had no impact on the recovery of TSP and observed the same amount in the absence. Keeping in view the data obtained from these variables, we developed a procedure for protein extraction and then confirmed the results with ELISA-based quantitation. We observed that the maximum TSP proteins had a positive correlation with the highest expression of rOSM in lettuce samples.
3.4 Recombinant Osmotin was degraded after incubating plant extract at 4°C
The stability of recombinant proteins is more important, especially for low-level expressing proteins. Transgenic plants have relatively lower expression in transient, chloroplast, or cell culture-based systems, and therefore it is crucial to minimize the loss of proteins during downstream processing. We, therefore, observed our protein stability in plant extract after shaking incubation at 4°C for 24 hours, without shaking. We observe a decline in protein expression after 4 hours when proteins started degrading. The peak degradation was observed 20 hours after incubation at 4°C (Fig. 3C). We also excluded the possibility of no PIC on protein protection over longer periods. Therefore, we added PIC with a 1:100 ratio to the extraction buffer to study protein degradation over a longer period. However, we observed an equal amount of degradation, comparable to extraction buffer without PIC (data not shown).
3.5 Recombinant Osmotin was purified from lettuce leaf tissue
The maximum recovery of total proteins was achieved by optimizing extraction conditions and then confirmed our hypothesis of higher total protein content will have higher rOSM with ELISA. The leaf extracts were used for manual purification of Histidine-tagged-OSM using His GraviTrap™ TALON® Columns Nickel-nitrilotriacetic (Sigma Aldrich). Every fraction was subjected to TSP analysis with Bradford analysis to observe the protein recovery. To find out the purity, we did the densitometric analysis using ImageJ software of the blot and achieved > 90% purity. We also loaded the purified in exceeding amounts up to 15 µg, however could see no degradation based on SDS-PAGE and western blot.
3.6 Lettuce-made recombinant Osmotin inhibits fungal growth
To evaluate the inhibitory effect of rOSM, we considered two yeast strains of human pathogens i.e., Candida albicans and Cryptococcus neoformans. The purified rOSM proteins were added in 0.5, 1.0, 1.5 and 2.0 µM concentrations. As shown in Fig. 4, purified rOSM had a significant inhibitory activity for both Candida albicans and Cryptococcus neoformans. The highest amount of 2.0 µM concentration of rOSM inhibited the growth of fungal species to 22% and 13% for Candida albicans and Cryptococcus neoformans, respectively.
3.7 Osmotin expression in lettuce improves stress tolerance, and proline contents
To test whether compartmentalization of Osmotin accumulation in lettuce seed endosperm improves seedling salt tolerance, we challenged T3 transgenic lettuce seedlings with salt in different concentrations. We did not observe a significant difference between wild type and transgenic lines in survival rate under 100mM and 200mM salt stress conditions (Fig. 5A). Similarly, the electrolyte leakage levels in leaves of LS-rOSM-7 and LS-rOSM-10 plants that survived salt stress were slightly, but not significantly, lower compared to WT (Fig. 5C), indicating slightly better cell protection due to rOSM expression in transgenic lines. However, the germination rate of LS-rOSM-7 and LS-rOSM-10 seeds was significantly increased compared to wild-type under 100 and 200 mM NaCl salt stress, indicating a markedly improved salt stress tolerance specifically in transgenic lettuce leaf expressing rOSM (Fig. 5B). Because of a generally better performance of LS-rOSM-10 in the abovementioned aspects, we used this line for all downstream processing.
We also estimated the proline contents in the leaf tissues after exposure to a maximum concentration of 200 mM NaCl. Proline is the major contributor to resistance against adverse conditions by overexpressing under stress conditions. We observed a sharp increase in proline contents when both LS-rOSM-7 and LS-rOSM-10 were exposed to salt stress. There was an increase of 57.1% and 67.6% increase in proline contents for LS-rOSM-7 and LS-rOSM-10, respectively (Fig. 5D).