4.1 Chemicals, Materials and standard procedures
All chemicals were acquired from Carl Roth GmbH & Co. KG (Karlsruhe, Germany) if not, mentioned otherwise. Standard molecular techniques were carried out as described by Sambrook and Russell (2006) [44]. The desired DNA fragments were amplified in polymerase chain reactions using DNA Polymerase (Phusion High-Fidelity #M0530S, New England BioLabs, Frankfurt am Main, Germany). The PCRs were carried out on a PCR thermal cycler (prqSTAR 96X VWR GmbH, Darmstadt, Germany). Chromosomal DNA was purified with a ready to use kit (innuPREP Bacteria DNA Kit) and plasmid DNA was extracted with innuPREP Plasmid Mini Kit (Analytik Jena AG, Jena, Germany). After PCR reactions, amplified DNA fragments were extracted after agarose-based gel electrophoresis with QIAquick PCR & Gel Cleanup Kit, according to the manufactures’ instruction. Restriction enzymes and alkaline phosphatase (#M0290) was purchased from New England BioLabs (Frankfurt am Main, Germany) and T4 DNA ligase were purchased from Thermo Fisher Scientific (Karlsruhe, Germany). All ligation reactions were performed overnight at 4 °C. For better efficiency of ligation, a PEG 8000 solution was added. Oligonucleotides were synthesized by Eurofins MWG (Ebersberg, Germany).
4.2 Strains, plasmids and transformation method
All strains and plasmids used in this study are shown in Table 3. Oligonucleotides used for construction of strains and plasmids are listed in Table 4. Escherichia coli JM109 was used for plasmid propagation and cloning. Transformation of E. coli strains were carried out according to the standard heat-shock method [45]. B. subtilis JABs32 strain, a sfp+ derivate of B. subtilis 3NA, was used for mannose counterselection. Therefore, erythromycin resistance gene (erm) for manPA deletion was removed by the use of plasmid pJOE7644.2 resulting in BMV9 [46]. Strain BMV9 was used as parental strain for construction of further mutant strains. Transformation of natural competent B. subtilis strains was performed according to the “Paris method” [47]. Depending on the selection marker, the transformants were selected on LB agar supplemented with ampicillin (100 µg/mL), spectinomycin (100 µg/mL) or erythromycin (10 µg/mL for E. coli and 5 µg/mL for B. subtilis). All plates were incubated at 37 °C.
Table 3. Bacterial strains and plasmids used in this study
Strain or plasmid
|
Genotype or description
|
Reference
|
Strains
|
|
|
Escherichia coli
|
|
|
JM109
|
mcrA recA1 supE44 endA1 hsdR17 (rK–mK+) gyrA96 relA1 thi∆(lac-proAB) F' [traD36 proAB+ lacIq lacZ ∆M15]
|
[48]
|
Bacillus subtilis
|
|
|
JABs24
|
B. subtilis 168 ΔmanPA; trp+ ; sfp+;
|
[49]
|
3NA
|
spo0A3;
|
[50]
|
JABs32
|
spo0A3; ΔmanPA::erm; sfp+;
|
J. Altenbuchner (unpublished)
|
BMV9
|
spo0A3; ΔmanPA; sfp+;
|
This study
|
BMV10
|
spo0A3; ΔmanPA; sfp+ ;
ΔamyE:: degQ (from B. subtilis DSM10T)
|
This study
|
BMV11
|
spo0A3; ΔmanPA; sfp+; Ppps-ppsA-E:: Pveg –ppsA-E
|
This study
|
BMV12
|
spo0A3; ΔmanPA; sfp+; ΔsrfAA-AD:: comS-erm
|
This study
|
BMV13
|
spo0A3 ΔmanPA; sfp+; ΔsrfAA-AD:: comS -erm;
Ppps-ppsA-E::Pveg –ppsABCDE
|
This study
|
BMV14
|
spo0A3; ΔmanPA; sfp+; Ppps-ppsABCDE::Pveg –ppsABCDE;
ΔamyE::degQ (from B. subtilis DSM10T)
|
This study
|
Plasmids
|
|
|
pJOE6743.1
|
oripUC18, bla, spc, manP, ter-lacI-lacZα-ter
|
[51]
|
pJOE7644.2
|
oripUC18, bla,PmanP-manP, spc, manR-ctaO
|
[46]
|
pJOE4786.1
|
oripUC18, bla, ter-′lacI-lacZα-ter
|
[52]
|
pKAM312
|
oripBR322, rop, ermC, bla, amyE′-[ter-PglcR-lacZ-spcR]- ′amyE
|
[46]
|
pMAV3
|
pJOE4786.1 containig Pveg::Ppps exchange fragment (integrated by Sma I)
|
This study
|
pMAV4
|
pJOE6743.1 containig Pveg::Ppps exchange fragment (integrated by Hind III)
|
This study
|
pMAV5
|
pKAM312 containing degQ (B. subtilis DSM10T) (integrated by Hind III)
|
This study
|
|
|
|
|
|
Table 4. Oligonucleotides used in this study
Name
|
Sequence 5´ - 3´
|
Purpose
|
s1009
s1410
s1409
s1010
|
CTGCCGTTATTCGCTGGATT
ATTATTAACATATGCGGCGTACCTCATACGGATACAC
ATTATTAAGAATTCCTCCTTGATCCGGACAGAATC
AGAGAACCGCTTAAGCCCGA
|
Integration of degQ gene (B. subtilis DSM10T) (+510 bp) in amyE locus
Underlined sequences highlight the Nde I and EcoR I restriction site
|
s1221
s1222
s1223
s1224
s1225
s1226
|
GGAAAGTGAAAAAAGGAGAAGG
CCTATGCAGGTTTTCAACTGTTATTGATTTGCCAAAATGACAG
CAGTTGAAAACCTGCATAGG
TGCATCCACCTCACTACAT
ATGTAGTGAGGTGGATGCATTGAGCGAACATACTTATTCTTTAAC
CATTTAAAGAGATTCCATCCATTATGATATG
|
Construction of Pveg::Pppspromoter exchange
|
s1162
|
CATGATTTTCAGGTCTGCAAGAAC
|
Construction of srfAA-AD:: comS-erm
|
s1163
|
GTTCAAACGTCTGCTCCTCCTTAATCTTTATAAGCAGTGAACATGTGC
|
s1164
|
AGGAGGAGCAGACGTTTGAAC
|
s1165
|
CTTCTCCCTCCAGCAGAAGTAC
|
s1166
|
CTTCTGCTGGAGGGAGAAGTAGGTATAAATTTAAC-GATCACTCATCATGTTC
|
s1167
|
GACCGATAGATTTTGAATTTAGGTGTC
|
s1168
|
CACCTAAATTCAAAATCTATCGGTCGAATGCCAAT-TTCTGCATGGTATAATAG
|
s1169
|
GGCAACCTGATGGATAAAGAAATTG
|
4.3 Construction of plasmids for strain engineering
For markerless promoter exchange, LFH-PCR method was used [53]. Accordingly, upstream and downstream wild-type sequence of pps promoter region was fused with veg promoter. After ligation into Sma I digested pJOE4786.1 resulting in pMAV3, target sequence was isolated by Hind III digestion and was subsequently integrated into pJOE6743.1 (results in pMAV4). Afterwards, plasmid pMAV4 was transformed into strain BMV9 followed by the protocol described before [51].
For the integration of the degQ gene including promoter region (+ 510 bp) and terminator structure from B. subtilis DSM10T, the primer s1011 and s1232, containing Nde I and EcoR I restriction sites, were used. After restriction digestion, the degQ fragment was ligated into pKAM312 [46] resulting in pMAV5. After transformation of pMAV5 into parental strain BMV9 and other mutant strains, transformants were selected on LB agar plates containing spectinomycin. To ensure the correctness of plasmids and mutant strains, all constructs were confirmed by sequencing (Eurofins Genomics Germany GmbH, Ebersberg, Germany).
4.4 Deletion of surfactin operon and retain of comS gene
The principle of LFH-PCR was utilized to design a DNA fragment for deletion of srfA operon and simultaneously retain of comS gene. A fusion of upstream region of srfA operon with comS gene ensured a wild-type expression. For a simple strain selection, comS gene was additionally linked with erythromycin resistance cassette (erm) of pKAM312. An uncoupled erm gene expression was ensured by maintaining the natural Perm promoter region from pKAM312. Fig. 4 illustrates the described strategy.
4.5 Cultivation in mineral salt medium
The mineral salt medium used was based on the fermentation medium of Willenbacher et al. [54] with slight changes. The composition of the final medium was: 20 g/L glucose, 4.0 × 10−6 M Na2EDTA × 2 H2O, 7.0 × 10−6 M CaCl2, 4.0 × 10−6 M FeSO4 × 7 H2O, 1.0 × 10−6 M MnSO4 × H2O, 50 mM Urea, 0.03 M KH2PO4, 0.04 M Na2HPO4 × 2 H2O and 8.0 × 10−4 M MgSO4 × 7 H2O.
For the first preculture, 10 mL LB medium (10 g/L tryptone, 5 g/L NaCl, 5 g/L yeast extract) was inoculated with 10 μL glycerol stock solution in a 100 mL baffled shake flask. After 8 hours of cultivation, the cells were transferred to 10 mL mineral salt medium with an initial OD600 of 0.1 as a second preculture. This preculture was incubated overnight and after reaching an OD600 between 2 - 4 the main culture was inoculated. The main cultivations took place in 1 L Erlenmeyer baffled flasks with the final volume of 100 mL and initial OD600 of 0.1. All cultivation had three biological replicates and were performed at 30 °C and 120 rpm in an incubation shaker (Innova 44®R, Eppendorf AG, Hamburg, Germany).
Additionally, the influence of potentially critical amino acids including glutamic acid, glutamine, isoleucine, alanine, proline and ornithine on plipastatin production was tested using mineral salt medium complemented with 30 mM of each amino acids.
4.6 Extraction of lipopeptides and HPTLC analysis
The cell-free supernatants were obtained by centrifugation at 4700 rpm and 4 °C and were used for extraction of lipopeptides following the method described before with slight changes [55]. In detail, 2 mL of cell-free supernatant was mixed 3 times with 1 mL 1-butanol 95% (v/v) by vortexing for 1 min, followed by 5 min centrifugation at 3000 rpm to separate organic phase. After complete evaporation of butanol phases (RVC2-25 Cdplus, Martin Christ Gefriertrocknungsanlagen GmbH, Osterode am Harz, Germany) at 10 mbar and 60 °C, the remaining residues were dissolved in 2 mL methanol. To quantify surfactin and plipastatin production, these methanolic fractions were separated by HPTLC (CAMAG, Muttenz, Switzerland) as described previously [56].
4.7 Structural analysis of plipastatin variants by Mass spectrometry
LC-MS analysis of plipastatin was performed on a 1290 UHPLC system (Agilent, Waldbronn, Germany) coupled to a Q-Exactive Plus Orbitrap mass spectrometer equipped with a heated electrospray ionization (HESI) source (Thermo Fisher Scientific, Bremen, Germany). Analyte separation was achieved by a Waters ACQUITY CSH C18 column (1.7 μm, 2.1 μm x 150 mm). The column temperature was maintained at 40 °C. Samples were dissolved in methanol and 5 µl of each sample was injected. Mobile phase A was 0.1% formic acid in water (v/v), and mobile phase B 0.1% formic acid in acetonitrile (v/v). A constant flow rate of 0.3 mL/min was used and the gradient elution was performed as follows: 0 – 15% B from 0 to 15 min, 15 – 75% B from 15 to 29 min, 75 – 100% B from 29 to 32 min, isocratic at 100% B from 32 to 36 min, the system was returned to initial conditions from 100% B to 0% B from 36 to 37 min. The HESI source was operated both in positive and negative mode, with a capillary voltage of 3.90 kV and an ion transfer capillary temperature of 350 °C. The sweep gas and auxiliary pressure rates were set to 35 and 10, respectively. The S-Lens RF level was 50%, and the auxiliary gas heater temperature was 150 °C. The temperature of ion transfer capillary, spray voltage, sheath gas flow rate, auxiliary gas flow rate and S-lens RF level were set to 325 °C, 3.5 kV, 60, 30 and 55, respectively. The Q-Exactive Plus mass spectrometer was calibrated externally in positive and negative ion mode using the manufacturer’s calibration solutions (Pierce/Thermo Fisher, Germany). Mass spectra were acquired in MS mode within the mass range of 600 to 1800 m/z at a resolution of 70000 FWHM using an Automatic Gain Control (AGC) target of 1.0 × 106 of and 100 ms maximum ion injection time. Data dependent MS/MS spectra in a mass range of 200 to 2000 m/z were generated for the five most abundant precursor ions with a resolution of 17500 FWHM using an Automatic Gain Control (AGC) target of 5.0 × 104 of and 64 ms maximum ion injection time and a stepped collision energy of 20, 60 and 150. Xcalibur™ software version 4.0.27 (Thermo Fisher Scientific, San Jose, USA) was used for data acquisition and data analysis.