Ketogenic Diet Ameliorates NAFLD via Balancing Mitochondrial Dynamics and Improving Mitochondrial Dysfunction

doi:10.21203/rs.3.rs-3954951/v1

Download PDF

Research Article

Ketogenic Diet Ameliorates NAFLD via Balancing Mitochondrial Dynamics and Improving Mitochondrial Dysfunction

https://doi.org/10.21203/rs.3.rs-3954951/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background & Aims:

The prevalence of non-alcoholic fatty liver disease (NAFLD) imposes a huge burden on global health management. The ketogenic diet (KD) is considered to be an effective lifestyle to manage NAFLD. Here, we aimed to investigate the effect of KD on metabolic endpoints in NAFLD mice and explore the underlying mechanisms.

Methods

High fat diet (HFD)-induced NAFLD mice were fed with/without KD for 2 weeks in contrast with standard diet-fed (SD) mice. The metabolic endpoints of SD and NAFLD mice were determined by measuring liver fat and plasma ALT and AST. Then mitochondrial morphology of the liver was evaluated by transmission electron microscopy (TEM). Western blot was performed to identify the changes of mitochondrial dynamics related proteins. Mitochondrial function was assessed by qPCR and ATP content measurement. In vitro, HepG2 cells were treated with palmitic acid (PA), β-hydroxybutyric acid (β-OHB) and/or MFI8. Tom20 fluorescence staining was used to assess mitochondrial morphology. Mitochondrial function was assessed by qPCR, ATP content measurement and JC-1 staining. Furthermore, lipid deposition was examined by Nile Red and BODIPY staining.

Results

KD feeding for 2 weeks showed the improvement on NAFLD phenotype, which was associated withdecreased levels of Fis1 and Drp1 in the liver of NAFLD mice. Furthermore, KD also improved HFD-induced mitochondrial dysfunction as evidence by increased ATP content and the key genes involved in fatty acid oxidation. In vitro, β-OHB also improved PA-induced mitochondrial fragmentation and dysfunction in HepG2 cells. Moreover, β-OHB alleviated PA-induced lipid accumulation, and this effect was blunted by mitochondrial fusion inhibitor MFI8.

Conclusions

Collectively, these findings indicated that KD feeding improved lipid accumulation, balanced mitochondrial dynamics and improved mitochondrial dysfunction in the liver of NAFLD mice.

NAFLD

Ketogenic diet

Lipid accumulation

Mitochondrial dynamics and Mitochondrial function

Non-alcoholic fatty liver disease (NAFLD) is a clinical syndrome, which is defined as at least 5% hepatocyte steatosis without alcohol and other definite causes of hepatic steatosis [1]. NAFLD is estimated to afflict one billion individuals globally and affects approximately 30% total global population [2]. In addition, NAFLD is a metabolic syndrome and associates with obesity, insulin resistance and dyslipidemia [3]. NAFLD is an independent risk factor for liver-related and all-cause death [4], which emphasizes the need to inhibit the progression of NAFLD. Because of the complex pathophysiology, healthy lifestyles such as a balanced diet and physical exercise are crucial to the prevention and treatment of NAFLD [5]. Therefore, controlling diet structure may be a sustainable treatment for NAFLD.

The ketogenic diet (KD) is a high-fat, low-carbohydrates and appropriate protein diet [6]. It induces the body to switch from glucose to fatty acids (FAs) metabolism, which produces ketone bodies as energy substrates for other tissues and organs [7]. In addition to the treatment of intractable epilepsy, KD also has been used in the management of some metabolic diseases, namely, insulin resistance, lipid profile, cardiovascular disease risk, and NAFLD [10–11]. Moreover, a meta-analysis of randomized controlled trials has shown that compared with routine diet, the KD is more effective in amelioration body weight, blood glucose and blood lipid in overweight individuals, especially those with type 2 diabetes [8]. In addition, high dietary fat intake reduces lipid deposition by inhibiting fat production and promoting fatty acid oxidation [9]. KD was also reported to be beneficial on NAFLD phenotyps, with the effect of KD on weight loss and improving insulin resistance and ketone bodies as effective modulators of inflammation and fibrosis [12, 13]. However, it is unclear whether the KD provides additional benefits for improving NAFLD.

Mitochondria are important organelles that produce energy and regulate cell signals. This functional diversity is matched by their morphological and structural diversity, during the cellular life cycle [14]. The regulation of mitochondrial dynamics primarily involves several key proteins, including dynamin-related protein 1 (Drp1), fission mitochondrial 1(Fis1), mitofusin1 (Mfn1), mitofusin2 (Mfn2), and optic nerve atrophy protein 1 (Opa1) [15]. Drp1 and Fis1 contract and cut mitochondria, mediating mitochondrial division, while Mfn1, Mfn2 and Opa1 fuse mitochondrial membranes, mediating mitochondrial fusion. Under physiological conditions, mitochondrial fission and fusion are dynamically balanced, and the balance can be changed by nutrient supply or metabolic demand [16–18]. Moreover, significantly larger or smaller mitochondria are also observed under pathological conditions, such as non-alcoholic fatty liver disease, malnutrition, myopathy and cancer cells [19]. In addition, mitochondrial dynamics disorder results in mitochondrial dysfunction and leads to the development of mitochondria-related diseases [20]. A study indicates that gene knockout of Mfn1 in the liver protects mice against HFD-induced obesity and insulin resistance [21]. However, the effects of KD on mitochondrial dynamics and its potential role in improving NAFLD development remain unclear.

Herein, we performed a KD feeding HFD-induced NAFLD mice and assessed the change of the NAFLD metabolic phenotype. In addition, mechanically, we evaluated the role of mitochondrial dynamics and mitochondrial function in KD improvement of NAFLD. Taken together, these approaches led to the conclusion that KD prevented the metabolic phenotype of NAFLD, balanced mitochondrial dynamics, and improved mitochondrial dysfunction in the liver of NAFLD mice.

Animals

Six-week-old male C57/BL6J mice were obtained from Beijing Vital River Laboratory Animal Technology Company. All mice were housed in standard vented cages in temperature- and humidity-controlled rooms with 12-hour light/dark cycles, and free access to water. Mice were randomly divided into two groups receiving standard diet (SD) or high-fat diet (HFD) for 12 weeks as NAFLD model, starting at the age of 8 weeks. SD and NAFLD groups were fed with/without KD for another 2 weeks. The percentage of calories from macronutrient content is as follows: SD, 10% from protein, 13% from fat and 77% from carbohydrates; KD, 10% from protein and 90% from fat; HFD, 10% from protein, 60% from fat and 30% from carbohydrates. All diets are matched on a per-calorie basis for micronutrient content, fiber and preservatives. At the end of the experiment, mice were weighted and punctured blood after anesthesia. Then, the livers were removed after sacrificed by cervical dislocation, and after weighed the liver weight, the liver samples were stored according to different experimental needs. All study protocols were approved by The Institutional Animal Care and Use Committees of Chongqing Medical University.

Measurement of plasma β-hydroxybutyrate (β-OHB)

The plasma β-OHB levels were measured with β-hydroxybutyrate Assay Kits (Nanjing Jiancheng Reagents, Jiangsu, China) according to the manufacturer’s instructions.

Glucose tolerance tests (GTTs) and insulin tolerance tests (ITTs)

For GTTs, mice were fasted overnight and then were administered with glucose (2 g/kg body weight) through intraperitoneal injection. Blood glucose was measured from the tail vein using point-of-care blood glucose monitoring system (Yuwell, China) at 0, 15, 30, 60 and 120 min following glucose administration. For ITTs, 6 h fasted mice were injected intraperitoneally with recombinant human insulin at 0.75 U/kg and their blood glucose concentrations were measured at 0, 15, 30, 60 and 90 min after insulin injection.

Histology and staining

Both frozen and fixed liver tissues with 4% paraformaldehyde were used as needed.. H&E staining and Oil Red O staining were used to assess the liver lipid accumulation with commercial kits (Solarbio, Beijing, China) according to the manufacturer’s instructions.

Transmission electron microscope

Fresh liver tissues were fixed overnight in 2.5% glutaraldehyde at 4˚C. Briefly, samples were fixed with 2% Osmic acid and dehydrated with gradient alcohol and then embedded in resin. Then, samples were sliced into 70 nm thickness using a Leica EM UC6 Microsystem and stained with uranyl acetate and lead citrate. The mitochondria were observed with a Philips CM-120 transmission electron microscope (TEM).

Western blots

The liver tissues and HepG2 cells were lysed by RIPA (Beyotime Biotechnology) with PMSF (Beyotime Biotechnology). After protein concentration was determined by BCA assay (Thermo Fisher Scientific), protein samples were incubated with loading buffer for 30 min at 65℃. 30 µg protein samples were separated by 12% SDS/PAGE gels, then transferred to PVDF membranes (Millipore). After blocking with 5% non-fat milk in TBST, the membranes were incubated with the primary antibodies overnight at 4℃ followed by secondary antibodies for 1 hour at room temperature. The following antibodies were used for immunoblotting: Drp1 (CST, 8570, 1:1000), Mfn2 (CST, 9482, 1:1000), Mfn1(Abclonal, A9880, 1:1000), Fis1 (Proteintech, 66635-1-Ig, 1:1000) and β-actin (ZSGB-BIO, 1:1000). Images were visualized using the Fusion FX Spectra system (Vilber Lourmat).

Quantitative RT-PCR

Total RNA was extracted from liver tissues or HepG2 cells using RNAiso plus (Takara, Japan). The cDNA was synthesized with a PrimeScript RT reagent kit (Takara, Japan). Then 100 ng cDNA was analyzed by SYBR Green PCR Master Mix (Takara, Japan) in a CFX96 Real-time System (Bio-Rad, USA). Each group set three repetitions. The original threshold cycle (Ct) values were standardized with β-actin by 2^−ΔΔCt method. The primer sequences used are as shown in Table 1.

Table 1

The primer sequences used in this study
gene	Forward (5'to3')	Reverse (5'to3')
Mouse Cpt1α	TGGCATCATCACTGGTGTGTT	GTCTAGGGTCCGATTGATCTTTG
Mouse Pparα	GGCGTTTCCTGAGACCCT	ATGTTGGATGGATGTGGC
Mouse Acads	TTGTGCTGTGAAGTATGCCGA	CTGGTGGCTAATGGCGGTT
Mouse Acadm	CCAGAGAGGAGATTATCCCCG	TACACCCATACGCCAACTCTT
Mouse slc25a20	CAACCACCAAGTTTGTCTGGA	CCCTCTCTCATAAGAGTCTTCCG
Mouse β-actin	TGGAATCCTGTGGCATCCATGAAAC	TAAAACGCAGCTCAGTAACAGTCCG
Human Pparα	GACGTGCTTCCTGCTTCATAGA	CCACCATCGCGACCAGAT
Human Cpt1α	CGTCTTTTGGGATCCACGATT	TGTGCTGGATGGTGTCTGTCTC
Human Acads	TGCTGGCCTCGATTACCT	GCCTGCTTCTGCTCCTTG
Human Acadm	GAGCCATTGATGTGTGCTT	GCTTTTCCTCCGTTGGTT
Human slc25a20	CTACCTGTGGCAAGAATGC	CTCCTGGTGATCTGGTTGA
Human β-actin	CCTGGCACCCAGCACAAT	GGGCCGGACTCGTCATAC

Measurement of intracellular ATP content

ATP content was measured by ATP detection kit (Beyotime Biotechnology, China). Briefly, 30 µg liver tissues or HepG2 cells in 6-well plates were lysed in 200 µL lysate. After centrifugation at 12000 g for 5 minutes at 4°C, the supernatant was used to measure ATP concentration. To measure ATP content, 100 µL of ATP detection working solution was added to the black 96-well plate. 5 minutes later, 40 µg supernatant solution was added. Then the luminescence was measured with microplate detector (BioTek Synergy, USA).

Measurement of mitochondrial membrane potential (Δψ_m)

The integrity of the inner mitochondrial membrane may be measured by observing the potential gradient over this membrane. The HepG2 cells were seeded into 12-well plates and treated with PA and/or β-OHB for 24 hours. Then the cells were stained with JC-1 dye (Beyotime Biotechnology, China) for 20 minutes at 37°C. Finally, the cells were washed with PBS three times and the green/red fluorescence ratio was observed by fluorescence microscope (ZEISS, Germany).

Plasma profile

Blood samples were collected from SD mice and NAFLD mice fed with/without KD. After centrifugation at 3000 rpm for 10 minutes at 4°C, plasma samples were used to determine liver function. Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were measured with a AU5800 biochemical analysis system (Beckman Coulter, USA) at the Laboratory Department of the People's Hospital of Yubei District, Chongqing.

Biochemical parameter

Biochemical parameters were measured using an assay kit (Nanjing Jiancheng Reagents, Jiangsu, China) according to the manufacturer's instructions. Liver tissue (10 mg) was homogenized with 90 µL absolute ethyl alcohol. After centrifugation at 2500 rpm for 10 min at 4°C, the supernatant was used to measure hepatic total cholesterol (TC) and triglyceride (TG) content. Cell sediments were collected in PBS, treated by ultrasound in an ice-water bath, protein concentration was determined by the BCA method, and then TC and TG were determined.

Immunofluorescence staining

HepG2 cells were treated with PA (300 µM, Sigma-Aldrich, USA) and/or β-OHB (2 mM, MCE, USA) for 24 hours. The cells were fixed with 4% PFA for 15 minutes. After washing with PBS three times, cells were permeabilized with 0.5% Triton X-100 in room temperature for 20 minutes. After blocking with the goat serum for 1 h at room temperature, the cells were incubated overnight at 4°C with the primary antibodies against Tom 20 (Proteintech). The next day, after washing with PBST for three times, secondary antibodies were incubated for 1 h at room temperature. The cells were washed three times and incubated with DAPI. The fluorescence was scanned using the confocal fluorescence microscope (ZEISS, Germany).

Nile Red and BODIPY staining

Intracellular lipid droplet analysis was performed using Nile red and BODIPY staining. The HepG2 cells were treated with PA, β-OHB or/and MFI8 (20 µM, MCE, USA) for 24 hours. Then the cells were fixed with 4% paraformaldehyde for 15 minutes. After staining with Nile Red dye or BODIPY dye in room temperature for 15 minutes and loading the DAPI, the images were acquired using a fluorescence microscope (Leica, Germany).

Statistical analyses

Graphpad Prism software version 8 was used to statistically analyze the data. Data shown are mean ± SEM. Statistical analysis was calculated by one way ANOVA, P < 0.05 was considered as statistically significant.

Ketogenic diet reduces body weight and improves insulin resistance in NAFLD mice

To test whether the KD was beneficial for the management of NAFLD, SD mice and NAFLD mice were subjected to a KD for 2 weeks. As shown in Fig. 1A-1C, relative to NAFLD mice, feeding with KD significantly reduced body weight and liver weight. As expected, KD increased serum β-hydroxybutyrate (β-OHB) (Fig. 1D). Moreover, feeding the KD improved glucose tolerance test (Fig. 1E and 1F) and insulin sensitivity (Fig. 1G and 1H) in NAFLD mice. These findings suggested that KD was efficient in reducing for body weight and controlling blood glucose in NAFLD mice.

Ketogenic diet ameliorates HFD-induced steatosis

To investigate the effect of KD on liver lipid deposition of NAFLD mice, we examined the liver lipid content by H&E staining (Fig. 2A) and Oil Red O staining (Fig. 2B), which showed that the lipid content of NAFLD mice was significantly reduced by KD feeding. Next, we further analyzed the changes of hepatic lipid levels, and found that the hepatic TC level did not change (Fig. 2C), but the hepatic TG level of NAFLD mice was significantly reduced after KD feeding (Fig. 2D). Moreover, although plasma AST levels did not change significantly (Fig. 2E), circulating ALT levels were elevated in NAFLD mice and substantially reduced by KD feeding (Fig. 2F). These results indicated that KD feeding displayed lower hepatic lipid accumulation in NAFLD mice.

The ketogenic diet prevented mitochondrial excessive fission in the liver of NAFLD mice

Given that mitochondria play a key role in lipid metabolism, we next determined whether the KD regulated mitochondrial morphology in the liver of NAFLD mice. As expected, HFD resulted in hepatic mitochondrial fragmentation as evidenced by decreased mitochondrial size in NAFLD mice (Fig. 3A-C). To investigate the underlying mechanism of KD on mitochondrial dynamics, we measured the levels of the main mitochondrial dynamics related proteins (Fig. 3D). Both Drp1 and Fis1 promote mitochondrial fission, and the protein levels of Drp1 and Fis1 were increased in the liver of NAFLD mice (Fig. 3E and 3F). Feeding a KD decreased Drp1 and Fis1 protein contents in NAFLD mice (Fig. 3E and 3F). There was no difference in the content of Mfn1(Fig. 3G) and Mfn2 (Fig. 3H). These results indicated that feeding a KD prevented excessive hepatic mitochondrial fission of NAFLD mice by regulating the expression levels of mitochondrial dynamics-related proteins.

The β-OHB prevented PA-induced mitochondrial excessive fission in HepG2 cells

We next explored whether β-OHB affects mitochondrial morphology under PA treatment in HepG2 cells. PA treatment significantly increased the protein levels of Fis1 and decreased the content of Mfn1 and Mfn2 but did not affect the content of Drp1 (Fig. 4A-E). However, this effect was reversed in response to treatment with β-OHB (Fig. 4A-E). Next, we evaluated mitochondrial morphology by Tom20 fluorescence staining. Our results showed that PA increased the number of fragmented mitochondria and decreased the number of branched mitochondria compared to controls in HepG2 cells. However, mitochondrial fusion increased upon β-OHB treatment as evidenced by branched mitochondria increased and fragmented mitochondria decreased compared with the PA-treated group (Fig. 4F and 4G).

The ketogenic diet improved HFD- induced mitochondrial disfunction

We next sought to determine whether these mitochondrial morphologic abnormalities resulted in mitochondrial dysfunction. HFD feeding reduced fatty acids β-oxidation, as evidenced by significantly reduced hepatic Ppara, Acads, Acadm, slc25a20 and Cpt1a mRNA levels in NAFLD mice (Fig. 5A-E). However, feeding a KD increased liver β-oxidation partly in NAFLD mice. These metabolic changes were accompanied by reversal of the impairment in the HFD-induced expression of Ppara and Cpt1a (Fig. 5A and 5E). Notably, the levels of ATP in the liver of NAFLD mice were significantly increased in response to KD feeding (Fig. 5F). In vitro, we also observed that the mRNA levels of β- oxidation related genes including Ppara, Acads, Acadm, slc25a20 and Cpt1a in HepG2 cells (Fig. 5G-K). This effect of PA, however, was reversed upon β-OHB treatment (Fig. 5G and 5H). However, we did not observe significant changes in Acadm (Fig. 5I), slc25a20 (Fig. 5J) and Cpt1a (Fig. 5K) mRNA levels under β-OHB treatment. Nonetheless, the reduction of ATP content induced by PA was also reversed by β-OHB (Fig. 5L). We further evaluated the mitochondrial membrane potential with PA or/and β-OHB treatment in HepG2 cells. Fluorescence images of JC-1-stained indicated that β-OHB ameliorated PA-induced mitochondrial membrane potential reduction (Fig. 5M and N). Taken together, these results demonstrated that KD or β-OHB treatment improved HFD- or PA-induced mitochondrial disfunction.

β-OHB attenuated PA-induced lipid accumulation in HepG2 cells

As serum β-OHB levels were increased upon KD feeding (Fig. 1D),we investigated whether β-OHB could improve the PA-induced lipid accumulation in vitro. As shown in Fig. 6A-6C, Nile Red and BODIPY staining demonstrated that PA increased the lipid droplets in HepG2 cells. This effect of PA, however, was blunted upon β-OHB treatment. In addition, PA treatment significantly increased the content of TC (Fig. 6D) and TG (Fig. 6E), while β-OHB treatment reversed the increasement of TG. These results demonstrated that β-OHB alleviated the PA-induced lipid accumulation. Next, to investigate whether β-OHB ameliorates PA-induced lipid deposition by affecting mitochondrial dynamics, we used the mitochondrial fusion inhibitor MF18. As shown in Fig. 6F and 6G, the addition of MFI8 increased lipid deposition and reversed the ameliorative effect of β-OHB on lipid deposition.

Lipid metabolism disruptions play a significant role in the initiation and progression of NAFLD [22, 23]. Dietary intervention is one of the most important interventions for the treatment of NAFLD [24]. However, it has raised concerns about the safety of KD in the treatment of NAFLD because it increases serum cholesterol [25] and worsen liver function [26–27]. In our previous study, we found that KD may have a temporal effect on improving NAFLD, and it is related to the ketogenic ability of the liver (data not shown). Therefore, in our study, NAFLD mice were fed a KD for 2 weeks, the optimal time point for KD to improve NAFLD. Our data showed that feeding a KD for 2 weeks ameliorated lipid accumulation, balanced mitochondrial dynamics and improved mitochondrial dysfunction in the liver of NAFLD mice.

Mitochondria are known to play an important role in regulating hepatic lipid metabolism [28]. Many studies have reported that KD can improve both mitochondrial morphology and function, which in turn ameliorates autism spectrum disorder (ASD) and mitochondrial disease [29–30]. However, However, it is unknown whether KD improves mitochondrial morphology in the liver of NAFLD mice and thereby contributes to the amelioration of the NAFLD phenotype. In our NAFLD model, we confirmed that the significant hepatic dysfunction and lipid accumulation were accompanied by excessive mitochondrial fragmentation. In accordance with this, mitochondrial function was impaired, as evidenced by decreased ATP content and damaged fatty acids oxidation. Feeding the KD inhibited mitochondrial excessive fission and improved mitochondrial function, which may be an underlying mechanism contributing to the protection of NAFLD. Moreover, in molecular level, we found that feeding the KD significantly decreased the levels of Drp1 and Fis1, indicating that these two proteins may be promising targets for further studies on the prevention of NAFLD.

The disorder of mitochondrial dynamics leads to mitochondrial disfunction [31–32]. Excessive accumulation of fat in hepatocytes is the first step in the development of NAFLD. Hepatic lipid metabolism involves four main pathways: lipid uptake, de novo lipogenesis, fatty acid β-oxidation and lipid secretion [33, 34]. When the uptake of fatty acids and de novo lipogenesis surpass fatty acid oxidation and export, it will lead to hepatic steatosis and the occurrence of NAFLD [35]. Mitochondria are the main sites of lipid de novo and fatty acid β-oxidation (FAO) [36], so maintaining mitochondrial function is essential for lipid metabolism. Moreover, FAO has been shown to play an important role in the pathophysiology of common disorders such as insulin resistance, diabetes, obesity, kidney fibrosis, and heart failure [37–39]. Our study also demonstrated that KD improved mitochondrial function, as evidenced by increased FAO and ATP production in the livers of NAFLD mice. Therefore, improving mitochondrial function is an important way for KD to protect NAFLD.

As one of the ketone bodies, β-OHB is the most abundant ketone body in circulation. There are reports that β-OHB is beneficial for mitochondrial repair and respiratory function in heart and endothelial cells [40, 41]. However, whether β-OHB affects mitochondrial morphology and function of the hepatocyte has not been reported clearly. Our results suggested that β-OHB ameliorated PA-induced mitochondrial fragmentation and mitochondrial disfunction in HepG2 cells. However, surprisingly, our results showed that, in the absence of PA, exogenous addition of β-OHB inhibited mitochondrial ATP production in HepG2 cells. The ketogenic process and tricarboxylic acid (TCA) cycle are two main branches of FAO [42]. Whether β-OHB inhibits the TCA cycle of liver mitochondria under physiological conditions is unclear. So, the effect of β-OHB on mitochondrial ATP production in ketogenic tissues under physiological conditions remains to be further explored.

There are some limitations that need to be pointed out in this study. In vivo, we demonstrated that KD improved NAFLD and balanced mitochondrial dynamics, thus enhancing mitochondrial function. But it raises a question, that is, whether the changes in mitochondrial dynamics are the result of phenotypic changes in NAFLD or KD improves NAFLD by balancing mitochondrial dynamics or both remains an open question and should be explored in future studies.

In summary, we showed that feeding a KD for 2 weeks alleviated NAFLD metabolic phenotype, balanced mitochondrial dynamics and improved mitochondrial dysfunction in the liver of NAFLD mice.

Conflict of interest

The authors declared no conflict of interest.

Financial support

This work was supported by the National Natural Science Foundation of China (31700725 to LM, 82071734 and 81871222 to XX), the Natural Science Foundation of Chongqing (2020jcyj-msxmX0504 to LM) and the Postgraduate Research and Innovation Project of Chongqing (CYB21167 to YY and XX)

Funding

Declaration

Author Contribution

X. Xiao and L. Ma supervised this work; Y. You designed the experiment with the help of L. Ma; Y. You, H. Ni, Q. Ma and L. Jiang performed the experiments; Y. You and X. Xiao co-wrote the manuscript. All authors discussed the results and commented on the manuscript.

Availability of data and materials

The data generated in the study are analyzed and presented in this article. The raw data are available on request.

Loomba R, Friedman SL, Shulman GI. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell. 2021;184(10):2537–64.
Le MH, Yeo YH, Li X, Li J, Zou B, Wu Y, et al. 2019 Global NAFLD Prevalence: A Systematic Review and Meta-analysis. Clin Gastroenterol Hepatol. 2022;20(12):2809–2817e28.
Yki-Järvinen H. Non-alcoholic fatty liver disease as a cause and a consequence of metabolic syndrome. Lancet Diabetes Endocrinol. 2014;2(11):901–10.
Baumeister SE, Völzke H, Marschall P, John U, Schmidt CO, Flessa S, et al. Impact of fatty liver disease on health care utilization and costs in a general population: a 5-year observation. Gastroenterology. 2008;134(1):85–94.
Powell EE, Wong VW, Rinella M. Non-alcoholic fatty liver disease. Lancet. 2021;397(10290):2212–24.
Ludwig DS, Willett WC, Volek JS, Neuhouser ML. Dietary fat: From foe to friend? Science. 2018;362(6416):764–70.
Taylor MK, Swerdlow RH, Burns JM, Sullivan DK. An Experimental Ketogenic Diet for Alzheimer Disease Was Nutritionally Dense and Rich in Vegetables and Avocado. Curr Dev Nutr. 2019;3(4):nzz003.
Choi YJ, Jeon SM, Shin S. Impact of a Ketogenic Diet on Metabolic Parameters in Patients with Obesity or Overweight and with or without Type 2 Diabetes: A Meta-Analysis of Randomized Controlled Trials. Nutrients. 2020;12(7):2005.
Lundsgaard AM, Holm JB, Sjøberg KA, Bojsen-Møller KN, Myrmel LS, Fjære E, et al. Mechanisms Preserving Insulin Action during High Dietary Fat Intake. Cell Metab. 2019;29(1):229.
Gershuni VM, Yan SL, Medici V. Nutritional Ketosis for Weight Management and Reversal of Metabolic Syndrome. Curr Nutr Rep. 2018;7(3):97–106.
Mooli RGR, Ramakrishnan SK. Emerging Role of Hepatic Ketogenesis in Fatty Liver Disease. Front Physiol. 2022;13:946474.
Watanabe M, Tozzi R, Risi R, Tuccinardi D, Mariani S, Basciani S, et al. Beneficial effects of the ketogenic diet on nonalcoholic fatty liver disease: A comprehensive review of the literature. Obes Rev. 2020;21(8):e13024.
Puchalska P, Crawford PA. Multi-dimensional Roles of Ketone Bodies in Fuel Metabolism, Signaling, and Therapeutics. Cell Metab. 2017;25(2):262–84.
Willems PH, Rossignol R, Dieteren CE, Murphy MP, Koopman WJ. Redox Homeostasis and Mitochondrial Dynamics. Cell Metab. 2015;22(2):207–18.
Li R, Toan S, Zhou H. Role of mitochondrial quality control in the pathogenesis of nonalcoholic fatty liver disease. Aging. 2020;12(7):6467–85.
Molina AJ, Wikstrom JD, Stiles L, Las G, Mohamed H, Elorza A, et al. Mitochondrial networking protects beta-cells from nutrient-induced apoptosis. Diabetes. 2009;58(10):2303–15.
Gomes LC, Di Benedetto G, Scorrano L. During autophagy mitochondria elongate, are spared from degradation and sustain cell viability. Nat Cell Biol. 2011;13(5):589–98.
Westermann B. Bioenergetic role of mitochondrial fusion and fission. Biochim Biophys Acta. 2012;1817(10):1833–8.
Yamada T, Murata D, Adachi Y, Itoh K, Kameoka S, Igarashi A, et al. Mitochondrial Stasis Reveals p62-Mediated Ubiquitination in Parkin-Independent Mitophagy and Mitigates Nonalcoholic Fatty Liver Disease. Cell Metab. 2018;28(4):588–604e5.
Rovira-Llopis S, Bañuls C, Diaz-Morales N, Hernandez-Mijares A, Rocha M, Victor VM. Mitochondrial dynamics in type 2 diabetes: Pathophysiological implications. Redox Biol. 2017;11:637–45.
Sebastián D, Hernández-Alvarez MI, Segalés J, Sorianello E, Muñoz JP, Sala D, et al. Mitofusin 2 (Mfn2) links mitochondrial and endoplasmic reticulum function with insulin signaling and is essential for normal glucose homeostasis. Proc Natl Acad Sci U S A. 2012;109(14):5523–8.
Stefan N, Cusi K. A global view of the interplay between non-alcoholic fatty liver disease and diabetes. Lancet Diabetes Endocrinol. 2022;10(4):284–96.
Meex RCR, Watt MJ. Hepatokines: linking nonalcoholic fatty liver disease and insulin resistance. Nat Rev Endocrinol. 2017;13(9):509–20.
Moore MP, Cunningham RP, Dashek RJ, Mucinski JM, Rector RS. A Fad too Far? Dietary Strategies for the Prevention and Treatment of NAFLD. Obes (Silver Spring). 2020;28(10):1843–52.
Saslow LR, Daubenmier JJ, Moskowitz JT, Kim S, Murphy EJ, Phinney SD, et al. Twelve-month outcomes of a randomized trial of a moderate-carbohydrate versus very low-carbohydrate diet in overweight adults with type 2 diabetes mellitus or prediabetes. Nutr Diabetes. 2017;7(12):304.
Colica C, Merra G, Gasbarrini A, De Lorenzo A, Cioccoloni G, Gualtieri P, et al. Efficacy and safety of very-low-calorie ketogenic diet: a double blind randomized crossover study. Eur Rev Med Pharmacol Sci. 2017;21(9):2274–89.
Schwenger KJP, Fischer SE, Jackson TD, Okrainec A, Allard JP. Non-alcoholic Fatty Liver Disease in Morbidly Obese Individuals Undergoing Bariatric Surgery: Prevalence and Effect of the Pre-Bariatric Very Low Calorie Diet. Obes Surg. 2018;28(4):1109–16.
Mansouri A, Gattolliat CH, Asselah T. Mitochondrial Dysfunction and Signaling in Chronic Liver Diseases. Gastroenterology. 2018;155(3):629–47.
Ahn Y, Sabouny R, Villa BR, Yee NC, Mychasiuk R, Uddin GM, et al. Aberrant Mitochondrial Morphology and Function in the BTBR Mouse Model of Autism Is Improved by Two Weeks of Ketogenic Diet. Int J Mol Sci. 2020;21(9):3266.
Qu C, Keijer J, Adjobo-Hermans MJW, van de Wal M, Schirris T, van Karnebeek C, et al. The ketogenic diet as a therapeutic intervention strategy in mitochondrial disease. Int J Biochem Cell Biol. 2021;138:106050.
Benador IY, Veliova M, Liesa M, Shirihai OS. Mitochondria Bound to Lipid Droplets: Where Mitochondrial Dynamics Regulate Lipid Storage and Utilization. Cell Metab. 2019;29(4):827–35.
Sênos Demarco R, Uyemura BS, D'Alterio C, Jones DL. Mitochondrial fusion regulates lipid homeostasis and stem cell maintenance in the Drosophila testis. Nat Cell Biol. 2019;21(6):710–20.
Koo SH. Nonalcoholic fatty liver disease: molecular mechanisms for the hepatic steatosis. Clin Mol Hepatol. 2013;19(3):210–5.
Lee J, Choi J, Scafidi S, Wolfgang MJ. Hepatic Fatty Acid Oxidation Restrains Systemic Catabolism during Starvation. Cell Rep. 2016;16(1):201–12.
Huh JY, Reilly SM, Abu-Odeh M, Murphy AN, Mahata SK, Zhang J, et al. TANK-Binding Kinase 1 Regulates the Localization of Acyl-CoA Synthetase ACSL1 to Control Hepatic Fatty Acid Oxidation. Cell Metab. 2020;32(6):1012–1027e7.
Kastaniotis AJ, Autio KJ, Kerätär JM, Monteuuis G, Mäkelä AM, Nair RR, et al. Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology. Biochim Biophys Acta Mol Cell Biol Lipids. 2017;1862(1):39–48.
Houten SM, Violante S, Ventura FV, Wanders RJ. The Biochemistry and Physiology of Mitochondrial Fatty Acid β-Oxidation and Its Genetic Disorders. Annu Rev Physiol. 2016;78:23–44.
Piret SE, Attallah AA, Gu X, Guo Y, Gujarati NA, Henein J, et al. Loss of proximal tubular transcription factor Krüppel-like factor 15 exacerbates kidney injury through loss of fatty acid oxidation. Kidney Int. 2021;100(6):1250–67.
Wensaas AJ, Rustan AC, Just M, Berge RK, Drevon CA, Gaster M. Fatty acid incubation of myotubes from humans with type 2 diabetes leads to enhanced release of beta-oxidation products because of impaired fatty acid oxidation: effects of tetradecylthioacetic acid and eicosapentaenoic acid. Diabetes. 2009;58(3):527–35.
Thai PN, Seidlmayer LK, Miller C, Ferrero M, Dorn GWII, Schaefer S, et al. Mitochondrial Quality Control in Aging and Heart Failure: Influence of Ketone Bodies and Mitofusin-Stabilizing Peptides. Front Physiol. 2019;10:382.
Lopaschuk GD, Hess DA, Verma S. Ketones regulate endothelial homeostasis. Cell Metab. 2022;34(4):513–5.
McGarry JD, Foster DW. Regulation of hepatic fatty acid oxidation and ketone body production. Annu Rev Biochem. 1980;49:395–420.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Ketogenic Diet Ameliorates NAFLD via Balancing Mitochondrial Dynamics and Improving Mitochondrial Dysfunction

Status:

Version 1

Abstract

Background & Aims:

Methods

Results

Conclusions

Figures

Introduction

Methods

Animals

Measurement of plasma β-hydroxybutyrate (β-OHB)

Glucose tolerance tests (GTTs) and insulin tolerance tests (ITTs)

Histology and staining

Transmission electron microscope

Western blots

Quantitative RT-PCR

Measurement of intracellular ATP content

Plasma profile

Biochemical parameter

Immunofluorescence staining

Nile Red and BODIPY staining

Statistical analyses

Results

Ketogenic diet reduces body weight and improves insulin resistance in NAFLD mice

Ketogenic diet ameliorates HFD-induced steatosis

The ketogenic diet prevented mitochondrial excessive fission in the liver of NAFLD mice

The β-OHB prevented PA-induced mitochondrial excessive fission in HepG2 cells

The ketogenic diet improved HFD- induced mitochondrial disfunction

β-OHB attenuated PA-induced lipid accumulation in HepG2 cells

Discussion

Declarations

Conflict of interest

Financial support

Funding

Author Contribution

Availability of data and materials

References

Additional Declarations

Status:

Version 1