ALA/LA Inhibited Renal Tubulointerstitial Fibrosis of DKD db/db Mice Induced by Oxidative Stress

doi:10.21203/rs.3.rs-3956527/v1

Download PDF

Research Article

ALA/LA Inhibited Renal Tubulointerstitial Fibrosis of DKD db/db Mice Induced by Oxidative Stress

https://doi.org/10.21203/rs.3.rs-3956527/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Diabetic kidney disease (DKD) is a leading cause of end-stage renal disease. Its progression is caused by various pathological mechanisms, including oxidative stress (OS), inflammation, and fibrosis. This study aimed to explore the effects of alpha-linolenic acid (ALA)/ linoleic acid (LA) on preventing and delaying the progression of interstitial fibrosis and improving OS in DKD mice.

Methods

Male eight-week-old db/db mice were randomly allocated to either the DKD model group, the low-dose ALA/LA group (250 mg/kg·d), the high-dose ALA/LA group (500 mg/kg·d), or the control group, consisting of db/m mice. After 12 weeks of ALA/LA intervention, blood urea nitrogen, blood glucose, and urine protein levels were signifi-cantly lower in db/db mice than in the control group;

Results

ALA/LA enhanced SOD and CAT levels and reduced reactive oxygen species and MDA production. Furthermore, db/db mice in the intervention group had lower mRNA and protein expression levels of p38, p-p38, ERK, p-ERK, /transforming growth factor-β1 (TGF-β1), and type IV collagen (ColIV) than did the model group (P < 0.05);

Conclusions

ALA/LA improved recovery from injury in db/db mice by reducing OS and alleviating kidney fibrosis, especially in the tubules. The potential mechanism was that ALA/LA inhibited renal tubulointerstitial fibrosis and OS via the P-P38, P-ERK/ TGF-β1/ColIV signaling pathway.

α-linolenic acid

linoleic acid

diabetic kidney disease

oxidative stress

tubule intersti-tial fibrosis

Diabetic kidney disease (DKD) is the leading cause of chronic kidney disease and end-stage renal disease (ESRD) worldwide and accounts for approximately 50% of all ESRD cases [1]. DKD is a major complication among patients with type 1 and type 2 diabetes, even in the presence of adequate glycemic control, and it serves as the pri-mary cause of morbidity and mortality in this patient population [2]. It is character-ized by capillary injury, mesangial cell expansion, extracellular matrix (ECM) accumu-lation, thickening of the glomerular basement membrane, and podocyte and glomeru-lar injury, leading to glomerular sclerosis and tubulointerstitial fibrosis [3, 4]. Renal fibrosis, the main pathological characteristic of DKD, is characterized by collagen depo-sition and fibroblast stimulation in the diseased kidney [5, 6].

DKD has multiple etiologies and underlying mechanisms; notably, it has been suggested that fibrosis contributes to its pathogenesis. Furthermore, increasing evidence from experimental and clinical studies suggests a strong association between hyperglycemia, oxidative stress, and DKD [7]. High glucose levels stimulate several fi-brogenic pathways, triggering the production of reactive oxygen species (ROS), stimu-lating neurrohormone responses, and activating growth factor cascades. The mitogen-activated protein kinases (MAPK) signaling pathway, including JNK, Erk, and Ρ38, is involved in producing pro-fibrotic mediators. Specifically, the MAPK pathway is activated by multiple stimulations, in-cluding transforming growth factor-beta 1 (TGF-β1) and ECM proteins [8]; notably, the former is an important pro-fibrotic cytokine significantly elevated in diabetes that induces ECM production in mesangial cells [9]. TGF-β1 activates the downstream Smad3 pathway to induce ECM collagen IV (ColIV) and fibronectin secretion, leading to renal fibrosis [10–12].

Little is known about the effects of the consumption of plant-derived n-3 polyun-saturated fatty acid (PUFA) alpha-linolenic acid (ALA) and the major n-6 PUFA, lino-leic acid (LA) on OS and fibrosis. However, the consumption of ALA and LA has been associated with reduced glycemia in diabetes and diabetic kidney disease [8, 13]. To the best of our knowledge, few studies have evaluated PUFAs in relation to the histo-pathological features of the kidneys [14].

Robust large-scale evidence indicates that circulating plasma phospholipid n-3 PUFA (ALA) and n-6 PUFA (LA) concentrations are associated with a lower incidence of type 2 diabetes mellitus (T2DM). Moreover, lower intake of PUFAs, especially ALA and LA, is associated with chronic kidney disease in patients with T2DM [15, 16].

Over the last two decades, no new drugs have been approved to specifically prevent DKD or improve kidney functions [17, 18]. Therefore, it is tempting to hypothe-size that the protection afforded by agents known to delay the progression of renal disease in diabetic patients may be mediated, at least in part, by the attenuation of fi-brosis [19]. Our previous findings showed that ALA/LA ameliorates glucose toxicity in HK-2 cells by attenuating oxidative stress and apoptosis through the ROS/p38/TGF-β1 pathway [20]. However, the effects and mechanisms of action of ALA/LA in renal fi-brosis remain poorly understood. This study aimed to assess whether ALA/LA intake is associated with the prevention and development of interstitial fibrosis in DN db/db mice and the relationship between tubular interstitial fibrosis and OS.

Animal Experimental Design

Eight-week-old diabetic male db/db mice from the Academy of Military Sciences (Tianjing, China) with serum glucose levels > 11.1 mM was randomly divided into three groups: the DKD model group (n = 10), the low-dose group (n = 10), and the high-dose group (n = 10). Eight-week-old male db/m mice served as controls (n = 10). The mice in the low-dose group were fed with 250 mg/kg·d ALA/LA (1:4), and the mice in the high-dose group were fed with 500 mg/kg·d ALA/LA (1:4). All the procedures were performed in accordance with the relevant institutional guidelines of the South-eastern University Animal Experimentation Ethics Committee.

Metabolic Data

Weight was measured weekly. Plasma glucose, urine volume, and 24-hour urine protein levels were measured every 4 weeks. Plasma glucose levels were meas-ured after an overnight fast. Water intake, food intake, blood urea nitrogen (BUN), creatinine (Scr), and urinary acid (UA) levels were measured at 8, 12, 16, and 20 weeks of age. Kidneys were harvested after 20 weeks. Serum BUN, Scr, and UA levels were measured using a fully enzymatic method.

Analysis of serum and urine markers of nephrotoxicity Serum creatinine and BUN levels were estimated using commercially available kits following the manufacturer's instructions. Urinary albumin levels were measured by the turbidimetry method using a kit, according to the manufacturer’s instructions.

ROS Expression Detection

To evaluate the effects of ALA/LA on ROS production, superoxide anion radicals were detected using dihydroethidium (DHE) staining (Beyotime Institute of Biotech-nology, Nantong, China). Briefly, the kidney sections were incubated with DHE (2 mmol/l) at 37℃ in a humidified chamber protected from light for 45 min. DHE fluo-rescence intensity was analyzed using BIOZERO software (Keyence). Superoxide dismutase (SOD), Catalase (CAT), and malondialdehyde (MDA) levels were measured using UV-Visible Spectrophotometry, and 8-OHDG levels were determined using ELISA.

Quantitative Real-time polymerase chain reaction (PCR)

Total RNA was extracted from the renal tissue using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). According to the manufacturer's instructions, an equal amount of total RNA (1 µg) was reverse-transcribed into cDNA using a Prime Script RT Reagent Kit (Perfect Real Time, Takara, Japan). The primer sequences used in this study are listed in Table 1. Quantitative real-time PCR was performed in triplicates using an Applied Biosystems 7500 quantitative PCR system (Applied Biosystems, Foster City, CA, USA). The Ct values obtained from different samples were compared using the 2-ΔΔCt method. Glyceraldehyde-3-phosphate dehydrogenase served as an internal ref-erence gene.

Table 1

Primer sequences of GAPDH, TGF-β1, P38, ERK and COLⅣ
Primer	Sequence	Length(bp)
GAPDH	F 5' AATGGATTTGGACGCATTGGT 3'	21
	R 5' TTTGCACTGGTACGTGTTGAT 3'	21
TGF-β1	F 5' CTCCCGTGGCTTCTAGTGC 3'	19
	R 5' GCCTTAGTTTGGACAGGATCTG 3'	22
P38	F 5'CCTATCCTGGAAGAGCCATACT 3'	22
	R 5'ACTTTGTCACGCTGACCAGAT 3'	21
ErK	F 5' GGTTGTTCCCAAATGCTGACT 3'	21
	R 5' CAACTTCAATCCTCTTGTGAGGG 3'	23
COLⅣ	F 5' CTGGCACAAAAGGGACGAG 3'	19
	R 5' ACGTGGCCGAGAATTTCACC 3'	20

Tissue Preparation and Histological Analysis

Immediately after sacrificing the animals, their kidneys were stored in 10% neu-tral-buffered formalin and embedded in molten paraffin to prepare tissue blocks. Sub-sequently, tissue sections of 5 µm thickness were cut using a microtome (Leica RM2235, Germany). These sections were stained with hematoxylin and eosin (H&E) for histopathological changes. Tissue sections were subjected to Masson’s trichrome (MT) and periodic acid-Schiff (PAS) staining to demonstrate fibrosis and glomerulosclerosis in the renal tissues and visualized under a light microscope (Olympus CX31, Japan).

Statistical Analysis

Data are presented as means ± SEM. Differences among different groups were evaluated by one-way analysis of variance, followed by least significant difference tests (using SPSS 18.0). Differences yielding P < 0.05 were considered statistically signif-icant.

Effect on Renal Function Related Parameters.

The weight gain of db/db mice with DKD was significantly greater than that of db/m mice. When administered both doses of ALA/LA (250 mg/kg·d and 500 mg/kg·d) at a 1:4 ratio over 12 weeks, the weight of db/db mice was lower not only compared to DKD mice but also to db/m mice (P < 0.01). DKD db/db mice demonstrated significant-ly increased levels of blood glucose, blood urea nitrogen (P < 0.01), and urinary protein (P < 0.01), indicating the development of diabetic kidney disease (Fig. 1E, F, G, H). Treatment with both 250 mg/kg·d ALA/LA (1:4) and 500 mg/kg·d ALA/LA (1:4) sig-nificantly normalized their levels as compared to those of DKD db/db mice.

Effects of ALA/LA on db/db Mice on OS Markers

Compared to the normal control group, the DKD model group demonstrated a significant (P < 0.001) increase in the levels of MDA and 8-OHDG and a reduction in the levels of antioxidants (SOD and CAT). The lower doses of ALA/LA (250 mg/kg·d with ratio of 1:4) significantly (P < 0.01) augmented the levels of the antioxidant en-zymes and reduced the level of MDA of DKD db/db mice. The higher doses of ALA/LA (500 mg/kg·d with a ratio of 1:4) had no significant effect on the oxidant-antioxidant status of DKD db/db mice (Fig. 2).

As illustrated in Fig. 2A and F, stimulation with high glucose concentrations significantly increased ROS levels in the kidneys of DKD db/db mice. Immunofluores-cence assays revealed that two doses of ALA/LA (250 mg/kg·d with a ratio of 1:4 and 500 mg/kg·d with a ratio of 1:4) significantly reduced the level of ROS in the kidney of DKD db/db mice.

ALA/LA Treatment Attenuates the Pathological Changes in the Kidneys of DKD db/db Mice

H&E and periodic acid-Schiff (PAS) staining were used to evaluate pathological changes. As shown in Figs. 3A-C, morphological changes in the renal tissue were iden-tified by H&E, Masson, and PAS staining. The control group exhibited normal glo-meruli without any pathological changes. In group G, glomerular hypertrophy, fibro-sis, mesangial cell proliferation, mesangial matrix expansion, and inflammatory cell infiltration were observed in the kidneys of db/db mice with DKD. In addition, com-pared to the control group, DKD db/db mice had the highest injury scores based on the above ratings. Further, the DKD db/db mice treated with a dose of 500 mg/kg·d, at a ratio of 1:4 ALA/LA (high-dose group, group H), exhibited comparable injuries, including glomerular hypertrophy, mesangial matrix expansion, and inflammation, to those of the DKD control group. Conversely, the DKD db/db mice administered a dose of 250 mg/kg·d, at a ratio of 1:4 ALA/LA (low-dose group, group L), showed a reduction in the extent of glomerular hypertrophy, fibrosis, mesangial matrix expan-sion, and inflammation. Additionally, the injury score in the mice of group L was significantly lower than that in the DKD model group (P < 0.05).

The results from scanning electron microscopy (SEM) revealed that in the normal control group (group N), the glomerular structure of db/m mice was well-maintained, with neatly arranged Sertoli cells, clearly visible foot processes, and distinct mito-chondrial structures in renal tubular epithelial cells; the basement membrane was also clear and uniformly textured. In contrast, the DKD model group (group G) featuring db/db mice exhibited mild thickening of the glomerular capillary basement membrane, increased mesangial matrix, and disordered arrangement of foot processes. Additionally, mitochondrial swelling and cristae disappearance were observed (Fig. 3D, E). In the low and high doses of ALA/LA intervention groups (groups L and H), the glomerular capillary basement membrane thickening of the mild glomerular mesangial area matrix increased slightly. SEM results showed slight changes in endoplasmic reticulum and mitochondrial swelling and hyperplasia of interstitial collagen fibers in renal tubular epithelial cells. Compared with that of the DKD model group, glomerular damage was notably reduced in the low-dose group, which demonstrated superior interven-tion effects relative to the high-dose group (P < 0.05).

Effect of ALA/LA on Fibrotic Markers of db/db Mice

The levels of fibrotic markers, TGF-β1, and ColIV were analyzed because of their association with the development of DKD. In DKD model mice, the levels of TGF-β1 and ColIV were significantly elevated compared to those of the normal control ani-mals (P < 0.001). Interestingly, ALA/LA treatment (500 mg/kg) significantly reduced the levels of the fibrotic markers (Fig. 4).

As shown in Fig. 4D and Fig. 4H, compared to those of the normal control mice, p38 mRNA expression and relative p-p38 levels were enhanced in the DKD model mice (group G) and low- and high-dose groups (group L and group H) (group N) (P < 0.05). However, with the treatment of 1:4 ALA/LA, the expression of p38 mRNA and relative p-p38 was improved, not only in the 250 mg/kg·d dose (group L) but also in the 500 mg/kg·d dose (group H) (P < 0.05). Similar results were obtained for ERK, a MAPK signaling molecule. However, only in group L was the expression of ERK mRNA and relative p-ERK lower than that in the DKD model group (P < 0.05).

The therapeutic use of polyunsaturated fatty acids (PUFAs) in preserving insulin sensitivity and prevention of cardiovascular disease and cancer has gained interest in recent decades; however, the roles of ALA and LA remain poorly understood. Our data demonstrated that treatment with 250 mg/kg·d and 500 mg/kg·d ALA/LA resulted in a more pronounced decline in weight and FBG in db/db mice than it did in the DKD model group (P < 0.01). An n–3 PUFA-rich diet is correlated with decreasing or preventing adipose tissue fat accumulation, insulin resistance, hypertension, obesity, cardiovascular diseases, and T2DM [21–23]. Furthermore, Zhang et al. reported that long-term intake of LA (for women only) and ALA might have a protective effect against the development of T2DM in obese/overweight subjects [24]. Increasing atten-tion is being paid to mechanistic studies on the effects of n-3 PUFAs on metabolic dis-eases. Specifically, N-3 PUFAs have been reported to improve both glucose and lipid metabolism in obesity by modulating neuropeptides in the hypothalamus [25]. David reported that a high dietary intake of n-3 PUFA increased beneficial microorganisms, primarily Bacteroidetes to Firmicutes ratios, as well as Actinobacteria and Proteobac-teria species. These bacterial species are associated with increased short-chain fatty ac-id production, which prevents and reduces obesity and its related metabolic dysbiotic effects [26]. However, further studies are needed to verify how ALA/LA works on weight loss and glucose reduction in db/db mice.

Further, ALA/LA improves kidney function in db/db mice with DKD. In our data analysis, ALA/LA intake improved blood urea nitrogen and urinary protein levels in DKD db/db mice. The results of the meta-analysis suggested that using n-3 PUFA supplements reduced urine protein excretion but not the glomerular filtration rate.

More importantly, high plasma glucose levels directly damage renal tubular cells, resulting in various metabolic and cellular dysfunctions [27]. SEM results showed that, compared to those of db/m mice, GB MT increased, foot processes fused, mitochondria enlarged, and cristae disappeared in db/db mice with DKD. The effect of prolonged exposure to high glucose and the activation of signaling pathways leads to the impairment of mitochondrial structure and function in kidney cells, leading to increased ROS synthesis [28]. Similarly, our previous study showed that overproduction of ROS, activation of apoptosis, and p38 MAPK signaling pathways are interlinked mechanisms that play pivotal roles in the progression of DKD [20]. In contrast, ALA/LA treatment significantly enhanced the levels of SOD and CAT, decreased MDA, inhibited the overproduction of ROS (P < 0.05), and attenuated kidney OS (Fig. 2). Furthermore, the foot process width, mitochondrial structure, and function of DKD mice were improved by ALA/LA administration (Fig. 2A and E). Although renal tubular epithelial cells (TECs) have the highest mitochondrial content, they may be affected by diabetes-induced mitochondrial injury [27]. Furthermore, fatty acid oxidation (FAO) also occurs in mitochondria. ALA and LA are essential long-chain fatty acids that are the preferred energy sources for TECs via the FAO. Fatty acid uptake, oxidation, and synthesis are tightly balanced to prevent intracellular lipid accumulation [29], potentially representing the underlying mechanism by which ALA/LA protects kidney structure in DKD mice.

Renal fibrosis is a histological manifestation of a progressive, irreversible process that causes chronic and end-stage kidney disease [29]. Renal fibrosis is caused by the loss of epithelial function and the expansion of connective tissue (swelling of interstitial myofibroblasts and excess deposition of ECM). Additionally, fibrosis is character-ized by the loss of capillary networks and accumulation of fibrillary collagen, activat-ed myofibroblasts, and inflammatory cells [30, 31]. Although TECs may not be the di-rect precursors of myofibroblasts, they play an instrumental role in orchestrating renal fibrosis via multiple mechanisms, including the secretion of various cytokines. In par-ticular, TGF-β1 is a key mediator of tissue fibrosis; it induces the secretion of fibrillary collagens and promotes cell death and dedifferentiation [32]. Our data showed that in DKD db/db mice, the levels of TGF-β1 and ColIV were significantly (P < 0.001) elevated in comparison to those of the control animals. Interestingly, ALA/LA (50 mg/kg) treatment can ameliorate tubular injury, TGF-β1 production, and deposition of the ECM components (ColIV).

MAPK are intracellular signaling molecules that elicit diverse pro-fibrotic effects, both in vitro and in vivo. The anti-fibrotic effect has been recently reported in experi-mental models of renal interstitial fibrosis, showing that blockade of the MAPK pathway ameliorates renal fibrosis [33]. Several MAPK inhibitors have been developed and tested in various stages of clinical trials. The Ρ38 pathways play important roles in the production of pro-fibrotic mediators, which are activated by various cellular stresses [34]. The administration of pharmacological MAPK inhibitors has been shown to suppress the development of glomerulosclerosis and tubulointerstitial fibrosis in various animal models [35]. Similar results reported by Lim et al. were obtained in our study. ALA/LA treatment significantly inhibited the P38/ERK MAPK signaling path-ways and decreased the deposition of TGF-β1and ColIV.

We confirmed that ALA/LA downregulates OS and metabolic diseases in db/db mice with DKD by reducing ROS production and promoting the expression of antioxidant enzymes, such as SOD and CAT. Moreover, ALA/LA ameliorates renal fibrosis by blocking MAPK signaling pathways, cutting down the deposition of TGF-β1 and reducing ECM accumulation. Our results provide new insights into the antioxidant ef-fects of ALA and LA on DKD. Further studies are needed to clarify the underlying mechanisms and enhance the performance of ALA/LA in protecting against DKD.

Author Contributions

MXJ and CKZ participated in the conception and design of the study, interpretation of the data, and drafting of the article. HS participated in writing the paper and interpreting the data. HFZ and YC participated in the analysis and interpretation of the data. HFZ and HZ participated in the acquisition of the data. CKZ participated in revised the article critically for important intellectual content. All the authors read and approved the final manuscript.

Funding

This research was funded by the National Natural Science Foundation of China, grant number 81903318.

Ethics approval and consent to participate

The animal study protocol was approved by the Ethics Committee of Southeast University (protocol code 20210106039 and date of approval Jan6, 2021).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Barrera C, Jaisser F. Pathophysiologic mechanisms in diabetic kidney disease: A focus on current and future therapeutic targets. Diabetes Obes Metab. 2020; 22 Suppl 1:16-31.
Doshi SM, Friedman AN. Diagnosis and management of type 2 diabetic kidney disease. Clin J Am Soc Nephrol. 2017;12(8):1366-1373.
Anders HJ, Huber TB, Isermann B, Schiffer M. CKD in diabetes: diabetic kidney disease versus nondiabetic kidney dis-ease. Nat Rev Nephrol. 2018;14(6):361-377.
Thomas MC, Brownlee M, Susztak K, Sharma K, Jandeleit-Dahm KA, Zoungas S, Rossing P, Groop PH, Cooper ME. Diabetic kidney disease. Nat Rev Dis Primers. 2015; 1:15018.
Roberts V, Lu B, Chia J, Cowan PJ, Dwyer KM. CD39 overexpression does not attenuate renal fibrosis in the unilateral ureteric obstructive model of chronic kidney disease. Purinergic Signal. 2016;12: 653-660.
Guan T, Fang F, Su X, Lin KQ, Gao Q. Silencing PEG3 inhibits renal fibrosis in a rat model of diabetic nephropathy by suppressing the NF-κB pathway. Mol Cell Endocrinol. 2020; 513:110823.
Lin YC, Chang YH, Yang SY, Wu KD, Chu TS. Update of pathophysiology and management of diabetic kidney disease. J Formos Med Assoc. 2018; 117(8):662-675.
Fan Z, Qi XX, Yang WW, Xia LL, Wu YG. Melatonin Ameliorates Renal Fibrosis Through the Inhibition of NF-κB and TGF-β1/Smad3 Pathways in db/db Diabetic Mice. Arch Med Res. 2020; 51(6):524-534.
Dai C, Liu Y. Hepatocyte growth factor antagonizes the profibrotic action of TGF-beta1 in mesangial cells by stabilizing Smad transcriptional corepressor TGIF. J Am Soc Nephrol. 2004; 15:1402-1412.
Navarro-Gonzalez JF, Mora-Fernandez C. The role of inflammatory cytokines in diabetic nephropathy. J Am Soc Nephrol. 2008;19: 433-442.
Lv M, Chen Z, Hu G, Li Q. Therapeutic strategies of diabetic nephropathy: recent progress and future perspectives. Drug Discov Today. 2005; 20:332-346.
Forouhi NG, Imamura F, Sharp SJ, Koulman A, Schulze, MB, Zheng JS, Ye Z, Sluijs I, Guevara M, José HM, Heiner B, Dow C, Fagherazzi G, Franks PW, Gonzalez C, Kaaks R, Key TJ, Khaw KT, Kühn T, Ma L, Mortensen X, Nilsson PM, Overvad K Pala V, Palli D, Panico S, Quirós JR, Rodriguez-Barranco M, Olov R, Sacerdote C, Scalbert A, Slimani N, Spijkerman AMW, Tjonneland A, Tormo MJ, Tumino R, van der A DL, van der Schouw YT, Langenberg C, Riboli E, Wareham NJ. Association of Plasma Phospholipid n-3 and n-6 Polyunsaturated Fatty Acids with Type 2 Diabetes: The EPIC-InterAct Case-Cohort Study. PLoS Med. 2016; 13(7): 1002094.
Teixeira DSAL, Kummel DC, Manoella S, Maira Z, Carnevalle AJ, Luiz GJ, Jobim AM, Hinda LA, Themis Z, Gregory S. Low linolenic and linoleic acid consumption are associated with chronic kidney disease in patients with type 2 diabetes. Plos One. 2018; 13(8):0195249.
Eide IA, Dörje C, Svensson M, Jenssen T, Hammarstrøm C, Scott H, Bjerve KS, Christensen JH, Schmidt EB, Hartmann A, Åsberg A, Reisæter AV, Reinholt FP. Development of Kidney Transplant Fibrosis Is Inversely Associated with Plasma Marine Fatty Acid Level. J Ren Nutr 2018; 28(2):118-124.
Xi HH, Zhou W, Sohaib M, Niu Y, Zhu R, Guo YZ, Wang SK, Mao J, Wang XY, Guo LR. Flaxseed supplementa-tion significantly reduces hemoglobin A1c in patients with type 2 diabetes mellitus: A systematic review and meta-analysis. Nutr Res.2023; 110:23-32.
Zhu LL, Sha LP, Li K, Wang Z, Wang T, Li YW, Liu P, Dong XY, Dong YP, Zhang XX, Wang H. Dietary flax-seed oil rich in omega-3 suppresses severity of type 2 diabetes mellitus via anti-inflammation and modulating gut microbiota in rats. Lipids Health Dis. 2020;19(1):20.
Breyer MD, Susztak K. The next generation of therapeutics for chronic kidney disease. Nat Rev Drug Discov. 2016;15: 568–588.
Srivastava SP, Li J, Takagaki Y, Kitada M, Goodwin J E, Kanasaki K, Koya D. Endothelial SIRT3 regulates myofibro-blast metabolic shifts in diabetic kidneys. iScience. 2021; 24(5):102390.
Tuleta I, Frangogiannis NG. Diabetic fibrosis. Biochim Biophys Acta Mol Basis Dis. 2021; 1867(4):166044.
Jiang MX, Zhang HF, Zhai LJ, Ye BL, Cheng Y, Zhai CK. ALA/LA ameliorates glucose toxicity on HK-2 cells by at-tenuating oxidative stress and apoptosis through the ROS/p38/TGF-β1 pathway. Lipids Health Dis. 2017; 16(1):216.
Huang CW, Chien YS, Chen YJ, Ajuwon KM, Mersmann HM, Ding ST. Role of n-3 polyunsaturated fatty acids in ameliorating the obesity-induced metabolic syndrome in animal models and humans. Int J Mol Sci. 2016; 17:1689
Lalia AZ, Lanza IR. Insulin-sensitizing effects of omega-3 fatty acids: Lost in translation? Nutrients. 2016; 8:329
Lepretti M, Martucciello S, Aceves MAB, Putti R, Lioneti L. Omega-3 fatty acids and insulin resistance:Focus on the regulation of mitochondria and endoplasmic reticulum stress. Nutrients. 2018; 10, 350
Zhuang P, Shou QY, Wang WQ, He LL, Wang J, Chen JN, Zhang Y, Jiao JJ. Essential Fatty Acids Linoleic Acid and α-Linolenic Acid Sex-Dependently Regulate Glucose Homeostasis in Obesity. Mol Nutr Food Res. 2018; 62(17): e1800448.
Ma SS, Ge YL, Gai XY, Xue ML, Li N, Kang JX, Wan JB, Zhang JY. Transgenic n-3 PUFAs enrichment leads to weight loss via modulating neuropeptides in hypothalamus. Neurosci Lett. 2016; 611:28-32.
David JM, Priscila SF, Gabriela M, Rita CAG, Priscila AH, Danielle B, Verônica AZP, Lincoln CSO, Arnildo P. Fatty Acid Diets: Regulation of Gut Microbiota Composition and Obesity and Its Related Metabolic Dysbiosis. Int J Mol Sci. 2020; 21(11):4093.
Forbes JM, Thorburn DR. Mitochondrial dysfunction in diabetic kidney disease. Nat Rev Nephrol. 2018;14(5):291-312.
Zhang LW, Liu J, Zhou FF, Wang WM, Chen N. PGC-1α ameliorates kidney fibrosis in mice with diabetic kidney dis-ease through an antioxidative mechanism. Mol Med Rep. 2018; 17(3): 4490-4498.
Kang HM, Ahn SH, Choi P, Ko YA, Han SH, Chinga F, Park ASD, Tao JL, Sharma K, Pullman J, Bottinger EP, Goldberg IJ, Susztak K. Defective fatty acid oxidation in renal tubular epithelial cells has a key role in kidney fibrosis de-velopment. Nat Med. 2015; 21(1):37-46.
Humphreys BD, Lin SL, Kobayashi A, Hudson TE, Nowlin BT, Bonventre JV, Valerius MT, McMahon AP, Duf-field JS. Fate tracing reveals the pericyte and not epithelial origin of myofibroblasts in kidney fibrosis. Am J Pathol. 2010;176(1):85-97.
Zeisberg M, Hanai JI, Sugimoto H, Mammoto T, Charytan D, Strutz F, Kalluri R. BMP-7 counteracts TGF-β1–induced epithelial-to-mesenchymal transition and reverses chronic renal injury. Nat Med. 2003; 9(7):964-8.
DeBerardinis RJ, Thompson CB. Cellular metabolism and disease: what do metabolic outliers teach us? Cell. 2012; 148: 1132–1144.
Li R, Guo YJ, Zhang YM, Zhang X, Zhu LP,Yan TH. Salidroside Ameliorates Renal Interstitial Fibrosis by Inhibiting the TLR4/NF-κB and MAPK Signaling Pathways. Int J Mol Sci. 2019; 20(5):1103.
Ono K, Han J. The p38 signal transduction pathway: Activation and function. Cell. Signal. 2000; 12(1):1-13.
Lim AKH, Ma FY, Nikolicpaterson DJ, Ozols E, Young MJ, Bennett BL, Friedman GC, Tesch GH. Evaluation of JNK Blockade as an Early Intervention Treatment for Type 1 Diabetic Nephropathy in Hypertensive Rats. Am J Nephrol. 2011; 34, 337–346.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

ALA/LA Inhibited Renal Tubulointerstitial Fibrosis of DKD db/db Mice Induced by Oxidative Stress

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Methods

Animal Experimental Design

Metabolic Data

ROS Expression Detection

Quantitative Real-time polymerase chain reaction (PCR)

Tissue Preparation and Histological Analysis

Statistical Analysis

Results

Effects of ALA/LA on db/db Mice on OS Markers

ALA/LA Treatment Attenuates the Pathological Changes in the Kidneys of DKD db/db Mice

Effect of ALA/LA on Fibrotic Markers of db/db Mice

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1