Incidence of aphid-transmitted viruses in raspberry and raspberry aphids in Norway and experiments on aphid transmission of black raspberry necrosis virus (BRNV)

doi:10.21203/rs.3.rs-3956579/v1

Download PDF

Research Article

Incidence of aphid-transmitted viruses in raspberry and raspberry aphids in Norway and experiments on aphid transmission of black raspberry necrosis virus (BRNV)

https://doi.org/10.21203/rs.3.rs-3956579/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Raspberry (Rubus idaeus L.) is susceptible to aphid-borne viruses. We studied the incidence of four of them – black raspberry necrosis virus (BRNV), raspberry leaf mottle virus (RLMV), raspberry vein chlorosis virus (RVCV), and Rubus yellow net virus (RYNV) – in raspberry plants and aphids in and around Norwegian raspberry crops for three years (2019, 2021–2022). Most of the samples were from symptomatic plants. Applying RT-PCR, 274 leaf samples and 107 aphid samples were analyzed. All four viruses were found, but BRNV dominated: it was detected in 93% of the 178 leaf samples with virus and was the only virus more common as a single infection than in co-infections with the other viruses. The old cv. Veten had the highest virus incidence (97%) among the sampled plants, followed by uncultivated raspberry in the boundary vegetation (82%). All aphids identified were Amphorohora idaei and Aphis idaei. BRNV and/or RLMV was detected in 27% of the aphid samples. Notably, BRNV was detected in 30% of A. idaei samples, a species not known as a BRNV vector. In subsequent transmission experiments we found that although A. idaei can acquire BRNV within one hour it did not transmit the virus to healthy raspberry plants. In contrast, Am. idaei, a known BRNV vector, was able to acquire the virus within one minute and transmit it within one hour of inoculation. Our study will improve the identification and management of BRNV.

Raspberry

black raspberry necrosis virus

raspberry leaf mottle virus

Rubus yellow net virus

raspberry vein chlorosis virus

Red raspberry (Rubus idaeus L.), an economically important perennial crop, reached global production of 886538 tons in 2021 (FAO, 2022). Its popularity has increased significantly, especially in Europe and North America, due to its high nutritional, dietary and medicinal values. Norway is one of the raspberry producing countries in Europe, with an annual production of 1798 tons in 2021 (FAO, 2022). In Norway, the prime area for growing raspberries is in the western part, specifically within the fjord district of Sogn og Fjordane, now part of Vestland county (Bøthun & Heiberg, 2004). This region benefits from an ideal climate for raspberry production, contributing to its prominence in cultivation. Raspberry cv. Veten was the cornerstone cultivar for more than 30 years, chiefly serving the processing industry with its robust characteristics (Fotirić Akšić et al., 2022; Haffner et al., 2002). However, the introduction of cv. Glen Ample in 1996 marked a significant shift, as this Scottish-bred variety supplanted cv. Veten due to its high yield with large fruit and excellent quality at high latitudes, flourishing even in the northern reaches of Brønnøysund in Nordland (65^o N) (Bøthun & Heiberg, 2004; Heiberg et al., 2001). Recently, the cv. Glen Mor, bred by the James Hutton Institute in 2020, has raised the interest of Norwegian farmers, mainly due to its Phytophthora resistance.

Raspberry plants are vulnerable to a host of pathogens, particularly viruses (Martin et al., 2013). Till now, 23 plant viruses from different families and genera are known to infect raspberry (Koloniuk et al., 2023; Tan et al., 2022). Among them, aphid-transmitted viruses, such as black raspberry necrosis virus (BRNV), raspberry leaf mottle virus (RLMV), and Rubus yellow net virus (RYNV), are important, causing raspberry mosaic disease (RMD) when occurring as mixed infections (Alford, 2007; Converse, 1987). Yield losses due to the combined effect of these viruses in some red raspberry cultivars can be significant, ranging from 11 to 39% in different regions (Converse, 1963; Freeman & Stace-Smith, 1970). Individually, these viruses may not exhibit distinct symptoms in red raspberry (R. idaeus L.) cultivars (Jones & Jennings, 1980; Martin et al., 2013). For instance, BRNV may cause apical necrosis in shoots of the indicator species R. henryi and R. occidentalis (Jones & Jennings, 1980) while RLMV induces chlorotic leaf spots and mosaics, and RYNV causes net-like chlorosis along veins (Martin et al., 2013; Stace-Smith, 1955a). Another aphid-borne virus, raspberry vein chlorosis virus (RVCV), induces a yellow net pattern in most cultivars (Martin et al., 2013). The spread of viruses is often unintentionally facilitated by farmers, such as using infected planting material or overlooking slight symptoms, highlighting the importance of efficient detection and production of healthy planting material (Converse, 1987; Tatineni & Hein, 2023).

All viruses transmit efficiently through vegetative propagation techniques, with additional routes of transmission including carriers such as seeds, pollen, and insects such as aphids (Dietzgen et al., 2016). In Europe, the large European raspberry aphid, Amphorophora idaei (or Am. rubi idaei) is the primary vector transmitting BRNV, RLMV, and RYNV, while the small European raspberry aphid, Aphis idaei transmits RVCV (Martin et al., 2013; Tan et al., 2022).

Viral infections, facilitated by vector dispersal strategies, pose a significant challenge once established. The use of virus-free plant material is thus crucial for disease control. Studying virus occurrence and vector distribution on commercial farms is necessary to establish disease management strategies. The main objective of this study was to assess the relative distribution of aphid-transmitted viruses in symptomatic raspberry and aphids on such plants in commercial raspberry farms across the most important production area in Norway. The secondary objective was to evaluate the capability of Am. idaei and A. idaei as vectors for BRNV through aphid transmission experiments.

Field survey and sample collection

Field sampling was carried out in June and July 2019, 2021, and 2022 in different counties in Norway (in 2020 the covid pandemic led to a break in the sampling). The sample sizes for different years and locations are listed in Table 1. The selected plantations were subjected to visual inspection and shoots of raspberry canes with leaves were collected. In majority of cases, plants displaying virus symptoms were chosen. A total of 274 samples of raspberry leaves were acquired, consisting predominantly of three cultivars – ‘Glen Ample’, ‘Veten’, and ‘Glen Mor’ - from open fields or polytunnels, and of non-cultivated raspberry plants of unknown variety found within the boundary vegetation of the plantations, referred to as “Wild" cultivars. Furthermore, some cultivated raspberry samples were labeled as “Others”, signifying their unidentified cultivar name. Photographs were taken for all the samples collected to assist in the evaluation of leaf symptoms.

In 2021 and 2022, any aphids colonizing the sampled leaves were also examined and a total of 107 aphid samples were collected over the two years. The aphids were individually collected and placed in separate 2 ml Eppendorf tubes containing DNA/RNA Shield (Zymo Research, Irvine, CA, USA). For nymphs, 3–5 individuals were collected in a single tube, while for adults, the number was limited to 1–2 per tube.

Table 1

Locations and number of raspberry leaf samples collected. The sampling locations are the counties covering the most important raspberry growing areas in Norway, while the sample size indicates the number of raspberry samples collected in three different years (2019, 2021 and 2022).
Sampling location	Sample size
Sampling location	2019	2021	2022	Total
Innlandet	8	0	0	8
Vestfold og Telemark	9	0	0	9
Viken	7	16	27	50
Vestland	39	68	83	190
Agder	0	11	6	17
Total	63	95	116	274

RNA Extraction

Raspberry leaf samples were ground into a fine powder using liquid nitrogen employing a mortar and pestle. Total RNA was then extracted from fresh young leaf tissues (50 mg) using the Norgen Plant/Fungi RNA kit (Norgen Biotek, Thorold, ON, Canada). Extraction was performed according to the manufacturer's instructions with some modifications, and then elution was performed in 50 µL of RNase-free water. DNase treatment was implemented on the column during the extraction process. In addition, plant samples infected with BRNV, RLMV, RYNV and RVCV and cultivated in the NIBIO greenhouse as positive controls were also subjected to a similar RNA extraction procedure. The amount of RNA was determined using a NanoDrop 1000b spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and the extracted RNA was stored at a temperature of − 80°C for future use.

Aphid samples collected in the DNA/RNA solution were processed by directly crushing them with a small glass rod and adding 600 µL of TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). The total RNA was extracted using a Direct-zol RNA Miniprep Kit (Zymo Research) according to the manufacturer's instructions. The purified RNA was then stored at − 80°C.

RT-PCR and Sanger sequencing

The extracted total RNA was reverse transcribed (RT) using the Superscript IV Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's guidelines. As an internal amplification control of the plant sample for amplification, RT-PCR was used to amplify mitochondrial NADH dehydrogenase nad5 mRNA (Menzel et al., 2002). While internal controls of cytochrome c oxidase subunit I-COI (Folmer et al., 1994) were used for aphid samples. For the subsequent virus detection, only samples that passed the internal controls were included and carried out in a 25 µL reaction with Taq DNA polymerase (5U/µL) (InvitrogenTM, ThermoFisher Scientific, USA) according to the manufacturer's recommendations with 2 µL of cDNA. All primer sequences used in this study as well as their respective amplification conditions are listed in Table 2. As a part of quality control, reaction mixtures containing 2 µL of sterile water in place of the cDNA template were used as blank controls, and cDNA templates previously confirmed to be infected with the respective viruses were used as the virus-positive controls. The PCR programs applied to detect all the viruses were as follows: initial pre-denaturation step at 95°C for 2 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 47 to 60°C for 30 seconds, and extension at 72°C for 45 seconds. A final extension was performed at 72°C for 7 minutes. Each resulting PCR product (10 µL) was subjected to electrophoresis in a 1.2% agarose gel previously stained with SYBR safe DNA stain (Invitrogen, ThermoFisher Scientific, USA).

For aphid molecular identification, aphid samples amplified with COI primer were sent for Sanger sequencing (Eurofins Genomics, Norway). The purified PCR products were sequenced in both directions. The nucleotide sequences obtained from Sanger sequencing were analyzed using CLC Genomics Workbench 9.5.1 (Qiagen) and identified using the BLAST service against nr/nt database provided by the NCBI.

Table 2

All the primers used in this study.
Name of primer	Sequence (5’-3’)	Product size (bp)	Annealing temperature	Reference
Nad_F	GATGCTTCTTGGGGCTTCTTGTT	181	50	(Menzel et al., 2002)
Nad_R	CTCCAGTCACCAACATTGGCATAA
BRNV_1153	GCGCACTGAACCCAAGTTTA	502	60	(McGavin et al., 2010)
BRNV_1154	CAACATCGAATCCCTCAAGC
RLMV_CPhF	CGAAACTTYTACGGGGAAC	470	60	(Tzanetakis et al., 2007)
RLMV_CPhR	CCTTTGAAYTCTTTAACATCGT
RYNV_1752	TCCAAAACCTCCCAGACCTAAAAC	350	55	(Jones et al., 2002)
RYNV_1753	ATAATCGCAAAAGGCAAGCCAC
RVCV_3649	CCAACAAAGCTGATATWCCAG	257	55	(Jones et al., 2019) (Folmer et al., 1994)
RVCV_3648 LCOI490 HCO2198	CCTCATCTAAGTARTCTTCCA GGTCAACAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA	700	47	(Jones et al., 2019) (Folmer et al., 1994)

Aphid cultures

Colonies of A. idaei and Am. idaei were established as individual lines from the overwintering eggs collected outdoors in the early spring and subsequently tested for viruses. The aphids were kept on virus-free raspberry cv Glen Ample derived from tissue culture plants. The aphid cultures were maintained in net cages (70 x 50 x 50 cm) in a climate room at 18°C, 75% humidity, and a 16-h light/8-h dark cycle. All experiments were carried out under the same conditions in separate aphid net chambers i.e., one cage per treatment.

Aphid transmission

Adult wingless aphids from tested BRNV-free colonies of Am. idaei and A. idaei were employed in the experiment. Starvation time was determined by not feeding the aphids for various periods of time up to two hours and then offering them a raspberry leaf to observe whether feeding commenced immediately or not using a Lecia MZ72 stereomicroscope. Based on this, the starvation time was set to one hour.

For the virus acquisition phase, aphids were allowed to feed on BRNV-infected leaves for different periods of time: 1 minute, 5 minutes, 1 hour, and 24 hours, with each acquisition group consisting of 13 aphids. Following this feeding period, three aphids were immediately tested for virus acquisition and a group of five aphids were carefully placed on the upper surfaces of each of two BRNV-free raspberry plants of raspberry cv. Ninni. The aphids were then placed for specific inoculation periods, including 5 minutes, 1 hour, 24 hours, and 48 hours (for Am. idaei) or 7 days (for A. idaei) as shown in Fig. 1. The experimental treatments, consisting of 8 combinations of aphid species, acquisition and inoculation time are listed in Table 3.

Table 3

BRNV transmission experiments with two aphid species showing acquisition and inoculation times: min—minutes; h—hour/hours.
Aphid species	Treatment ID	Acquisition period	Inoculation period	No. and type of inoculated plants
Amphorophora idaei	1	1 min.	5 min	Two individual virus-free raspberry plants in each treatment
	2	5 min	1 h
	3	1 h	24 h
	4	24 h	48 h
Aphis idaei	5	1 min	5 min
	6	5 min	1 h
	7	1 h	24 h
	8	24 h	7 days

Data Analysis

Statistical analyses were performed with R-Studio software, using Microsoft Excel for graphical representation. The maps were created using the QGIS 3.24 software. For this purpose, Norway's shape file was obtained from Kartverket, the Norwegian mapping authority. The file was accessed via the following link: https://kartkatalog.geonorge.no/metadata/administrative-enheter-fylker/6093c8a8-fa80-11e6-bc64-92361f002671.

Annual virus occurrence and geographical distribution

In 2019, out of 63 samples tested, 23 were found to be infected with one of the tested viruses. Notably, BRNV dominated with 22 cases, followed by RLMV (4) and RYNV (2). RVCV was detected in only one plant sample. All virus-infected samples were collected in Vestland County, with no occurrences in the other surveyed regions (Fig. 2a).

In 2021, out of 95 tested leaf samples, 72 exhibited infections with one of the tested viruses. Once again, BRNV was predominant, found in 64 out of 95 samples, followed by RLMV (21) and RVCV (6). Interestingly, no instances of RYNV were detected this year. BRNV, RLMV, and RVCV were identified in samples from Vestland County, while BRNV and RVCV were also found in Viken and Agder Counties (Fig. 2b).

In 2022, 83 out of 116 tested leaf samples displayed infection with one of the tested viruses. BRNV maintained its dominance with 79 cases, followed by RLMV (17) and RVCV (15). Additionally, RYNV was detected in 10 plant samples this year. Agder County exhibited the presence of only BRNV and RLMV, while Viken County had solely BRNV (Fig. 2c). All mentioned viruses were identified in Vestland county including RYNV. The overall distribution of mentioned viruses in raspberry cultivars across different Norwegian counties (2019, 2021–2022) were tabulated in Table S1.

Occurrence of single and mixed virus infections

In total, out of 274 collected samples, 178 samples exhibited either sole infection by a single virus or co-infections involving multiple tested viruses (Table 4). Upon analyzing the collective data spanning all three years, a clear pattern emerged, highlighting the substantial prevalence of BRNV, with an infection rate of 93.3% (166 out of 178). BRNV single infection accounted for a noteworthy 63.4% of the total infected samples, with 113 instances. Next in prevalence was mixed infections of BRNV and RLMV, constituting 16.2% of the total infected samples, amounting to 29 cases. In contrast, the single infection rate of the other aphid-borne viruses, namely RLMV, RYNV, and RVCV, was notably low (Table 4). Examining the co-infection dynamics, it was observed that the co-infection rate of BRNV with RLMV remained consistently high. Moreover, the survey unearthed instances of RMD, arising from concurrent infections of BRNV, RLMV, and RYNV. These instances were relatively scarce, constituting only 2.8% of the total infected samples, with a count of 5 cases (Table 4).

Most of the samples infected with BRNV had mosaic and vein clearing symptoms as shown in Fig. 3A while some others had no clear symptoms as in Fig. 3C. Heavily BRNV-infected raspberry cv. Glen Ample plants showed obvious reduced plant vigor with mosaic symptoms on leaves and symptoms spreading gradually to the neighbor plants in both sides (Fig. 3B). The mixture of BRNV with other virus exhibited more intense symptoms (Fig. 3D-G) varying from mosaic, yellowing, leaf curl, dwarf, and leaf malformation symptoms.

Table 4

Presence and incidence of detected raspberry viruses in a total of 274 raspberry samples.
Detected virus	No of RT-PCR positive samples	*Percentage (%) of positive samples in total number of infected samples
BRNV alone	113	63.4
RLMV alone	4	2.2
RYNV alone	3	1.6
RVCV alone	5	2.8
Single virus detected (total)	125	70.2
BRNV + RLMV	29	16.2
BRNV + RYNV	3	1.6
BRNV + RVCV	12	6.7
Co-infection with 2 viruses (total)	44	24.7
BRNV + RLMV + RYNV	5	2.8
BRNV + RLMV + RVCV	3	1.6
Co-infection with 3 viruses (total)	8	4.4
BRNV + RLMV + RYNV + RVCV	1	0.5
Co-infection with 4 viruses (total)	1	0.5
Total number of samples (n) = 274, total infected samples = 178

*Relative occurrence, i.e., percentage derived by dividing the No of RT-PCR positive samples by No of Total infected samples (178).

Virus infection and cultivars

All three cultivated cultivars (‘Glen Ample’, ‘Glen Mor’, and ‘Veten’), along with the “Wild” and the "Others" category, demonstrated infection by at least one of the tested viruses (Fig. 4). Notably, cv. Veten samples exhibited the highest infection rate, with 97% (31 out of 32 samples) infected. Following this, uncultivated raspberry samples (“Wild”) showed an infection rate of 82% (50 out of 61 samples), and cv. Glen Mor of 58% (7 out of 12 samples). ‘Glen Ample’ exhibited a virus infection rate of 56% (70 out of 126 samples), and “Others” 52% (22 out of 42 samples). An analysis of virus infestation prevalence within these cultivars revealed that BRNV dominated across all cultivars (Fig. 5). Notably, RYNV was not detected in the cv. Veten and cv. Glen Mor cultivars.

Aphid species distribution and virus infection

In total, 107 total RNA has been extracted from collected aphid samples and checked with RT-PCR using COI primers before conducting virus diagnostics. Molecular identification of aphid species was performed on 13 and 76 aphid samples from 2021 and 2022, respectively. Specifically, only virus-infected aphids were molecularly identified in 2021, whereas all the COI-positive aphids were identified in 2022. In total, 77 aphids were successfully molecularly identified, with 54 classified as Am. idaei and 23 as A. idaei (Tables 5 and 6). The sequence of the size of 545–674 bp with 99.3–100% identity and 65.3–74.1% coverage was obtained for Am. idaei (NCBI accession no. JF340095; 453bp) (Table 5 and Table S3). The sequence of the size of 580–664 bp with 98.3–99.8% identity and 91.5–100% coverage was obtained for A. idaei (NCBI accession no. KF638947; 658 bp) (Table 5 and Table S3). A sequence of Am. idaei with the size of 633 bp has been submitted to NCBI genebank with the accession no. PP265263.

In total, one or more viruses were found in 27% of the aphid samples and BRNV was most common in both aphid species (Table S2 and Table 6). No aphids were found positive with RVCV or RYNV. In the case of Am. idaei, out of the 54 total samples, 16 were found to be positive with BRNV only, 1 for RLMV only, and 5 for both BRNV and RLMV. Notably, 32 samples were free from the tested viruses. For A. idaei, comprising 23 samples, 6 were positive for BRNV only, 1 for both BRNV and RLMV, and 16 were free from the tested viruses. The overall distribution of the mentioned viruses in all 107 aphid samples collected in 2021 and 2022 are tabulated in Table S2.

Table 5

Molecular identification of aphids by Sanger sequencing with COI primer.
Aphid species	Sequence Size (bp)	Identity (%)	Query cover (%)	Accession (GenBank)
Amphorophora idaei	545–674	99.3–100	65.3–74.1^*	JF340095
Aphis idaei	580–664	98.3–99.8	91.5–100	KF638947
Query coverage ranged from 65.3–74.1% in Am. idaei*. Query coverage is just how much of the primer and quality-trimmed amplicon sequence (545–674 bp) matches up with the shorter reference sequence (i.e., 453 bp). In this case, all of the sample sequence matches upto 99.3–100% with reference sequence (Acession number: JF340095; 453 bp)

Table 6

Virus presence in molecularly identified aphid samples collected from raspberry fields.
Aphid species	Total tested samples	Positive with BRNV only	Positive with RLMV only	Positive with BRNV and RLMV	Total Positive sample	Negative from tested viruses
Amphorophora idaei	54	16	1	5	22	32
Aphis idaei	23	6	0	1	7	16

Transmission assay

The aphid cultures underwent initial screening for BRNV using RT-PCR, confirming their BRNV-free status. When feeding aphids with BRNV-infected raspberry leaves for 1 minute, 5 minutes, 1 hour, or 24 hours. Am. idaei consistently acquired BRNV and tested positive for BRNV in all the examined acquistion periods (Fig. 6). Conversely, A. idaei aphids did not acquire BRNV after 1 min and 5 min (tested negative for BRNV), but demonstrated BRNV acquistion after 1 hour and 24 hours (tested positive for BRNV) (Fig. 6). Notably, all BRNV-positive Am. idaei aphids tested negative for plant internal nad control, ruling out the presence of plant debris inside the aphids. However, A. idaei were positive for plant internal nad control after 24 hours of acquisition, but tested negative after 1 hours of acquistion (Fig. 7), suggesting uncertainty in BRNV acquisition by A. idaei.

Subsequent testing of all inoculated plants for BRNV using RT-PCR, conducted two months after inoculation, revealed that none of the raspberry plants inoculated with A. idaei tested was positive for BRNV. In contrast, three raspberry plants inoculated with Am. idaei were positive for BRNV: two plants from 1- hour inoculation time and one plant from 48 hours (Fig. 8, Table 7).

Table 7

Summary of results from BRNV transmission assay with two aphid species. “Pos.” means RT-PCR positive result and “Neg.” means RT-PCR negative result.
Aphid species	Acquisition period	RT-PCR test of aphid after acquisition	Inoculation period	RT-PCR test of plants after inoculation	Number of infected plants
Amphorophora idaei	1 min.	Pos.	5 min	Neg.	0/2
	5 min	Pos.	1 h	Pos.	2/2
	1 h	Pos.	24 h	Neg.	0/2
	24 hr	Pos.	48 h	Pos.	1/2
Aphis idaei	1 min	Neg.	5 min	Neg.	0/2
	5 min	Neg.	1 h	Neg.	0/2
	1 h	Pos.	24 h	Neg.	0/2
	24 h	Pos.	7 days	Neg.	0/2

Overview of virus occurrence and distribution in plants and aphids

In this investigation, our focus was on detecting four aphid-transmitted raspberry viruses. BRNV was the most common virus found in plant as well as aphid samples. The predominance of BRNV might be attributed to its efficient transmission by the aphid vector, Am. idaei, which acquires and transmits the virus to healthy plants within minutes (Stace-Smith, 1955b). In contrast, RLMV and RYNV exhibit longer acquisition and inoculation times in Am. idaei, and the same is the case for RVCV in A. idaei (McMenemy et al., 2009; Stace-Smith, 1955a; Stace-Smith, 1961). The high incidence of BRNV in raspberry growing area in Norway is corresponding to the previous survey in Finland (Susi et al., 2018).

Our study revealed a higher percentage of co-infection occurrence of BRNV and RLMV both in plants and aphids, a trend aligning with reports of common co-infections in Europe (Converse, 1987). This co-infection is facilitated by the shared aphid vector and potentially also an attraction of the aphid vector to virus-infected plants within a short time window (McMenemy et al., 2012). Moreover, high co-infection rates are to be expected when mainly symptomatic plants are sampled, because BRNV, when found as a single infection, typically does not present symptoms on red raspberry (Jones & Jennings, 1980; Stace-Smith, 1955b). However, the high incidence of BRNV single infections in our study (41% of all our leaf samples) points to a presence of symptoms, and we observed mosaic and vein clearing symptoms on most of the Glen Ample leaf samples with BRNV single infection. None of these samples were infected with raspberry bushy dwarf virus and raspberry leaf blotch virus, either. To fulfill Koch's postulates, transmission of BRNV to virus-free Glen Ample plants to induce similar symptoms should be further pursued. When BRNV was present with other examined viruses i.e., as co-infections, the resulting symptoms were distinctive (Fig. 3), as reported in earlier literature (Martin et al., 2013).

Virus infection and cultivars

Among the surveyed raspberry cultivars, ‘Veten’ exhibited the highest virus infection rate, followed by “wild” raspberries found in the semi-natural vegetation that frequently adjoins Norwegian raspberry crops. ‘Veten’ was prominent in Norway's raspberry industry for over 30 years, primarily grown for industrial use. However, over the past two decades, it has been replaced by ‘Glen Ample’ (Heiberg et al., 2001), a cultivar with a specific resistance gene, A1, which to a certain extent provides it with a defense against the important virus vector Am. idaei (McMenemy et al., 2009). This shift in cultivars must have forced Am. idaei populations to prefer the few ‘Veten’ crops left or remain on wild raspberry, resulting in an accumulation of virus infection in these plants. The proliferation of viral infections in “wild” raspberry is a point of concern. These plants may act as viral reservoirs for both pollen-transmitted raspberry viruses like raspberry bushy dwarf virus (not included in this study) and aphid-borne viruses like BRNV (Susi et al., 2018).

The presence of aphid-borne virus in more than half the leaf samples of the two cultivars with a certain resistance to Am. idaei, ‘Glen Ample’ and ‘Glen Mor’, emphasizes the importance of continuous monitoring to mitigate the risk of widespread viral transmission in resistant cultivars as well, and to avoid basing the virus management on one method alone. Am. idaei has been found on ‘Glen Ample’ in Norway since 2015 (Trandem et al., 2015) and was also found in this study, indeed, Am. idaei for the transmission experiments was reared on ‘Glen Ample’ without problems. Our study thus aligns with McMenemy et al. (2009), who reported that the Am. idaei resistance conferred by the A1 gene had been broadly overcome by other biotypes of the aphid in Scotland, resulting in a notable surge in the occurrence of viruses transmitted by this vector. Two of the viruses known to be transferred by Am. idaei, BRNV and RLMV, were also found on newly established ‘Glen Mor’ plants with no obvious virus-like symptoms in our study. However, as the sample size was low and no Am. idaei was collected on these plants, we do not know if the viruses came with the planting materials or transmitted by aphids after planting.

Aphid species and BRNV transmission assay

Eight different aphids have been reported sucking on raspberries and transmitting different viruses, i.e., Am. idaei, Am. rubi, Am. agathonica, A. idaei, A. rubicola, Macrosiphu euphorbiae, Sitobion. fragariae, and Myzus. ornatus (Tan et al., 2022). Two of them i.e., Am. idaei and A. idaei, were molecularly identified in this study. This result showed the dominance of Am. idaei and A. idaei in Norwegian raspberry; they are by far the two most common aphids in European raspberry (Gordon et al 1997; McMenemy et al. (2009). The absence of the other six aphids in our samples can be explainable: Am. rubi is typically associated with blackberry (Alford, 2007), Am. agathonica and A. rubicola are specific in North America (Blackman & Eastop, 2000; Martin et al., 2013) and the others have alternative hosts and are only occasionally observed on raspberry plants (Gordon et al., 1997; Tan et al., 2022).

In the transmission experiments, we found that Am. idaei can acquire and transmit BRNV within a remarkably short period, one minute for acquisition and within one hour for inoculation. These results correspond with the earlier research of Stace-Smith (1955b), who observed that this aphid required 15 minutes for virus acquisition and around 2 minutes for transmission. Such behavior was reviewed and classified as a semi-persistent type of virus transmission by McMenemy et al. (2009) and was partially observed in our experiment, although the acquisition time in our study was notably shorter, within 1 minute. This discrepancy in acquisition time could be due to the sensitivity of our RT-PCR methodology, which can detect lower virus concentrations than the traditional indicator-plant based methods used by Stace-Smith (1955b). Furthermore, our experiments revealed that virus transmission was not observed within 5 minutes but only became apparent after 1 hour. It is crucial to recognize that aphid behavior significantly influences transmission rates, and transmission is not always guaranteed, as noted by Stace-Smith (1955b). Additionally, the limited sample size in our study, with only 2 plants per treatment, may have contributed to the absence of observed transmission within the 5-minute inoculation period.

For the transmission experiment with A. idaei, the aphids acquired BRNV within 1 hour, but transmission to healthy raspberry plants could not be confirmed. The virus uptake by the aphid could be through the gut region or hemocoel, whereas transmission is likely hindered by multiple barriers (Lightle et al., 2012). For persistent or circulative mode of transmission, the virus must be retained in the aphid's salivary gland and for non-persistent transmission, it would require a certain level of specificity, such as protein interactions, for the virus to bind to the aphid's stylet (Abhinash et al., 2023; Lightle et al., 2012). In our case, the virus may not be able to reach the salivary glands which should be investigated comprehensively to fully understand the underlying mechanisms of transmission.

Our study focused on the occurrence and distribution of aphid transmitted viruses on various raspberry cultivars in Norway. The results consistently identified BRNV as the most prevalent virus across all year, constituting 93% of total infected samples. Notably, BRNV was most common as a single infection, followed by mixed infection with RLMV, which is the second most prevalent virus. Other viruses like RVCV and RYNV were considerably less common. Observation revealed distinct mosaic patterns and vein clearing symptoms with BRNV single infection that intensified in co-infections with other viruses. This information could assist farmers in early detection of viral infections.

Virus identification in aphid samples and transmission experiments further elucidated the dynamics of BRNV with aphids. A. idaei demonstrated the ability to acquire BRNV within an hour but did not transmit it, in contrast to Am. idaei, which rapidly acquired and transmitted the virus within the same timeframe. These findings highlight the intricate nature of aphid-virus interactions and emphasize the urgent need for effective management practices. The observed infection rates across different cultivars underscore the necessity for enhanced surveillance and the adoption of virus-free plant materials as a crucial management strategy. Our study lays a foundation for future research and development of integrated control measures, ensuring the sustainability of raspberry production in the face of evolving viral threats and changing climatic conditions.

Supplementary Materials: The supplementary materials include three detailed tables that augment the findings presented in the main text.

S1: Annual distribution of aphid-transmitted virus infections in raspberry cultivars across Norwegian counties (2019, 2021 and 2022).

S2: Annual distribution of aphid-transmitted virus infections in aphids across Norwegian counties (2019 and 2021).

S3: Molecular identification of aphids collected in two consecutive years (2021 and 2022) by Sanger sequencing with COI primer.

Author Contributions: Conceptualization, Z.H. and D.R.B; methodology, B.S. and Z.H.; software, B.S. and Z.H.; validation, B.S. and Z.H.; formal analysis, B.S. and Z.H.; investigation, B.S., D.R.B., N.T., Z.H.; data curation, B.S. and Z.H.; writing—original draft preparation, B.S. and Z.H.; writing—review and editing, B.S., D.R.B., N.T., J.F., I.K., Z.H.; visualization, B.S. and Z.H.; supervision, D.R.B., N.T., Z.H.; project administration, J.F., D.R.B and Z.H.; funding acquisition, J.F., I.K., D.R.B. and Z.H.. All authors have read and agreed to the published version of the manuscript.

Funding: The research leading to these results has received funding from the EEA Grants and the Technology Agency of the Czech Republic within the KAPPA Programme (TO01000295).

Acknowledgments: The authors would like to thank Division of Biotechnology and Plant Health, Norwegian Institute of Bioeconomy Research (NIBIO) for internal financial support. We thank extension officer from Norwegian Agriculture Extension Service (Norsk Landbruksrådgiving SA, NLR) for sample collections. We also thank Dr. Stuart MacFarlane from James Hutton Institute for providing the source of positive controls grown within NIBIO´s greenhouse facilities.

Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abhinash, B., Shreya, K., Markad Ajinkya, B., Meenakshi, R., & Seweta, S. (2023). Mechanism of arthropod-mediated transmission of plant viruses - A Review. Journal of Advanced Zoology, 44(S6), 38-52. https://doi.org/10.17762/jaz.v44is6.1960
Alford, D. V. (2007). Pests of fruit crops: a color handbook. Elsevier.
Blackman, R. L., & Eastop, V. F. (2000). Aphids on the world's crops: an identification and information guide. John Wiley & Sons Ltd.
Bøthun, M., & Heiberg, N. (2004). Satsing på økologisk bringebær (Production of organic raspberries in Norway) Norsk Frukt og bær 7(4), 16-18.
Converse, R. H. (1963). Influence of heat-labile components of the raspberry mosaic complex on growth and yield of red raspberries. Phytopathology, 53(1251-1254), 1.
Converse, R. H. (1987). Virus diseases of small fruits. United States Department of Agriculture, Agricultural Research Service.
Dietzgen, R., Mann, K., & Johnson, K. (2016). Plant virus–insect vector interactions: current and potential future research directions. Viruses, 8(11), 303. https://doi.org/10.3390/v8110303
FAO. (2022). FAOSTAT statistical database.
Folmer, O., Hoeh, W., Black, M., & Vrijenhoek, R. (1994). Conserved primers for PCR amplification of mitochondrial DNA from different invertebrate phyla. Molecular Marine Biology and Biotechnology, 3(5), 294-299.
Fotirić Akšić, M., Nešović, M., Ćirić, I., Tešić, Ž., Pezo, L., Tosti, T., Gašić, U., Dojčinović, B., Lončar, B., & Meland, M. (2022). Chemical fruit profiles of different raspberry cultivars grown in specific Norwegian agroclimatic conditions. Horticulturae, 8(9), 765.
Freeman, J., & Stace-Smith, R. (1970). Effects of raspberry mosaic viruses on yield and growth of red raspberries. Canadian Journal of Plant Science, 50(5), 521-527.
Gordon, S., Woodford, J., & Birch, A. (1997). Arthropod pests of Rubus in Europe: pest status, current and future control strategies. Journal of Horticultural Science, 72(6), 831-862.
Haffner, K., Rosenfeld, H. J., Skrede, G., & Wang, L. (2002). Quality of red raspberry Rubus idaeus L. cultivars after storage in controlled and normal atmospheres. Postharvest Biology and Technology, 24(3), 279-289.
Heiberg, N., Standal, R., & Måge, F. (2001). Evaluation of red raspberry cultivars in Norway. VIII International Rubus and Ribes Symposium, 585.
Jones, A., & Jennings, D. (1980). Genetic control of the reactions of raspberry to black raspberry necrosis, raspberry leaf mottle and raspberry leaf spot viruses. Annals of Applied Biology, 96(1), 59-65.
Jones, A. T., McGavin, W. J., Geering, A. D. W., & Lockhart, B. E. L. (2002). Identification of Rubus yellow net virus as a distinct badnavirus and its detection by PCR in Rubus species and in aphids. Annals of Applied Biology, 141(1), 1-10. https://doi.org/10.1111/j.1744-7348.2002.tb00189.x
Jones, S., McGavin, W., & MacFarlane, S. (2019). The complete sequences of two divergent variants of the rhabdovirus raspberry vein chlorosis virus and the design of improved primers for virus detection. Virus Research, 265, 162-165.
Koloniuk, I., Fránová, J., Přibylová, J., Sarkisova, T., Špak, J., Tan, J. L., Zemek, R., Čmejla, R., Rejlová, M., Valentová, L., Sedlák, J., Holub, J., Skalík, J., Blystad, D.-R., Sapkota, B., & Hamborg, Z. (2023). Molecular characterization of a novel Enamovirus infecting raspberry. Viruses, 15(12), 2281. https://doi.org/10.3390/v15122281
Lightle, D. M., Dossett, M., Backus, E. A., & Lee, J. C. (2012). Location of the mechanism of resistance to Amphorophora agathonica (Hemiptera: Aphididae) in red raspberry. Journal of Economic Entomology, 105(4), 1465-1470. https://doi.org/10.1603/ec11405
Martin, R. R., MacFarlane, S., Sabanadzovic, S., Quito, D., Poudel, B., & Tzanetakis, I. E. (2013). Viruses and virus diseases of Rubus. Plant Disease, 97(2), 168-182.
McGavin, W., McMenemy, L., & MacFarlane, S. (2010). The complete sequence of a UK strain of black raspberry necrosis virus. Archives of virology, 155(11), 1897-1899.
McMenemy, L. S., Hartley, S. E., MacFarlane, S. A., Karley, A. J., Shepherd, T., & Johnson, S. N. (2012). Raspberry viruses manipulate the behaviour of their insect vectors. Entomologia Experimentalis et Applicata, 144(1), 56-68.
McMenemy, L. S., Mitchell, C., & Johnson, S. N. (2009). Biology of the European large raspberry aphid (Amphorophora idaei): its role in virus transmission and resistance breakdown in red raspberry. Agricultural and Forest Entomology, 11(1), 61-71. https://doi.org/10.1111/j.1461-9563.2008.00409.x
Menzel, W., Jelkmann, W., & Maiss, E. (2002). Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods, 99(1-2), 81-92.
Stace-Smith, R. (1955a). Studies on Rubus virus diseases in British Columbia: I. Rubus yellow-net. Canadian Journal of Botany, 33(3), 269-274.
Stace-Smith, R. (1955b). Studies on Rubus Virus Diseases in British Columbia: II. Black raspberry necrosis. Canadian Journal of Botany, 33(4), 314-322.
Stace-Smith, R. (1961). Studies on Rubus virus diseases in British Columbia: vii. Raspberry vein chlorosis. Canadian Journal of Botany, 39(3), 559-565.
Susi, H., Rajamäki, M. L., Artola, K., Jayaraj‐Mallika, F. R., & Valkonen, J. P. T. (2018). Molecular detection and characterisation of black raspberry necrosis virus and raspberry bushy dwarf virus isolates in wild raspberries. Annals of Applied Biology, 173(2), 97-111. https://doi.org/10.1111/aab.12438
Tan, J. L., Trandem, N., Fránová, J., Hamborg, Z., Blystad, D.-R., & Zemek, R. (2022). Known and potential invertebrate vectors of raspberry viruses. Viruses, 14(3), 571. https://doi.org/10.3390/v14030571
Tatineni, S., & Hein, G. L. (2023). Plant viruses of agricultural importance: current and future perspectives of virus disease management strategies. Phytopathology, 113(2), 117-141. https://doi.org/10.1094/phyto-05-22-0167-rvw
Trandem, N., Eklo, T., & Vintland, A. (2015). Stor bringebærbladlus (Amphorophora idaei) oppdaget I ‘Glen Ample’. Norsk Frukt og bær, 18(4), 13.
Tzanetakis, I. E., Halgren, A., Mosier, N., & Martin, R. R. (2007). Identification and characterization of raspberry mottle virus, a novel member of the Closteroviridae. Virus Research, 127(1), 26-33.

Supplementaryvsersion3.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Incidence of aphid-transmitted viruses in raspberry and raspberry aphids in Norway and experiments on aphid transmission of black raspberry necrosis virus (BRNV)

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Field survey and sample collection

RNA Extraction

RT-PCR and Sanger sequencing

Aphid cultures

Aphid transmission

Data Analysis

Results

Annual virus occurrence and geographical distribution

Occurrence of single and mixed virus infections

Virus infection and cultivars

Aphid species distribution and virus infection

Transmission assay

Discussion

Overview of virus occurrence and distribution in plants and aphids

Virus infection and cultivars

Aphid species and BRNV transmission assay

Conclusion

Declarations

References

Supplementary Files

Status:

Version 1