Identification of maternal risk factors for having Down syndrome cases in Jordan

doi:10.21203/rs.3.rs-3962121/v1

Download PDF

Research Article

Identification of maternal risk factors for having Down syndrome cases in Jordan

https://doi.org/10.21203/rs.3.rs-3962121/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Down syndrome (DS) is the leading cause of intellectual disability, yet the factors contributing to its occurrence remain largely unknown. In this study, we investigated the genetic influence of the C677T variant in the methylenetetrahydrofolate reductase (MTHFR) gene, alongside maternal age, family history, and miscarriages, on the development of DS. Our findings indicate that the presence of the C677T CT and TT genotypes in the MTHFR gene were associated with a 1.9-fold and 3.4-fold increased risk of DS, respectively, compared to controls. Furthermore, advanced maternal age, family history of DS, and particularly a history of miscarriages were found to significantly elevate the risk of DS. These results highlights the genetic and environmental factors contributing to DS and emphasize the importance of understanding these factors for effective prevention and management strategies.

Down syndrome

aneuploidy

trisomy 21

MTHFR

maternal risk factors

Trisomy 21, commonly known as Down syndrome (DS), is a chromosomal abnormality characterized by the presence of an extra copy of chromosome number 21. It is the most prevalent genetic cause of neurodevelopmental disorders in humans and primarily arises from chromosomal nondisjunction during meiosis (Hultén et al., 2008; Nagaoka et al., 2012a).

The global prevalence of DS is approximately 1 in 1000 live births each year (Weijerman & De Winter, 2010). In the Arab world, the frequency of DS has been reported as 1.9 in 1000 live births in Libya in 1985 (Verma et al., 1990), 2.2 in 1000 live births in Dubai, and 3.13 in 1000 live births among UAE nationals for the years 1999 to 2003 (Murthy et al., 2006). However, DS birth rates have been decreasing overall, primarily due to prenatal genetic testing (Huete-García & Otaola-Barranquero, 2021).

Meiotic nondisjunction, the failure of normal chromosome segregation during meiosis, is a leading cause of reproductive complications in humans, including infertility, spontaneous abortion, and birth disorders (Jones & Lane, 2013; Mikwar et al., 2020) The majority of aneuploid embryos do not survive until birth, with only a small percentage resulting in live births (Fragouli et al., 2013; Nagaoka et al., 2012b). Trisomy 21 is the most common type of aneuploidy among live-born infants (Hassold & Hunt, 2007; Hunt & Hassold, 2008; Jones, 2008; Karmiloff-Smith et al., 2016; Oliver et al., 2008; Petersen et al., 1993).

Studies have demonstrated that the origin of the extra copy of chromosome 21 in DS is maternal in more than 88% of cases, while less than 10% are of paternal origin, and approximately 3% occur after fertilization (Hunt & Hassold, 2008; Jones, 2008; Karmiloff-Smith et al., 2016; Oliver et al., 2008; Petersen et al., 1993). Multiple paternal and maternal factors influence the likelihood of DS births. Paternal risk factors are relatively limited and primarily associated with lifestyle choices. Factors such as obesity, low folate intake, a fat-rich diet, and exposure to pyrethroid insecticides and air pollutants have been linked to an increased rate of disomy of chromosome 21 in sperm (Coppedè, 2016; Jurewicz et al., 2014, 2016; Moura & Houten, 2010; Radwan et al., 2015; Young et al., 2008)

Maternal risk factors, on the other hand, are more complex and diverse. This may be attributed to the long period of oogenesis, during which primordial oocytes enter meiosis I around 10–13 weeks of pregnancy during fetal development in the grandmother's body and then arrest in prophase I until ovulation. Meiosis II is completed only after fertilization (Rowsey et al., 2013). Consequently, the lifestyle of the grandmother may also play a role in DS grand-offspring births (Coppedè, 2016). Advanced maternal age has been consistently linked to DS births in various populations (Morris et al., 2003a). Other factors, including maternal lifestyle, pregnancy weight, exposure to radiation, and the use of contraceptive pills, have also been considered as potential influences (Coppedè, 2016)

Aberrant DNA methylation has been associated with various human diseases, including malignancies, heart diseases, neurological disorders, infertility, and birth defects (Momparler and Bovenzi, 2000; Ebisch et al., 2007; Douglas Wilson et al., 2015; Fernández-Sanlés et al., 2017; Salemi et al., 2017; Cui and Xu, 2018). Folate metabolism plays a crucial role in DNA methylation and in the synthesis and repair of DNA and RNA. Folate serves as a methyl donor, which is essential for proper chromosome segregation (Crider et al., 2012a; Lan et al., 2018; Nazki et al., 2014).

Abnormal folate metabolism resulting from mutations in the methylenetetrahydrofolatereductase (MTHFR) gene in females has been associated with an increased risk of DS births and has been extensively studied as a maternal risk factor for DS births ((Medica et al., 2009; Rai et al., 2014)James et al., 1999). The MTHFR gene regulates folate metabolism, it mediates the irreversible conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate (5-MTHF). 5-MTHF is the biologically active form of folate, which plays a vital role as methyl group donor in the enzymatic methylation of homocysteine, promoting its conversion into methionine. This methylation process is essential for biochemical reactions and cellular functioning (Rai et al., 2014).. Several studies have demonstrated a reduction in MTHFR enzyme activity due to single nucleotide polymorphisms (SNPs) within the MTHFR gene, which are associated with DNA global hypomethylation and increased levels of homocysteine (Balarin et al., 2017; Bucerzan et al., 2017a; Jiajin et al., 2019).

In this study, we aimed to identify maternal risk factors associated with DS births in Jordan, by investigating the genetic variant rs1801133 (C677T) within the MTHFR gene, we can gain insights into its relationship with DS and contribute to our understanding of the maternal factors influencing DS occurrence in the Jordanian population.

Sample Selection

The study participants were recruited from Princess Rahma Hospital, Prince Hamza Hospital, and Jasmine Society for Children with Down Syndrome in Jordan. The case group consisted of 85 mothers who had given birth to children with Down syndrome (DS). Inclusion criteria for the case group included mothers aged less than 40 at the time of delivery and having a child with a confirmed diagnosis of Trisomy 21. Mothers with siblings with Down syndrome, mosaic Down syndrome, and Robertsonian translocation Down syndrome were excluded from the study. Mothers with known exposure to chemicals or radiation were also excluded. The control group comprised 118 newly delivered mothers aged less than 40 from Princess Badea’a Hospital, and their babies were confirmed to be normal and healthy after a medical examination. The study was approved by the institutional review board at Jordan University of Science and Technology and King Abdullah University Hospital (Approval # 2016/98/10). Written consents were obtained from all participants.

Karyotype and Genotype Analysis

Karyotyping was performed at the cytogenetic laboratory at King Abdullah University Hospital using the standard protocol. Blood samples were collected from subjects in EDTA tubes, and DNA was isolated using the Puregene Blood Core Kit B (Qiagen). The purity and concentration of DNA were quantified using the NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). For genotype analysis, conventional polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) analysis was performed for the C677T single nucleotide polymorphism (SNP) in the MTHFR gene. Primers were synthesized, and PCR amplifications and RFLP (Table 1) were carried out using the FIREPol master mix (Solis BioDyne) and HinfI restriction enzyme (New England Biolabs), respectively. The size of the PCR and RFLP products was confirmed by agarose gel electrophoresis and visualized using the GelDoc-It 310 imaging system (UVP). Genotype variations were confirmed by Sanger sequencing (Macrogen, South Korea).

Table 1

Primer set and restriction enzyme for C677T SNP
RS #	Variation	Primer sequence (5’-3’)	PCR size	T_m	R.E	RFLP sizes
						C	T
rs1801133	C677T	F:TGAAGG AGAAGGTGTCTGCGGGA	198	62	HinfI	198bp	175 + 23bp
		R:AGGACGGTGCGGTGAGAGTG
RS #: Reference Single nucleotide polymorphism cluster ID
T_m: melting temperature
R.E: restriction enzyme
RFLP: restriction fragment length polymorphism

Statistical Analysis

All statistical calculations were performed using GraphPad Prism software version 8.4.1. The chi-square test was used to calculate p-values, with a significance level of < 0.05. Means were presented as mean ± standard deviation (SD), and the student's t-test was used to determine significant differences between means after confirming normality. Additionally, odds ratios and relative risks were calculated for each comparison group to evaluate the association between each risk factor and the likelihood of conceiving children with Down syndrome.

1- The C677T variant in the MTHFR gene increases the risk of conceiving a DS child

We investigated the association between the C677T variant in the MTHFR gene and the risk of conceiving a child with Down syndrome (DS). In the control group, 56.77% were homozygous for the wild-type allele (CC), 37.28% were heterozygous (CT), and 5.93% were homozygous for the variant allele (TT). In the DS cases, the heterozygous genotype (CT) had the highest frequency (47.05%), followed by the wild-type homozygous genotype (CC) at 38.82%, and the variant homozygous genotype (TT) at 14.11% (Table 2). The genotype frequencies were consistent with Hardy-Weinberg equilibrium in both the control group (P-value = 0.9980) and the DS cases (P-value = 0.9998). The odds of having the CT genotype compared to the CC genotype were 1.9 times higher in the cases than in the controls, and this difference was statistically significant (p = 0.039). Additionally, the odds of having the TT genotype were 3.4 times higher in the cases compared to the controls (p = 0.02).

Table 2

The genotypic and allelic distribution of the C677T locus in the *MTHFR* gene in the DS cases and controls
Genotype	Control group	DS group	Odds ratio (95%CI)	P-Value
Genotype	Frequency (%)	Frequency (%)	Odds ratio (95%CI)	P-Value
N	118	85
CC	67 (56.77%)	33 (38.82%)
CT	44 (37.28%)	40 (47.05%)	1.9 (1.21–9.74)	0.039^*
TT	7 (5.93%)	12 (14.11%)	3.4 (1.03–3.39)	0.020^*
C	75.42%	62.35%	1.839 (1-3.338)	0.049^*
T	24.57%	37.64%	1.839 (1-3.338)	0.049^*
N: Number of samples
^: statistical significant value, P-value < 0.05*

2- Maternal age, previous miscarriages, and family history increase the risk of conceiving a DS child

We examined the influence of maternal age on the incidence of DS. The mean age of DS cases was 30.86 ± 5.97, while in the control group, it was 28.10 ± 6.92. There was a significant difference in mean age between the two groups (P = 0.0034) (Table 3). We categorized the samples into two groups based on age: older females (35 years and above) and younger females (below 35). Older females were nearly twice as likely to have a child with DS compared to younger females (odds ratio = 2.4, 95% CI = 1.2578 to 4.5718, P = 0.0079). Furthermore, we investigated the association between previous miscarriages and the risk of conceiving a child with DS. Interestingly, having a previous miscarriage was associated with a nearly 12-fold increase in the likelihood of having a child with DS compared to those without previous miscarriages (odds ratio = 11.82, 95% CI = 4.7319 to 29.5191, P = 0.0001) (Table 3). Lastly, we observed a strong correlation between having one or more children with DS in the family and the risk of conceiving a child with DS. Parents with a known family history of DS were nearly six times more likely to have a child with DS compared to parents without a family history of DS (odds ratio = 6.093, 95% CI = 2.3951 to 15.4981, P = 0.0001) (Table 3).

Table 3

Clinical characteristics and risk factors of mothers of Down syndrome children and controls
Risk factor		Controls	Cases	Odd ratio (95% CI)	Relative risk	P-value
Family history	Without family history	94	72	6.093 (2.42–14.74)	3.209 (1.66–6.85)	0.0001^*
Family history	With family history	6	28	6.093 (2.42–14.74)	3.209 (1.66–6.85)	0.0001^*
Mother age	Mean maternal age ± SD	28.10 ± 6.92	30.86 ± 5.97	-	-	0.0039^*
	< 35	81	64	2.398 (1.28–4.53)	1.617 (1.12–2.44)	0.0109^*
	> 35	19	36	2.398 (1.28–4.53)	1.617 (1.12–2.44)	0.0109^*
Previous Miscarriages	No history of miscarriages	94	57	11.82 (4.94–27.7)	5.084 (2.53–10.9)	0.0001^*
Previous Miscarriages	With a history of miscarriages	6	43	11.82 (4.94–27.7)	5.084 (2.53–10.9)	0.0001^*
*: statistical significant value, P-value < 0.05
SD: standard deviation
CI: confidence interval

Down syndrome is the most common form of mental retardation, and it has a high incidence among different populations. It results because of meiotic or mitotic non-disjunction, while the causes or the risk factors for such abnormalities are not fully understood yet. This study aimed to assess the impact of the genetic variant C677T in the MTHFR gene on the risk of conceiving a child with Down syndrome (DS). Additionally, other factors such as the influence of maternal age, previous miscarriages, and family history were also studied.

Regarding the genetic variant C677T in the MTHFR gene, the results showed a different distribution of genotypic and allelic frequencies between the control group and DS cases. Furthermore, the CT genotype was 1.9 times higher than the CC genotype in DS cases compared to controls, while the TT genotype was 3.4 times higher in DS cases. These findings suggest that the MTHFR C677T variant may be associated with an increased risk of conceiving a child with DS. Our results are consistent with previous results which established an association between the maternal MTHFR C677T polymorphism and the risk of giving birth to a child with DS (Czechowicz et al., 2020; Meguid et al., 2008; Rai et al., 2014; Sadiq et al., 2011). Folic acid plays a crucial role in various functions, including DNA global methylation, and MTHFR is a significant enzyme in folic acid metabolism (Crider et al., 2012). MTHFR C677T is one of the polymorphisms that lead to dramatic elevation in folate deficiency (Li et al., 2015). Furthermore, MTHFR C677T polymorphism is associated with total homocysteine raising in pregnant women (Barbosa et al., 2008). Given together, it is reasonable to hypothesize that a combination of folic acid deficiency and the presence of the C677T variant could synergistically increase the risk of DS in Jordanian women. As a result, we propose that gynecologists contemplate the adoption of a clinical approach involving the recommendation of active folate form (5-MTHF), as the preferred supplementation strategy for women in the preconception and pregnancy stages. This recommendation is made considering the potential advantages of avoiding complications related to folate metabolism, particularly in MTHFR polymorphism cases. In addition, consider routinely assessing folic acid levels and the C677T variant in pregnancies at high risk for DS. However, further research and consensus within the medical community are needed to confirm and establish this as a standard practice.

Next, we examined the influence of maternal age on the incidence of DS. Although the mean age of DS cases (30.86 ± 5.97) was slightly higher than that of controls (28.10 ± 6.92), the difference was statistically significant. Interestingly, when comparing age categories, we found that older females (35 years and above) were approximately 2 times more likely to have a child with DS compared to younger females (below 35 years). This result is supported by previous findings indicating an increased risk of DS with advancing maternal age (Morris et al., 2003b; Musdalipa et al., 2021).

Furthermore, this study examined the impact of previous miscarriages on the risk of conceiving a child with DS. Interestingly, individuals who had experienced previous miscarriages were approximately 12 times more likely to have a child with DS compared to those without a history of miscarriage. This finding highlights the influence of chromosomal abnormalities on the incidence of miscarriages and DS and might be used as a useful factor to predict the re-occurrence of DS in the family (Bianco et al., 2006; Corona-Rivera et al., 2019; Stipoljev et al., 2019).

Finally, we studied the association between the family history of DS and the risk of conceiving a child with DS. Remarkably, parents with a known family history of DS were approximately 6 times more likely to have a child with DS compared to parents without a family history. The result aligns with previous studies that have found an increased risk of a family history of DS and conceiving a child with DS (Corona-Rivera et al., 2019; Huete-García & Otaola-Barranquero, 2021; Stipoljev et al., 2019). This indicates that the familial factor plays an important role in the occurrence of DS, demonstrating a potential genetic susceptibility.

There are some limitations of this study. The sample size was not relatively high, which may have influenced the statistical power of the findings. Furthermore, factors that might affect the incidence of DS such as; environmental factors, paternal-related factors, and additional genetic variants were not evaluated in this study.

In conclusion, our results identified that the maternal factors of the C677T variant in the MTHFR gene and advanced maternal age are associated with an increased risk of DS. Furthermore, previous miscarriages, and a family history of DS might also increase the risk of having a child with DS. These findings enhance our understanding of the genetic and non-genetic factors involved in the etiology of DS. Further research with larger sample sizes and more comprehensive studies is necessary to validate and expand upon these findings, ultimately improving our ability to assess the risk and provide appropriate interventions for families affected by DS.

DS: Down syndrome MTHFR: methylenetetrahydrofolatereductase

5-MTHF: 5-methyltetrahydrofolate SNP: single nucleotide polymorphisms

RFLP: restriction fragment length polymorphism SD: standard deviation

The authors declare no competing or financial interests

Acknowledgements

We thank the deanship of research at Jordan University of Science and Technology for financing this study by grant # 20160261.

Author contribution

OB and NAA conceived and designed research, NAA and HH conducted experiments, RM helped in samples’ recruitment and filling the questionnaires. MA and EA analyzed data. OB and NAA wrote the manuscript. All authors read and approved the manuscript

Conflict of interest

The authors declare no competing interests

Bianco, K., Caughey, A. B., Shaffer, B. L., Davis, R., & Norton, M. E. (2006). History of miscarriage and increased incidence of fetal aneuploidy in subsequent pregnancy. Obstetrics and Gynecology, 107(5). https://doi.org/10.1097/01.AOG.0000215560.86673.22
Coppedè, F. (2016). Risk factors for Down syndrome. Archives of Toxicology, 90(12), 2917–2929. https://doi.org/10.1007/s00204-016-1843-3
Corona-Rivera, J. R., Martínez‐Macías, F. J., Bobadilla‐Morales, L., Corona‐Rivera, A., Peña‐Padilla, C., Rios‐Flores, I. M., Flores‐Guevara, P. A., Orozco‐Vela, M., Aranda‐Sánchez, C. I., & Brukman‐Jiménez, S. A. (2019). Prevalence and risk factors for Down syndrome: A hospital‐based single‐center study in Western Mexico. American Journal of Medical Genetics Part A, 179(3), 435–441. https://doi.org/10.1002/ajmg.a.61044
Czechowicz, P., Małodobra-Mazur, M., Lebioda, A., Jonkisz, A., Dobosz, T., & Śmigiel, R. (2020). Polymorphisms of the MTHFR gene in mothers of children with trisomy 21 (Down syndrome) in a Polish population. Advances in Clinical and Experimental Medicine. https://doi.org/10.17219/acem/115078
Fragouli, E., Alfarawati, S., Spath, K., Jaroudi, S., Sarasa, J., Enciso, M., & Wells, D. (2013). The origin and impact of embryonic aneuploidy. Human Genetics, 132(9), 1001–1013. https://doi.org/10.1007/s00439-013-1309-0
Hassold, T., & Hunt, P. (2007). Rescuing distal crossovers Adaptive drool in the gene pool. 39(10), 1187–1192.
Huete-García, A., & Otaola-Barranquero, M. (2021). Demographic assessment of down syndrome: A systematic review. In International Journal of Environmental Research and Public Health (Vol. 18, Issue 1). https://doi.org/10.3390/ijerph18010352
Hultén, M. A., Patel, S. D., Tankimanova, M., Westgren, M., Papadogiannakis, N., Jonsson, A., & Iwarsson, E. (2008). On the origin of trisomy 21 Down syndrome. Molecular Cytogenetics, 1(1), 21. https://doi.org/10.1186/1755-8166-1-21
Hunt, P. A., & Hassold, T. J. (2008). Human female meiosis: what makes a good egg go bad ? January. https://doi.org/10.1016/j.tig.2007.11.010
Jones, K. T. (2008). Meiosis in oocytes: predisposition to aneuploidy and its increased incidence with age. 14(2), 143–158.
Jones, K. T., & Lane, S. I. R. (2013). Molecular causes of aneuploidy in mammalian eggs. Development (Cambridge), 140(18), 3719–3730. https://doi.org/10.1242/dev.090589
Jurewicz, J., Radwan, M., Sobala, W., Gromadzińska, J., Jabłońska, E., Radwan, P., Jakubowski, L., Wasowicz, W., & Hanke, W. (2016). Dietary Patterns and the Frequency of Disomy in Human Sperm. Urology, 93, 86–91. https://doi.org/10.1016/j.urology.2016.03.020
Jurewicz, J., Radwan, M., Sobala, W., Radwan, P., Jakubowski, L., Hawuła, W., Ulańska, A., & Hanke, W. (2014). Lifestyle factors and sperm aneuploidy. Reproductive Biology, 14(3), 190–199. https://doi.org/10.1016/j.repbio.2014.02.002
Karmiloff-Smith, A., Al-Janabi, T., D’Souza, H., Groet, J., Massand, E., Mok, K., Startin, C., Fisher, E., Hardy, J., Nizetic, D., Tybulewicz, V., & Strydom, A. (2016). The importance of understanding individual differences in Down syndrome. F1000Research, 5, 1–10. https://doi.org/10.12688/f1000research.7506.1
Medica, I., Maver, A., Augusto, G. F., & Peterlin, B. (2009). Polymorphisms in genes involved in folate metabolism as maternal risk factors for Down syndrome - Meta-analysis. Central European Journal of Medicine, 4(4). https://doi.org/10.2478/s11536-009-0055-0
Meguid, N. A., Dardir, A. A., Khass, M., El Hossieny, L., Ezzat, A., & El Awady, M. K. (2008). MTHFR genetic polymorphism as a risk factor in Egyptian mothers with Down syndrome children. Disease Markers, 24(1). https://doi.org/10.1155/2008/214027
Mikwar, M., MacFarlane, A. J., & Marchetti, F. (2020). Mechanisms of oocyte aneuploidy associated with advanced maternal age. Mutation Research - Reviews in Mutation Research, 785, 108320. https://doi.org/10.1016/j.mrrev.2020.108320
Morris, J. K., Wald, N. J., Mutton, D. E., & Alberman, E. (2003a). Comparison of models of maternal age-specific risk for Down syndrome live births. Prenatal Diagnosis, 23(3), 252–258. https://doi.org/10.1002/pd.568
Morris, J. K., Wald, N. J., Mutton, D. E., & Alberman, E. (2003b). Comparison of models of maternal age-specific risk for Down syndrome live births. Prenatal Diagnosis, 23(3), 252–258. https://doi.org/10.1002/pd.568
Moura, M. De, & Houten, B. Van. (2010). Review Article. Environmental and Molecular Mutagenesis, 405(April), 391–405.
https://doi.org/10.1002/em
Murthy, S. K., Malhotra, A. K., Mani, S., Shara, M. E. A., Al-Rowaished, E. E. M., Naveed, S., Alkhayat, A. I., & Alali, M. T. (2006). Incidence of Down syndrome in Dubai, UAE. Medical Principles and Practice, 16(1), 25–28. https://doi.org/10.1159/000096136
Musdalipa, M., Maddeppungeng, M., & Wulandari, R. (2021). Maternal Age Distribution of Down-Syndrome at Pediatric Growth and Development Clinic, 2015–2019. Green Medical Journal, 3(2). https://doi.org/10.33096/gmj.v3i2.84
Nagaoka, S. I., Hassold, T. J., & Hunt, P. A. (2012a). Human aneuploidy: Mechanisms and new insights into an age-old problem. Nature Reviews Genetics, 13(7), 493–504. https://doi.org/10.1038/nrg3245
Nagaoka, S. I., Hassold, T. J., & Hunt, P. A. (2012b). Human aneuploidy: Mechanisms and new insights into an age-old problem. Nature Reviews Genetics, 13(7), 493–504. https://doi.org/10.1038/nrg3245
Oliver, T. R., Feingold, E., Yu, K., Cheung, V., Tinker, S., Masse, N., & Sherman, S. L. (2008). New Insights into Human Nondisjunction of Chromosome 21 in Oocytes. 4(3), 1–10. https://doi.org/10.1371/journal.pgen.1000033
Petersen, M. B., Antonarakls, S. E., Hassold, T. J., Freeman, S. B., Sherman, S. L., Avramopoulos, D., & Mikkelsen, M. (1993). Paternal nondisjunction in trisomy 21: excess of male patients. 2(10), 1691–1695.
Radwan, M., Jurewicz, J., Wielgomas, B., Piskunowicz, M., Sobala, W., Radwan, P., Jakubowski, L., Hawuła, W., & Hanke, W. (2015). The association between environmental exposure to pyrethroids and sperm aneuploidy. Chemosphere, 128, 42–48. https://doi.org/10.1016/j.chemosphere.2014.12.077
Rai, V., Yadav, U., Kumar, P., Yadav, S. K., & Mishra, O. P. (2014). Maternal methylenetetrahydrofolate reductase C677T polymorphism and down syndrome risk: A Meta-analysis from 34 studies. PLoS ONE. https://doi.org/10.1371/journal.pone.0108552
Rowsey, R., Kashevarova, A., Murdoch, B., Dickenson, C., Woodruff, T., Cheng, E., Hunt, P., & Hassold, T. (2013). Germline mosaicism does not explain the maternal age effect on trisomy. American Journal of Medical Genetics, Part A, 161(10), 2495–2503. https://doi.org/10.1002/ajmg.a.36120
Sadiq, M. F., Al-Refai, E. A., Al-Nasser, A., Khassawneh, M., & Al-Batayneh, Q. (2011). Methylenetetrahydrofolate reductase polymorphisms C677T and A1298C as maternal risk factors for Down syndrome in Jordan. Genetic Testing and Molecular Biomarkers, 15(1–2). https://doi.org/10.1089/gtmb.2010.0057
Stipoljev, F., Vicic, A., & Gjergja-Juraski, R. (2019). #49 Impact of medical history, diet and lifestyle on chromosomal instability in lymphocytes of young couples with trisomy 21 pregnancy. Reproductive Toxicology, 88. https://doi.org/10.1016/j.reprotox.2019.05.051
Verma, I. C., Mathews, A. R., Faquih, A., El-Zouki, A. A., Malik, G. R., & Mohammed, F. (1990). Cytogenetic analysis of down syndrome in Libya. The Indian Journal of Pediatrics, 57(2), 245–248. https://doi.org/10.1007/BF02722095
Weijerman, M. E., & De Winter, J. P. (2010). Clinical practice: The care of children with Down syndrome. In European Journal of Pediatrics. https://doi.org/10.1007/s00431-010-1253-0
Young, S. S., Eskenazi, B., Marchetti, F. M., Block, G., & Wyrobek, A. J. (2008). The association of folate, zinc and antioxidant intake with sperm aneuploidy in healthy non-smoking men. Human Reproduction, 23(5), 1014–1022. https://doi.org/10.1093/humrep/den036

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Identification of maternal risk factors for having Down syndrome cases in Jordan

Status:

Version 1

Abstract

Introduction

Materials and methods

Sample Selection

Karyotype and Genotype Analysis

Statistical Analysis

Results

Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1