Cloning and expression of acetaldehyde dehydrogenase from archaea and its application in acrylamide elimination from fried foods

doi:10.21203/rs.3.rs-3972970/v1

Download PDF

Research Article

Cloning and expression of acetaldehyde dehydrogenase from archaea and its application in acrylamide elimination from fried foods

https://doi.org/10.21203/rs.3.rs-3972970/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 07 Jul, 2024

Read the published version in Food and Bioprocess Technology →

You are reading this latest preprint version

High-temperature frying is a common food processing method, and fried foods are favored by consumers due to its unique flavor and good taste. However, the degradation of unsaturated fatty acids in fats and oils during high-temperature processing results in the production of toxic lipid hydroperoxides (LOPs), saturated and unsaturated aldehydes, as well as acrylamides, which have been classified as group I carcinogens by the International Agency for Research on Cancer (IARC). In this study, high-temperature acetaldehyde dehydrogenase (SufALDH) of marine thermophilic archaeon Sulfolobus tokodaii 7 cloned and expressed. The optimal temperature was 88℃ and the optimal pH was 8.0. The SufALDH enzyme was further used for the pretreatment of fried food, which led to significant reduction in the aldehyde content of the fried food. In SufALDH-treated French fries, fried chicken and fried fish, aldehyde content reduced by 60%, 52% and 33%, respectively, while 40% reduction in acrylamide was observed in the French fries treated with SufALDH. Molecular docking indicated seven key amino acid residues between SufALDH and substrate acetaldehyde, acrolein, acrylamide and isopropyl alcohol, and they will be mutated to improve the SufALDH characteristics for it further application in food industries.

Acetaldehyde

Acrylamide

Aldehyde dehydrogenase

Clonal expression

The food industry is plagued by the accumulation of acetaldehydes in food products during brewing, deep-frying, and packaging. These aldehydes not only affect the quality of the product, but also the health of consumers and producers(Holmes 2022; Lachenmeier et al. 2009; St. Angelo et al. 1996). Acetaldehyde may cause toxicity in the exposed individuals, leading to respiratory depression and even death. Respiratory tract and mucous membranes can be damaged by acetaldehyde, and prolonged exposure to acetaldehyde leads to cytotoxicity, autoimmune reactions and oxidative stress (Kim et al. 2018). Acetaldehyde is currently classified as the group I carcinogen by International Agency for Cancer (IARC) (O'Grady et al. 2020; Grootveld et al. 2014).

For many years, unsaturated fatty acids (UFAs) have been considered relatively healthy than the saturated fatty acids. However, in high temperature environments, UFAs undergo extremely complex chemical degradation(Gabrielle Alves de Carvalho et al. 2022). It has been speculated that this process involve highly reactive free radicals and single-linear oxygen (Guillén and Ruiz 2003). Interactions between the bis- or monopropenyl CH2 groups located between or near the carbon-carbon double bonds in the polyunsaturated fatty acid and monounsaturated fatty acid chains, respectively, produce highly toxic conjugated peroxydiene (CHPD) and hydrogen peroxide monoenes (HPMs). These CHPDs and HPMs are then decomposed at high temperatures into secondary LOPs with lower molecular weight, including saturated and unsaturated aldehydes (Wann et al. 2021). Some aldehydes are precursors of other carcinogens, such as acrolein, which is an important precursor of acrylamide, produced by hydrolysis and thermal dehydration of lipids (Grootveld et al. 2022). Aldehydes are also important precursors of heterocyclic amines (Meurillon and Engel 2016). Therefore, application of aldehyde dehydrogenase for the treatment of food ingredients can reduce the variety of aldehydes originated during food processing(Martínez-Yusta et al. 2014).

Acetaldehyde dehydrogenase (ALDH) is a naturally occurring oxidoreductase involved in the interconversion of aldehydes and acids, as well as stress tolerance and fatty aldehyde metabolism in organisms (Dimitrios et al. 2010). However, the presence of ALDH in nature is very limited due to its low content and difficulty to extract. ALDH is used in the food industry, especially in production applications. When raw ingredients are heated during the food production process, ordinary ALDH is inactivated due to its inability to tolerate high temperatures. To address this challenge, high-temperature tolerant ALDH needs to be obtained from thermophilic Archaea. The thermophilic ALDH maintains its activity at high temperatures, and can therefore be used more efficiently in the food industry (Liu et al. 2013).

Therefore, this study was undertaken to explore the heterologous expression of high-temperature ALDH obtained from deep-sea archaea. And the effects of ALDH treatment was analyze on the common fast food products processed at high temperatures, i.e., French fries, fried chicken, and fried fish.(Wu et al. 2022) Also, we provides a simple and convenient method to measure the production of aldehydes within food products. The results indicated the ALDH could be used to improve the safety of fried foods.

2.1 Materials

The raw cooking oil used in this experiment was procured from Citi shortening, and it was mainly composed of refined vegetable oils with a smoke point of 180°C. French fries, Frozen chicken wings and frozen cod fish were purchased from Jiadefu supermarket. The E. coli cold shock vector PCOLD I was procured from Takara. ALDH used in this experiment was obtained from Sulfolobus tokodaii strain 7.

The plasmid mini-extraction kit and agarose gel DNA recovery kit used in this experiment were purchased from Tiangen Biochemical Technology Co., China. Restriction endonucleases, i.e., XhoI and HindIII, were purchased from New England Biotechnology, Inc., USA. PrimeSTAR MAX DNA polymerase and DNA ligation kit (Ver. 2.1) were purchased from Takara Corporation, Japan. True-Color Dual-Color Prestain protein marker was purchased from Sangon Bioengineering Co., Shanghai, China.

PCold I plasmid was purchased from Takara Corporation, Japan, and the receptor cell E. coli BL21 (DE3) was purchased from Tiangen Biochemical Technology Co., China.

Compositions of growth media, reagents and solutions were as follows:

LB medium: tryptone (10 g/L), yeast (5 g/L), NaCl (10 g/L), and benzyl penicillin (50 µg/mL), pH 7.4.

5x SDS-PAGE buffer solution: Tris − 15.1 g, glycine − 94 g, SDS − 5 g, in 1 L of ultrapure water.

SDS-PAGE staining solution: Kaomas Brilliant Blue R (250 0.4 g), isopropanol (100 mL), ice acetic acid (40 mL), and ultrapure water (260 mL).

SDS-PAGE decolorizing solution: glacial acetic acid (100 mL), anhydrous ethanol (50 mL), and ultrapure water (830 mL).

Acetaldehyde standard solution: 0.2686 g of acetaldehyde was dissolved in ethanol (aldehyde-free alcohol) at 4℃, and then condensed to 100 mL to obtain 1 g/L acetaldehyde standard solution. The standard solution was transferred into a brown reagent bottle, and stored in the refrigerator. 1–5 mL of acetaldehyde standard solution (1 g/L) was sucked and transferred to 100 mL volumetric flasks containing reference ethanol (4℃), to obtain acetaldehyde standard solutions of 10–50 mg /L concentrations, respectively.

Sodium bisulfite solution: 53 g of sodium bisulfite was dissolved in 100 mL of distilled water to obtain 53% sodium bisulfite solution.

Basic magenta sulfite solution: 0.075 g of basic magenta was dissolved in a small amount of distilled water (80℃). The mixture was cooled and diluted with water (75 mL). A certain amount of water and 7.5 mL of sulfuric acid was added into 50 mL of newly prepared sodium bisulfite solution, and the solution was transferred to a 500 mL volumetric flask. After shaking and deflating, the solution was left at room temperature for 10 ~ 12 h until the color of the solution faded and a strong odor of sulphur dioxide was noticed.

PBS buffer solution (0.1 mol/L) consisted of KH₂PO₄ (0.27 g/L), Na₂HPO₄ (1.42 g/mL), NaCl (8 g/mL), KCl (0.2 g/mL).

2.2 Methods

2.2.1 Cloning of SufALDH

Using the snap gene, primers and cleavage sites were designed based on the gene sequences of ALDH of S. tokodaii 7 (SufALDH) and PCold I plasmid as follows:

Table 1

Primer sequences
Name of primer	sequence
SufALDH-U	CCGCTCGAGATGTCTGAAGTAATCG
SufALDH-D	CCCAAGCTTAAGAAGAGTGATAGCGAT

PrimeSTAR MAX DNA polymerase was used to amplify the target gene through polymerase chain reaction (PCR) system.

Table 2

PCR system
Name	Quantity (µL)
SufALDH-U	2
SufALDH-D SufALDH PrimeSTAR MAX DNA Polymerace ddH₂O	2 1 25 20

PCR reaction conditions were: 98℃ for 10 s, 55℃ for 5 s, 72℃ for 90 s, 72℃ 3 min, 32 thermal cycles.

SufALDH and pCold plasmid were digested by using restriction endonuclease XhoI and HindIII at the same time. SufALDH was digested with XhoI and HindIII in a reaction system consisting of SufALDH (34 µL), Smartcut r2.1 (5 µL), and ddH₂O (7 µL). pCold was digested with XhoI and HindIII in a reaction system consisting of pCold (1 µL), Smartcut r2.1 (5 µL) and ddH₂O (31 µL). The digestion reactions were carried out at 37℃ for 45 h. Subsequently, target gene and pCold were detected and recovered using 1% agarose gel. Solution I was used to link the target gene to the vector pCold. enzyme-linke system encompassed SufALDH gene (1 µL), pCold (1 µL), Solution I (2 µL). Enzyme-linke reaction was performed at 16℃ for 1 h, then the plasmid containing SufALDH was transferred to the E. coli BL21 receptor cells.

Fifty microliters of the sensory cells frozen at -80°C were thawed on ice and added to 5 µL of recombinant plasmid. Cell suspensions were mixed gently and kept in ice bath for 30 min. Subsequently, cells were activated in a water bath at 42°C for 90 s, and then quickly transferred to an ice bath for 2–3 min. 800 µL of antibiotic-free LB medium was added to each centrifuge tube, mixed well and kept at 37°C and 180 r/min for 1–1.5 h to revive the bacteria. The revived cells were transferred into LB solid medium containing 50 µg/mL ampicillin and incubated at 37℃ for 12–15 h. A single colony was picked and transferred to the LB medium containing 50 µg/mL ampicillin and incubated at 37℃ for 6–8 h. At the same time, the target gene was amplified by PCR using Taq PCR master mix. PCR reaction mix consisted of sterile deionized water (12.5 µL), forward primer (1 µL), reverse primer (1 µL), DNA (0.5 µL), and Taq PCR master mix (12.5 µL). PCR reaction conditions were: 98℃ for 10 s, 55℃ for 5 s, 72℃ for 90 s, 72℃ for 3 min, 32 thermal cycles. The positive samples were sent to Shanghai Sangon Biotech for sequencing.

The positive colonies containing cloned ALDH were inoculated into LB liquid medium containing 50 µg/mL ampicillin. The inoculated medium was incubated at 180 r/min at 37°C for 4–5 h. At OD₆₀₀ = 0.4–0.5, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to obtain a final concentration of 0.5 mM. The liquid medium was cooled rapidly in ice water to 16°C, and incubated for 24 h. The bacterial culture was centrifuged at 5867 x g for 15 min, and the supernatant was discarded. The precipitated bacterial cells were washed twice with 10 mM PBS buffer by centrifugation at 5867 x g for 10 min. Washed cells were resuspended in PBS buffer, and then ultrasonicated for 30 min. Subsequently, bacterial suspension was centrifuged at 5867 x g for 10 min, and then the supernatant was extracted to obtain the crude enzyme solution. The crude enzyme solution was purified using a nickel column.

2.2.2 Determination of ALDH

ALDH activity was measured using the method elaborated by Vallee and Hoch (jing 2017). The reaction solution consisted of 100 µL of 1% acetaldehyde, 200 µL of 2% NAD+, 2000 µL of 50 mM PBS buffer solution (pH 8.0), 200 µL of 750 mM KCl solution, and 100 µL of enzyme solution. The changes in the absorbance of solution (at 340 nm) were measured at 80°C. The amount of enzyme required to generate 1 µmol NADH per min was defined as one unit of enzyme activity. Experimental data has been expressed as mean ± standard deviation (SD) of three replicates (jing 2017).

2.2.3 Expression of SufALDH and its properties

To determine the optimum reaction temperature for the cloned SufALDH, its activity was observed at temperatures of 60, 70, 80, 90 and 98℃. Before adding the acetaldehyde, reaction solutions were preheated at the chosen temperatures in a water bath for 3 min. After adding acetaldehyde, changes in the absorbance (at 340 nm) were measured at 80℃. Amount of enzyme required to generate 1 µmol NADH per min was defined as one unit of enzyme activity. The collected data were further used to calculate the relative enzyme activity.

To test the temperature stability of SufALDH, the enzyme solutions were preheated in a water bath at 70, 80 and 90℃ respectively. After preheating, enzyme solutions were mixed with the reaction solution containing acetaldehyde, and the SufALDH activity was determined using the method described in section 2.2.2. The results of the experiments were summarized and the relative enzyme activity was calculated.

To determine the optimum reaction pH for SufALDH, Tris-HCl (pH 9.2) and water in the enzyme solution were replaced with buffers of pH 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, and 11.0, and the SufALDH activity was measured, as described in section 2.2.2. The highest enzyme activity was considered 100% to calculate the relative enzyme activity.

To study the effect of different metal ions on SufALDH activity, 5 mM of metal ion solutions(Na⁺, K⁺, Ca²⁺, Mg²⁺, Cu²⁺, Ba²⁺)were added to the reaction solution, and the variations in SufALDH activity were observed. Reaction solution containing no metal ion was used as a control. SufALDH activity and relative enzyme activity were determined as mentioned above.

Furthermore, acetaldehyde, formaldehyde, isopropanol, ethanol and trichloroacetaldehyde were examined as substrates, and the best substrate was determined by analyzing the SufALDH activity in presence of different substrates.

2.2.4 Acetaldehyde elimination from fried foods by SufALDH

2.2.4.1 Standard curve

Standard solutions of acetaldehyde (10 to 50 mg/L), sodium bisulfite solution, and basic magenta sulfite solution were prepared according to the procedure described in section 2.1.

Basic magenta sulfite solution was added to the acetaldehyde standard solutions and the absorbance was measured at 520 nm to obtain a standard curve.

2.2.4.2 Determination of acetaldehyde content in the fried food products

French fries, chicken and minced fish were chosen as the ingredients for this experiment. Before frying, the ingredients were divided in four groups. The control group was set up by mixing 5 mL of aldehyde-free distilled water with 2 mL of Basic magenta sulfite solution. The ingredients in the untreated group were marinated in distilled water containing no enzyme, and then deep-fried. In the three treated groups, ingredients were treated with the enzyme solutions of 10, 50, and 100 U, respectively. After enzyme treatment, the ingredients were subjected to deep-frying. The frying for French fries was fried at 160℃ for 3 min. For chicken, frying temperature was 160℃, and frying time was 6 min. Fish was initially fried at 150℃ for 2 min, and then at 180℃ for 6 min. Subsequently, 10 g of each fried food sample was crushed and transferred to 50 mL centrifuge tubes. After adding 30 mL of chilled distilled water (4℃), food samples were vortexed for 2 min, and then centrifuged (9168 x g, 5 min, 10℃). Subsequently, 10 mL of the upper layer of the supernatant was aspirated into a 25 mL colorimetric tube. 2 mL of Basic magenta sulfite solution was added to the supernatant and the solution was left for 20 min in a water bath at 20℃. After 20 min of reaction, the absorbance of the solution was measured at 520 nm and the acetaldehyde content was calculated by using the standard curve.

Ten grams of food sample was mixed with acetaldehyde to obtain the final concentration of 10, 20, 30, 40, 50 mg/kg. The mixed samples were sealed in self-sealing bags, and then the bags were immersed in enzyme solution for 1 h to allow full absorption of SufALDH. The treated samples were crushed and transferred to 50 mL centrifuge tubes. Subsequently, 30 mL of chilled aldehyde-free ultrapure water (4℃) was added to the treated samples. The mixtures were vortexed for 2 min, and then centrifuged at 4℃ for 10 min at 9168 x g. Five milliliters of supernatant was pipetted into a 10 mL tube and 2 mL of chromogen was added to the tube. The reaction solution was left in a water bath for 20 min at 20℃, and then the absorbance was measured at 520 nm to determine the acetaldehyde content.

2.2.4.3 Preparation of acrylamide standard curve and analysis of acrylamide content in food samples

The standard working solutions were injected into the liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) system. The peak areas of the corresponding acrylamide and its internal standard were determined. Standard curve was plotted by placing the concentration of standard working solutions (µg/L) at the horizontal coordinate and the ratio of the peak areas of acrylamide (m/z 55) and the 13C3 acrylamide internal standard (m/z 58) at the vertical coordinate. To measure the acrylamide content in food samples, sample solutions were injected into the LC-MS/MS system, and m/z 55 and m/z 58 were measured. Concentration of acrylamide in the solution (µg/L) was determined according to the standard curve. At least two parallel measurements were carried out for each sample (Anon 2014).

2.2.4.4 Mass spectrometric analysis

Samples and the standard working solutions were injected into the LC-MS/MS system, and the total ion mobility, mass spectra and the peak areas of acrylamide and the internal standard were recorded. The peaks were analyzed to determine the retention time and the abundance of fragment ions. The signal-to-noise ratio of the detected acrylamide peaks was greater than 3, and the retention times of the target compounds in the test sample was found to be consistent with the retention times of same compounds in the standard solution. At the same time, abundance ratios of the corresponding ions of the target compounds in the test sample were consistent with the abundance ratios of the same compounds in the standard solution (Anon 2014).

2.2.4.5 Determination of acrylamide content

The acrylamide content in the samples was calculated according to the internal standard method using the following formula:

$$x=A\text{*}f/M$$

x: acrylamide content in the sample (µg/kg);

A: mass of acrylamide (ng) corresponding to the ratio of the areas of acrylamide (m/z 55) peak and 13C3 acrylamide internal standard (m/z 58) peak;

f: conversion factor for the internal standard added to the sample (f = 1 for 10 µL internal standard and f = 2 for 20 µL internal standard);

M: mass of sample (g)

Determined acrylamide content was expressed as the arithmetic mean of two independent measurements carried out under reproducible conditions (Anon 2014).

2.2.5 Mechanism exploration of acetaldehyde elimination

Theoretical simulations of SufALDH with the substrates were carried out using the Autodock software, which uses a Lamarckian Genetic Algorithm (LGA) with the honored docking method for the prediction of small molecule conformational changes and takes the incorporation of free energies for the evaluation of the docking results (Xue et al.). Homology modeling was performed using SWISS-MODLE with 8hap.1.A of Aldehyde dehydrogenase as a template. Based on the results of homology modeling and sequence comparison, the molecular linkage of acetaldehyde, acrolein, acrylamide and isopropyl alcohol with SufALDH was performed using Autodock to simulate the binding sites, and the docking results were viewed using PyMOL software and detected using Procheck.

2.2.6 Data analysis

All the experiments were set three parallel samples. SPSS v.2019 was used for significance analysis. The figures were drawn with Origin v.2018.

3.1 Recombinant vector construction, transformation, and expression of SufALDH

In this experiment, 5% agarose gel was used to verify the successful construction of recombinant plasmid. As shown in the Fig. 2, the size of SufALDH was observed to be around 1400 bp, and the gene bands in the electrophoresis results were consistent with the gene size.

The SufALDH gene was double-cleaved with pCold I plasmid, and the successful cleaving of gene was confirmed by agarose gel electrophoresis. The presence of a single band indicated successful cleavage of the target gene. Solution I was used to link the target gene (SufALDH gene) to the vector pCold I to construct the recombinant plasmid.

The recombinant plasmid was transformed into competent cells of E.coli BL21, and then the constructed E.coli BL21 strain was cultivated in a selection medium. A single colony was picked and cultured, and the plasmid was extracted. Extracted plasmid was subjected to double digestion, and then sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The results of sequencing revealed that the nucleotide sequence of the target gene was the same. E.coli BL21 strain with positive double digestion results and completely consistent sequencing results was selected for fermentation.

In presence of pCold plasmid, the fermentation conditions of E. coli were temperature-dependent due to the plasmid itself. In this experiment, a standard culture protocol was used. The E. coli strain was cultured at 37℃ until the OD₆₀₀ of culture reached 0.5. The bacterial culture was cooled down to 15℃ in an ice bath, and then IPTG was added at a final concentration of 0.5 mM and fermented at 16℃ for 24 h. After successful expression, SufALDH was purified by Ni-NTA affinity chromatography through AKTA™ system and a single band was obtained by 8% SDS-PAGE. The molecular weight of the single band (50 kDa) was found to be consistent with the result obtained from bioinformatic analysis.

3.2. Properties of SufALDH

SufALDH is a high temperature-tolerant ALDH. In this study, the optimum temperature for SufALDH was 90°C, and the optimum pH was 8.0 (Fig. 2). The enzyme showed highest enzyme activity at high temperature, which would be beneficial for practical applications.

As a high-temperature ALDH, SufALDH was not only able to tolerate the high temperatures, but it also showed good stability at higher temperatures for a longer period of time. The temperature stability of SufALDH met the requirements of practical applications, showing good activity for more than 6 h at 70°C and 80°C. The results indicated that SufALDH could tolerance high temperature conditions.

Since the active structure of enzyme often depends on the metal ion associated with it, it is necessary to investigate the effect of metal ions on the enzyme activity. Different metal ions affect the enzymes in different ways. However, most metal ions affect the properties of enzyme by acting on the metal group in its active center or by affecting the structure of the metal group and the nearby amino acids and peptide bonds. As shown in the Table 3, some of the metal ions promote enzyme activity to a certain extent.

Table 3

Effect of metal ions on activity of SufALDH
Metal ions (5 mM)	Relative enzyme activity (%)
none	100 ± 12.49
K⁺	128.69 ± 4.83
Na⁺	121.28 ± 10.34
Ca²⁺	102.33 ± 6.43
Mg²⁺	110.5 ± 13.86
Cu²⁺	86.88 ± 13.66
Ba²⁺	93.88 ± 5.17

Table 4

Activity of SufALDH in presence of different substrates
Substrate	Relative enzyme activity (%)
acetaldehyde	100
methanol	0
ethanol	0
isopropyl alcohol	0
trichloroacetaldehyde	0

As shown in Table 4, the most suitable substrate for SufALDH was found to be acetaldehyde, which is unable to react with methanol ethanol isopropanol and trichloroacetaldehyde.

3.3 Detection of aldehyde in samples

3.3.1 Standard curves

Standard curves have been shown in Figure S1 (see supporing information).

3.3.2 Recovery rate of acetaldehyde after SufALDH treatment of fried food products

The acetaldehyde content in the treated fried food samples were determined by following the method described in section 2.2.4.2. As shown in Table 5, recovery rates of acetaldehyde in French fries ranged from 62.53 to 88.44%, which were relatively good and reflected the deviations among the samples.

Table 5

Recovery rate of acetaldehyde in food samples
Spiked amount (mg/kg)	Recovery rate (%)	Relative standard deviation (%)
10	74.12 ± 0.75	4.40
20	61.97 ± 0.48	3.97
30	70.41 ± 0.81	4.12
40	83.61 ± 1.57	5.19
50	88.44 ± 0.93	2.36

3.3.3 Aldehyde content in fried food products

Observed concentration of aldehydes in the different experimental groups has been shown in Fig. 4.

Food ingredients treated with SufALDH showed significant reductions in internal aldehyde content after frying. In treated fish, 30 to 33% decrease in aldehyde content was observed after frying (Fig. 4A), while 52% decrease in aldehyde content was observed in the treated fried chicken (Fig. 4B). The effect was most pronounced for French fries, with 60% reduction in aldehyde content (Fig. 4C). According to the national standard document of the People's Republic of China GB 31640 − 2016 Edible Alcohol,(Anon 2016) the concentration of aldehydes in ordinary grade cooking alcohol should not be higher than 30 mg/L, and it should be less than 1 mg/L in special grade alcohol. The untreated chicken and fish groups had more aldehyde content than the recommended national standard. In the untreated chicken and fish groups, the aldehyde content produced during high temperature frying was higher than the recommended national standard. In the untreated French fries group, the aldehyde content was close to the upper limit of the recommended value. After enzyme treatment, the aldehyde concentrations in fried food products would be below the national standard limits.

3.4 Acrylamide concentration in fried food products

Considering the results mentioned in section 3.3.3, French fries were chosen as the raw material for further experiments, with 100 U as the most efficient enzyme concentration for treatment of French fries. The acrylamide concentration in the food samples was tested according to the method of GB5009.204-2014, and the results are shown in the Table 6.

Table 6

Acrylamide concentration in samples after enzyme treatment
Groups	Acrylamide (µg/L)	Relative standard deviation (%)
Blank	50.20 ± 0.14 ^a	0.002
100 U	29.95 ± 0.18 ^b	0.006
Different lowercase letters indicate significant difference, P < 0.05

As shown in Table 6, deep-frying after enzyme treatment resulted in a significant reduction in acrylamide content, as compared to the untreated group, with an average acrylamide reduction of 40.3% and a significant RSD of less than 5%. SufALDH treatment of ingredients resulted in a reduction in the internal acrylamide content of the French fries after deep-frying. So far, no quantitative standards have been issued to limit the acrylamide levels in food. However, policies to reduce acrylamide levels in food are being promoted in various regions. Therefore, it is necessary to minimize the acrylamide content in food.

3.5 Mechanism exploration of acetaldehyde elimination

Homology modeling of SufALDH is shown in Fig. 5(A). The results of Ramachandran plot are shown in Fig. 5(B). SufALDH is evaluated by using Errat and scores 93.6299 points, and 95.1% of φ and ψ dihedral angles of SufALDH were located in the optimal zone. 4.6% were located in the other permissive zones. Only 0.4% were located in the maximum zone, and no φ and ψ dihedral angles were found in the impermissible zone. As a result, the model is reasonable and could provide a model basis for the next molecular experiments.

The molecular docking by semi-flexible of acetaldehyde, acrolein, acrylamide and isopropyl alcohol with SufALDH are shown in Fig. 6 and Table 7. Seven amino acid residues K165, G196, R447, D433, E115, Y116 and Q95 were the key binding sites between SufALDH and substrates. As the Fig. 6(A) shows that the amino acid residue K165 and G196 could form hydrogen bond with acetaldehyde, and the length was less than 5 Å. For acrolein, R447 could form length less than 5 Å hydrogen bond with it. Acrylamide could form length less than 5 Å hydrogen bond with R91, D433, E115, and Y116. For isopropyl alcohol, the Q95 and Y116 were the key amino acid residues: the hydrogen bond length less than 5 Å, and the shortest hydrogen bond length was 2.90 Å. The lowest binding energy was − 13.33 kJ/mol, and binding energies of all the sites were lower than − 10.71 kJ/mol.

Table 7

SufALDH molecular docking results
Amino acid residue	Substrate	Binding energy (kJ/mol)	H-Bonds Length (Å) and Atomic Positions	Inhibition Constant (Ki) (mM)
K165	acetaldehyde	-10.71	N-O:2.9	13.21
G196	acetaldehyde	-10.71	N-O:3.3	13.21
R447	acrolein	-12.25	NG-O:3.1;NG-O:4	7.08
D433	acrylamide	-13.33	O-N:3.2;	4.58
E115	acrylamide	-13.33	N-O:3.4	4.58
Y116	acrylamide isopropyl	-13.33 -12.03	N-O:3.3;N-O:3	4.58 7.68
Q95	acrylamide isopropyl	-13.33 -12.03	N-O:3.4;N-O:3.7	4.58 7.68

Fried foods such as French fries, fried chicken, and fried fish not only have the wonderful flavor (Wang et al. 2023; Zhang et al. 2012), but also contain trans fatty acids (Manzoor et al. 2023), polycyclic aromatic hydrocarbon (PAH) (Gong et al. 2018) and various aldehydes (Moumtaz et al. 2019) generated due to various complex oxidation reactions during deep-frying. In turn, PAHs and aldehydes lead to the formation of heterocyclic amines (Skog et al. 1997) and acrylamides (Liu et al. 2015), which have high teratogenic and carcinogenic properties(Zhong et al. 2022).

SufALDH, derived from the marine archaea S. tokodaii 7, showed high temperature resistance, and its activity could be maintained for several hours at 80℃. These properties improve the application potential of SufALDH in the food industry.

Currently, high-temperature deep-frying is a common method of food processing. Ingredients, such as doughnuts, custard, tempura, crisps, cornflakes, shrimp chips, etc. are fried at high temperatures to turn them into tasty products (Wang et al. 2023). However, studies have shown that fried foods can do more harm than good to human health, due to high calories(Pan et al. 2021). Fried foods can be an important contributor to many diseases, such as obesity, high blood pressure, cardiovascular and cerebrovascular disease, and cancer(Pilar et al. 2012; Zhang et al. 2023; Miller-Kasprzak et al. 2022). Furthermore, aldehydes in the food form carcinogenic substances of group I under high temperature conditions, which are harmful to human body(Schouten et al. 2023). These harmful substances in fried foods can be reduced to a certain extent by selecting suitable frying oil, controlling the frying temperature and time, applying appropriate pretreatment, and adding exogenous inhibitors. For instance, according to different raw materials, rice bran oil and coconut oil can be used for deep-frying at the most appropriate temperature (150℃ for potatoes and 180℃ for meat products) (Zhang et al. 2021). However, more methods need to be explored and developed to reduce aldehyde content in fried food products.

By treating the raw material with a high temperature-tolerant ALDH prior to frying, the aldehyde content in French fries, could be reduced by 60%, which significantly decreased the total amount of additional aldehydes produced as by-products. This, in turn, reduced the production of carcinogenic acrylamide and improved the safety of fried food products.

The molecular docking is one of the important methods to study the key amino acid residues(Eberhardt et al. 2021). There were 7 residues, and they could be aimed for molecular modification to improve substrate specificity and enzymatic characteristics(Zhao et al. 2022). SufALDH could effectively remove the carcinogen acrylamide from fried foods, and molecular modification can further improve the removal rate.

Fried food is popular due to its delicious flavor. However, a large number of toxic substances, such as saturated and unsaturated aldehydes, trans fatty acids, etc., are produced during the frying process, which may form carcinogenic substances under high-temperature conditions. In this study, SufALDH, a high-temperature ALDH, from S. tokodaii 7 was cloned and expressed. The optimal temperature and pH of enzyme were 90℃ and 8.0, respectively. After treating the food ingredients with SufALDH, the aldehyde content in fried food products could be significantly reduced. In fried chicken and fish, the aldehyde content reduced by 52% and 33%, respectively. The best results were obtained for French fries, with a 60% reduction in aldehyde content and a 40% reduction in acrylamide content after deep-frying of enzyme treated French fries. This study suggests that the cloned SufALDH has a promising potential in the food industry.

Molecular docking results indicated K165, G196, R447, D433, E115, Y116 and Q95 were the key amino acid residues between SufALDH and substrate acetaldehyde, acrolein, acrylamide and isopropyl alcohol. In the following experiments, we will mutate SufALDH by targeted mutagenesis to obtain higher enzyme activity.

Author Contributions: L. Xue: Conceptualization, methodology, writing—original draft preparation. Y. Yu, Y. Hao and H. Ni: Data curation, resources. W.Chen, J.Lu and X. Kang: Visualization, investigation and Software, validation. J.Lu and M. Lyu: Writing—reviewing and editing. S. Wang: Funding acquisition, project administration. All authors have read and agreed to the published version of the manuscript.

Funding: This study was supported by the National Key R&D Program of China (2022YFC2805101); the National Natural Science Foundation of China (32172154, 32201964); the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Conflicts of Interest: The authors confirm that there is no conflict of interests regarding this paper.

Data Availability Statement: All the data are available from the corresponding author upon request.

Anon (2014) China national food safety standards Determination of acrylamide in food. In, vol GB 5009.204–2014. p^pp 16. National Health and Family Planning Commission of PRC.
Anon (2016) Edible alcohol. In, vol GB31640-2016. p^pp. National Health and Family Planning Commission of PRC National Medical Products Administration.
Dimitrios S, Ying C, Chad B, Elizabeth D, Brian CJ, David JO, David CT & Vasilis V (2010) Aldehyde Dehydrogenase 1B1: Molecular Cloning and Characterization of a Novel Mitochondrial Acetaldehyde-Metabolizing Enzyme. Drug Metabolism and Disposition. 38(10), 1679.https://doi.org/10.1124/dmd.110.034678
Eberhardt J, Santos-Martins D, Tillack AF & Forli S (2021) AutoDock Vina 1.2.0: New Docking Methods, Expanded Force Field, and Python Bindings. Journal of Chemical Information and Modeling. 61(8), 3891–3898.https://doi.org/10.1021/acs.jcim.1c00203
Gabrielle Alves de Carvalho A, Olmo-Garcia L, Rachel Antunes Gaspar B, Carrasco-Pancorbo A, Naciuk Castelo-Branco V & Guedes Torres A (2022) Evolution of the metabolic profile of virgin olive oil during deep-frying: Assessing the transfer of bioactive compounds to the fried food. Food Chem. 380, 132205.https://doi.org/10.1016/j.foodchem.2022.132205
Gong G, Zhao X & Wu S (2018) Effect of natural antioxidants on inhibition of parent and oxygenated polycyclic aromatic hydrocarbons in Chinese fried bread youtiao. Food Control. 87, 117–125.https://doi.org/10.1016/j.foodcont.2017.12.012
Grootveld M, Addis PB & Le Gresley A (2022) Editorial: Dietary Lipid Oxidation and Fried Food Toxicology. Frontiers in Nutrition. 9.
Grootveld M, Rodado VR & Silwood CJ (2014) Detection, monitoring, and deleterious health effects of. inform. 25(10), 25(10).
Guillén MD & Ruiz A (2003) Edible oils: discrimination by 1H nuclear magnetic resonance. Journal of the Science of Food and Agriculture. 83(4), 338–346.https://doi.org/10.1002/jsfa.1317
Holmes RS (2022) Evolution of aldehyde dehydrogenase genes and proteins in diploid and allotetraploid Xenopus frog species. Chemico-Biological Interactions. 351, 109671.
jing L (2017) Protective Effects of Recombinant Bacillus Subtilis Co-Expressing Alcohol Dehydrogenase and Acetaldehyde Dehydrogenase on Alcoholic Liver Injury in Mice. Nanjing Agricultural University.
Kim JM, Kim JH, Lee CY, Jerng DW & Ahn HS (2018) Toluene and acetaldehyde removal from air on to graphene-based adsorbents with microsized pores. Journal of Hazardous Materials. 344, 458–465.https://doi.org/10.1016/j.jhazmat.2017.10.038
Lachenmeier DW, Kanteres F & Rehm J (2009) Carcinogenicity of acetaldehyde in alcoholic beverages: risk assessment outside ethanol metabolism. Addiction 104(4), 533–550.
Liu T, Hao L & Wang R (2013) Molecular characterization of a thermostable aldehyde dehydrogenase (ALDH) from the hyperthermophilic archaeon Sulfolobus tokodaii strain 7. Extremophiles. 17, 181–190.
Liu Y, Wang P, Chen F, Yuan Y, Zhu Y, Yan H & Hu X (2015) Role of plant polyphenols in acrylamide formation and elimination. Food Chemistry. 186, 46–53.https://doi.org/10.1016/j.foodchem.2015.03.122
Manzoor S, Masoodi FA & Rashid R (2023) Influence of food type, oil type and frying frequency on the formation of trans-fatty acids during repetitive deep-frying. Food Control. 147, 109557.https://doi.org/10.1016/j.foodcont.2022.109557
Martínez-Yusta A, Goicoechea E & Guillén MD (2014) A Review of Thermo-Oxidative Degradation of Food Lipids Studied by 1H NMR Spectroscopy: Influence of Degradative Conditions and Food Lipid Nature. Comprehensive Reviews in Food Science and Food Safety. 13(5), 838–859.https://doi.org/10.1111/1541-4337.12090
Meurillon M & Engel E (2016) Mitigation strategies to reduce the impact of heterocyclic aromatic amines in proteinaceous foods. Trends in Food Science & Technology. 50, 70–84.https://doi.org/10.1016/j.tifs.2016.01.007
Miller-Kasprzak EA-O, Musialik K & Kręgielska-Narożna M (2022) The Relation between Resistin (-420C/G) Single Nucleotide Variant, Resistin Serum Concentration, Carbohydrate, and Lipid Parameters and Fried Food Taste Preference in Patients with Hypertriglyceridemia. LID − 10.3390/nu14235092 [doi] LID − 5092. Nutrients(2072–6643 (Electronic)).
Moumtaz S, Percival BC, Parmar D, Grootveld KL, Jansson P & Grootveld M (2019) Toxic aldehyde generation in and food uptake from culinary oils during frying practices: peroxidative resistance of a monounsaturate-rich algae oil. Scientific Reports. 9(1), 4125.https://doi.org/10.1038/s41598-019-39767-1
O'Grady I, Anderson A & O'Sullivan J (2020) The interplay of the oral microbiome and alcohol consumption in oral squamous cell carcinomas. Oral Oncology. 110, 105011.https://doi.org/10.1016/j.oraloncology.2020.105011
Pan X-F, Wang L & Pan A (2021) Epidemiology and determinants of obesity in China. The lancet Diabetes & endocrinology. 9(6), 373–392.https://doi.org/10.1016/S2213-8587(21)00045-0
Pilar G-C, Fernando R-A, Esther L-G, Luz ML-M, Pilar A, Eva A, Larraitz A, Aurelio B, Genevieve B, María-Dolores C, Miren D, José-María H, Nerea L, Pilar M, Carmen M, Esther M, Carmen N, Quirós JR, Laudina R, María José S, Carlos AG & Conchi M-I (2012) Consumption of fried foods and risk of coronary heart disease: Spanish cohort of the European Prospective Investigation into Cancer and Nutrition study. BMJ. 344, e363.https://doi.org/10.1136/bmj.e363
Schouten MA, Santanatoglia A, Angeloni S, Ricciutelli M, Acquaticci L, Caprioli G, Vittori S & Romani S (2023) Effects of Nuts, Dried Fruits, Dried Seeds and Black Olives as Enrichment Ingredients on Acrylamide Concentrations in Sweet and Savoury Biscuits. Food and Bioprocess Technology.https://doi.org/10.1007/s11947-023-03214-x
Skog K, Augustsson K, Steineck G, Stenberg M & Jägerstad M (1997) Polar and non-polar heterocyclic amines in cooked fish and meat products and their corresponding pan residues. Food and Chemical Toxicology. 35(6), 555–565.https://doi.org/10.1016/S0278-6915(97)00021-5
St. Angelo AJ, Vercellotti J, Jacks T & Legendre M (1996) Lipid oxidation in foods. Critical Reviews in Food Science and Nutrition. 36(3), 175–224.https://doi.org/10.1080/10408399609527723
Wang X, McClements DJ & Xu Z (2023) Recent advances in the optimization of the sensory attributes of fried foods: Appearance, flavor, and texture. Trends in Food Science & Technology. 138, 297–309.https://doi.org/10.1016/j.tifs.2023.06.012
Wann AI, Percival BC, Woodason K, Gibson M, Vincent S & Grootveld M (2021) Comparative 1H NMR-Based Chemometric Evaluations of the Time-Dependent Generation of Aldehydic Lipid Oxidation Products in Culinary Oils Exposed to Laboratory-Simulated Shallow Frying Episodes: Differential Patterns Observed for Omega-3 Fatty Acid-Containing Soybean Oils. In: Foods, vol 10. vol 10. p^pp.
Wu R, Jiang Y & Qin R (2022) Study of the formation of food hazard factors in fried fish nuggets. Food Chemistry. 373, 131562.https://doi.org/10.1016/j.foodchem.2021.131562
Xue Q, Liu X, Russell P, Li J, Pan W, Fu J & Zhang A Evaluation of the binding performance of flavonoids to estrogen receptor alpha by Autodock, Autodock Vina and Surflex-Dock. (1090–2414 (Electronic)).
Zhang J, Zhang W, Zhang Y, Huang M & Sun B (2021) Effects of Food Types, Frying Frequency, and Frying Temperature on 3-Monochloropropane-1,2-diol Esters and Glycidyl Esters Content in Palm Oil during Frying. In: Foods, vol 10. vol 10. p^pp.
Zhang Q, Saleh ASM, Chen J & Shen Q (2012) Chemical alterations taken place during deep-fat frying based on certain reaction products: A review. Chemistry and Physics of Lipids. 165(6), 662–681.https://doi.org/10.1016/j.chemphyslip.2012.07.002
Zhang T, Song SS & Liu M (2023) Association of Fried Food Intake with Gastric Cancer Risk: A Systemic Review and Meta-Analysis of Case-Control Studies. Nutrients(2072–6643 (Electronic)).https://doi.org/LID − 10.3390/nu15132982 [doi] LID − 2982
Zhao JC, Mu YL, Gu XY, Xu XN, Guo TT & Kong J (2022) Site-directed mutation of β-galactosidase from Streptococcus thermophilus for galactooligosaccharide-enriched yogurt making. Journal of Dairy Science. 105(2), 940–949.https://doi.org/10.3168/jds.2021-20905
Zhong G-C, Zhu Q, Gong J-P, Cai D, Hu J-J, Dai X & Gong J-H (2022) Fried food consumption and the risk of pancreatic cancer: A large prospective multicenter study. Frontiers in Nutrition. 9.

No competing interests reported.

suporttinginformation.docx

Download PDF

Journal Publication

published 07 Jul, 2024

Read the published version in Food and Bioprocess Technology →

Editorial decision: Revision requested
24 May, 2024
Reviews received at journal
23 May, 2024
Reviewers agreed at journal
10 May, 2024
Reviews received at journal
23 Mar, 2024
Reviewers agreed at journal
13 Mar, 2024
Reviewers invited by journal
13 Mar, 2024
Editor assigned by journal
21 Feb, 2024
Submission checks completed at journal
20 Feb, 2024
First submitted to journal
20 Feb, 2024

You are reading this latest preprint version

Cloning and expression of acetaldehyde dehydrogenase from archaea and its application in acrylamide elimination from fried foods

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1 Materials

2.2 Methods

2.2.1 Cloning of SufALDH

2.2.2 Determination of ALDH

2.2.3 Expression of SufALDH and its properties

2.2.4 Acetaldehyde elimination from fried foods by SufALDH

2.2.4.1 Standard curve

2.2.4.2 Determination of acetaldehyde content in the fried food products

2.2.4.3 Preparation of acrylamide standard curve and analysis of acrylamide content in food samples

2.2.4.4 Mass spectrometric analysis

2.2.4.5 Determination of acrylamide content

2.2.5 Mechanism exploration of acetaldehyde elimination

2.2.6 Data analysis

3. Results and analysis

3.1 Recombinant vector construction, transformation, and expression of SufALDH

3.2. Properties of SufALDH

3.3 Detection of aldehyde in samples

3.3.1 Standard curves

3.3.2 Recovery rate of acetaldehyde after SufALDH treatment of fried food products

3.3.3 Aldehyde content in fried food products

3.4 Acrylamide concentration in fried food products

3.5 Mechanism exploration of acetaldehyde elimination

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1