Indole-3-propionic acid improves cardiac function in septic cardiomyopathy through the AhR/NF-κB/NLRP3 pathway

doi:10.21203/rs.3.rs-3993405/v1

Download PDF

Research Article

Indole-3-propionic acid improves cardiac function in septic cardiomyopathy through the AhR/NF-κB/NLRP3 pathway

https://doi.org/10.21203/rs.3.rs-3993405/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Sepsis patients frequently develop septic cardiomyopathy. It is well known that sepsis-induced cardiomyopathy is closely related to excess inflammatory responses. Indole-3-propionic acid (IPA) is a tryptophan metabolite that has anti-inflammatory properties in many different diseases. In our research, we investigated IPA's underlying mechanisms and therapeutic role in septic cardiomyopathy.

Methods

To investigate IPA’s role in septic cardiomyopathy, a lipopolysaccharide (LPS)-induced rat model of septic cardiomyopathy was constructed, and rats were treated with IPA. Inflammatory factors and the NF-kB/NLRP3 pathway were evaluated in myocardial tissues and cells after the IPA treatment using RT-qPCR, ELISA, Western blot, and immunohistochemistry. To elucidate the role of the aryl hydrocarbon receptor (AhR), we detected the changes of inflammatory mediators and the NF-κB/NLRP3 pathway in cardiomyocytes treated by CH-223191 and FICZ.

Results

IPA supplementation improved cardiac dysfunction in septic cardiomyopathy rats. IPA reduced inflammatory cytokine release and inhibited NF-κB/NLRP3 signaling activity in myocardial tissue and in H9c2 cells. We found that CH-223191 blocked IPA's anti-inflammatory effect in LPS-treated cells, while FICZ exerted the same effect as IPA. We further found that IPA exhibited anti-inflammatory effects through binding to AhR. Our results indicated that IPA attenuated septic cardiomyopathy in rats via the AhR/NF-κB/NLRP3 signaling.

Conclusion

The study found that IPA improved left heart dysfunction and myocardial inflammation caused by sepsis via the AhR/NF-κB/NLRP3 signaling. This suggested that IPA could be a potential therapy for septic cardiomyopathy.

Indole-3-propionic acid

Septic cardiomyopathy

Cardiac function

Inflammation

Aryl hydrocarbon receptor

Systemic inflammatory response syndrome (SIRS), defined as sepsis, is a condition induced by infection or infectious factors. Unless controlled promptly, it can further progress to septic shock, which can be life-threatening[1]. Sepsis is still a major threat to global health despite declining morbidity and mortality. In 2017, there were 48.9 million cases of sepsis and 11 million deaths linked to sepsis worldwide, accounting for 19.7% of all deaths. [2, 3]. Septic cardiomyopathy is a common complication of sepsis or septic shock. Septic cardiomyopathy typically manifests as left ventricular dilatation, reduced ejection fraction, and decreased contractility[4]. The pathogenesis of sepsis-induced cardiac dysfunction includes dysregulation of inflammatory mediators, mitochondrial dysfunction, oxidative stress, and endothelial dysfunction[5]. Inhibiting one or more of these processes would be of great therapeutic significance for septic cardiomyopathy.

In the last few years, increasing researches have paid attention to the function of intestinal flora metabolites. These metabolites are biologically active and have a variety of functions. Indole-3-propionic acid (IPA) is an intestinal flora metabolite of dietary tryptophan[6]. Various effects of IPA have been demonstrated in different studies. Heng Fang et al. found that IPA attenuated sepsis by improving intestinal flora disorders in septic mice[7]. In addition, multiple studies have shown that IPA could reduce inflammation in myocytes[8], chondrocytes[9], the central nervous system[10], the liver[11], and the colon[12]. Therefore, IPA has anti-inflammatory effects in several organs, but the role of IPA in septic cardiomyopathy and cardiomyocytes is still unclear.

AhR (aryl hydrocarbon receptor) is a ligand-activated transcription factor. It has been reported that IPA could alleviate metabolic disorders[13] and attenuate inflammation through its receptor AhR[9, 14]. The Toll-like receptor 4 (TLR4), nuclear factor-kappaB (NF-κB) and NOD-like receptor 3 (NLRP3) pathways have gained much attention in septic cardiomyopathy over the past few years. Various researches have shown that the suppression of the TLR4/NF-κB/NLRP3 pathway could improve left ventricular dysfunction and alleviate myocardial inflammation in septic cardiomyopathy mice[15, 16]. Additionly, Jing Sun et al. revealed that IPA upregulated AhR production, inhibited the NF‐κB/NLRP3 signaling pathway, and reduced the release of the inflammatory cytokines in APP/PS1 mice[17]. Heng Fang et al. also demonstrated IPA exerted neuroprotective effects in sepsis-related encephalopathy mice by inhibiting NLRP3 inflammasome[18]. Therefore, we assume that IPA supplementation inhibits the TLR4/ NF‐κB/NLRP3 signaling pathway and attenuates myocardial injury in septic cardiomyopathy rats.

We assessed the role of IPA in the animal model of septic cardiomyopathy. Our findings indicated that IPA potentially enhanced cardiac function through the AhR/NF -κB/NLRP3 axis. This study is the first to investigate the therapeutic benefits of IPA in septic cardiomyopathy, providing new insights into the treatment of septic cardiomyopathy.

2.1. Materials

LPS and IPA were obtained from Sigma (St Louis, MO, USA). AhR agonist FICZ and AhR antagonist CH-223191 were purchased from Medchem Express (Shanghai, China). Primary antibodies against IL-1β, IL-6, TNF-α, Myd88, Caspase1, NLRP3, and CD68 were purchased from Abcam (Cambridge, UK). Primary antibodies against NF-κB p65 and Phospho-NF-κB p65 were acquired from Cell Signaling Technology (Danvers, MA, USA). Primary antibodies against GAPDH and Vinculin were purchased from Proteintech Group (Rosemont, USA). The secondary antibodies against rabbits and mice were acquired from Cell Signaling Technology (Danvers, MA, USA). ELISA kits for rat cardiac troponin T (c-TnT) and brain natriuretic peptide (BNP) levels were obtained from Elabscience Biotechnology (Wuhan, China). H9c2 cells were purchased from Procell Life Science&Technology Co, Ltd. (Wuhan, China). All other chemicals in this study were analytical grade.

2.2. Animals

The Animal Care and Use Committees of Xi'an Jiaotong University (Xi'an, Shaanxi, China) approved all animal procedures for animal welfare. The experiments followed the Guide for the Care and Use of Laboratory Animals (National Academies Press, 2011). The rats were maintained at 26°C under a 12:12 h light/12:12 h dark cycle for two weeks prior to the experiment, with free access to food and water.

Male Sprague Dawley rats (8 weeks) were purchased from Beijing Vital River Laboratory Animal Technology (Beijing, China). The rats were randomly divided into the following four groups. (1) Control group (Control): Rats were intraperitoneally administered with saline. (2) LPS group (LPS): Rats were intraperitoneally administered with LPS (10 mg/kg)[19]. (3) IPA group (IPA): Rats were treated with IPA (20 mg/kg/day)[9, 11] by gavage for seven consecutive days before saline injection. (4) LPS + IPA group (LPS + IPA): Rats were treated with IPA (20 mg/kg/day) by gavage for seven consecutive days before LPS injection.

2.3. Echocardiography

Echocardiograms were performed on rats using a MyLab ultrasound (Esaote SpA, Genoa, Italy) after they were anesthetized with isoflurane. Cardiac function was evaluated 24 hours after saline or LPS administration, and the following parameters were collected: ejection fraction (EF), fractional shortening (FS), left ventricle (LV) end-systolic diameter (LVEDd), and LV end-diastolic diameter (LVEDs).

2.4. ELISA

At the end of the experiment, the rats were sacrificed and the serum was collected. The levels of cTn-T and BNP protein in serum were determined in accordance with the manufacturer's instructions.

2.5. Immunohistochemistry

After dewaxing, dehydration, and antigen repair, heart tissue sections were treated with 3% H2O2 for 10 minutes and 10% goat serum for 30 minutes at 37°C to remove endogenous peroxidase. The slides were then incubated overnight at 4°C in a CD68 primary antibody solution. The sections were subsequently incubated with a secondary antibody against rabbit IgG at 37°C for 1 hour and with DAB for 5 minutes at room temperature. Finally, the sections were observed under a microscope and photographed.

2.6. Cell culture and treatment

H9c2 cells were cultured in high-glucose Dulbecco's modified eagle medium (DMEM, Gibco) with 1% penicillin/streptomycin and fetal bovine serum (FBS, 10%). When the cell density reached 70–80%, H9c2 cells were primed with different drug treatments. The group was as follows: (1) control group; (2) LPS group: The cells were exposed LPS for 24h to induce cardiomyocyte injury; (3) IPA (500µM) group[11]; (4) LPS + IPA (500µM) group: The cells were treated with LPS and IPA for 24h; (5) LPS + IPA + CH-223191 (10µmol/ml) group[20]: H9c2 cells were treated with CH-2232191 2 h before LPS and IPA stimulation; (6) LPS + FICZ (400nM) group[21]: The cells were treated with LPS and FICZ for 24h. After these treatments, cells of different groups were collected for protein or RNA extraction and analysis.

2.7. Western blot

The proteins and cell lysates from the ventricle tissue were extracted using RIPA. 40 µg of proteins were separated on SDS/PAGE gels and transferred to 0.22 µm PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked with 5% non-fat milk in TBS containing 0.1% Tween-20 (TBST) for 1 hour and then incubated with primary antibodies overnight at 4°C. After washing for 30 minutes, the membranes were incubated with the appropriate secondary antibodies for 1 hour at room temperature. After washing for 30 minutes, the membranes were visualised using a chemiluminescence apparatus. The band intensities were measured and quantified using Image J software.

2.8. Real-time PCR

The RNA from the cells was isolated using the RNA Isolation Kit (Takara, 9767) following the manufacturer's protocol. Subsequently, cDNA was synthesized using the PrimeScript RT kit (Takara, RR047A). The target genes were amplified and quantified using Fast Start Essential DNA Green Master (Roche, 06924204001). The data obtained was analyzed using the 2 − ΔΔCq method, with GAPDH serving as the internal standard control. The primers used in our study are presented as follows: GGCACAGTCAAGGCTGAGAATG (forward) and ATGGTGGTGAAGACGC-CAGTA (reverse) for rat GAPDH; CCGTTTCTACCTGGAGTTTGT (forward) and GTTTGCCGAGTAGACCTCATAG (reverse) for rat IL-6; CGTGTTCAT-CCGTTCTCTACC (forward) and GCAATCCAGGCCACTACTT (reverse) for rat TNF-α.

2.9. Statistical analysis

All results in our study were presented as the mean ± SD and analyzed using the GraphPad Prism 9.0 software. The differences between the 2 groups were compared by Student's unpaired t-test. Multiple comparisons among different groups were analyzed by one-way ANOVA followed by Bonferroni’s test (multiple groups). Statistical significance was considered when P < 0.05.

3.1. IPA improved cardiac dysfunction in septic cardiomyopathy

We investigated the effects of IPA on cardiac function and myocardial damage in the rat model of septic cardiomyopathy. Our data revealed that IPA ameliorated LPS-induced left ventricular dysfunction and improved LVEF and FS (Fig. 1A-D). In addition, we examined the levels of serum BNP and Troponin T in every group. The results showed that IPA administration could reverse the elevated BNP and Troponin T after LPS stimulation, which in turn reduced myocardial damage (Fig. 1E, F). Therefore, we concluded that IPA treatment could prevent LPS-induced cardiac damage.

3.2. IPA attenuated cardiac inflammation in septic cardiomyopathy

We detected changes in inflammatory factors in rat myocardium. Compared with the control group, the expressions of IL-1β, IL-6, and TNF-α were significantly elevated in the LPS group. However, after IPA administration, the levels of IL-1β, IL-6, and TNF-α were significantly reduced (Fig. 1A-D). In addition, we examined macrophage infiltration of myocardial tissues in every group. The data demonstrated that macrophage infiltration was attenuated in myocardial tissues of septic cardiomyopathy rats supplemented with IPA (Fig. 2E, F).

3.3. IPA inhibited the NF-κB/NLRP3 signaling pathway in septic cardiomyopathy

We evaluated the effects of IPA on myocardial inflammatory pathways in septic cardiomyopathy rats. The results indicated that the protein levels of MyD88 and NF-kB, downstream proteins of TLR4, were increased with LPS challenge (Fig. 3A-C). Besides, the expressions of Caspase1 and NLRP3 were significantly increased in septic cardiomyopathy, suggesting the activation of NLRP3 inflammasome (Fig. 3D, E). However, IPA supplementation inhibited the activation of the above proteins. Thus, we demonstrated that IPA suppressed the activation of NF-κB/NLRP3 signaling pathway in LPS-treated rats.

3.4. IPA reduced inflammation and inhibited NF-κB/NLRP3 signaling in cell model of septic cardiomyopathy

We examined the anti-inflammatory effects of IPA in in vitro models. The results showed that the mRNA expression levels of IL-6 and TNF-α were significantly elevated in H9c2 cells after LPS stimulation (Fig. 4A, B). However, their elevated expressions were reversed after IPA treatment. We also checked the effect of IPA on the NF-κB/NLRP3 signaling pathway in LPS-treated cells. We also checked the impact of IPA on the NF-κB/NLRP3 pathway in LPS-treated cells. Likewise, the LPS-induced up-regulation of proteins such as MyD88, NF-κB and NLRP3 was reversed by IPA treatment. (Fig. 4C-H). Our data demonstrated that IPA played a protective role by inhibiting the inflammatory response.

3.5. Protective effects of IPA were dependent on AhR

IPA has been shown to exert its anti-inflammatory activity via the AhR in previous studies. [9, 14]. Hence, our hypothesis was that IPA may exert cardioprotective effects via the AhR. We treated H9c2 cells with AhR antagonist, CH-223191. Consistent with previous results, IPA could reverse the expression of IL-6 and TNF-α, and supress the NF-κB/NLRP3 signaling pathway. After CH-223191 treatment, the mRNA expressions of inflammatory factors were elevated (Fig. 5A, B), and NF-κB/NLRP3 pathway-related proteins were activated (Fig. 5C-H). These results indicated that the cardioprotective effect about IPA depended on AhR activation.

3.6. The activation of AhR inhibited inflammation and NF-κB/NLRP3 signaling

To further explore the effect of AhR, H9c2 cardiomyocytes were treated with AhR agonist FICZ. RT-PCR results showed that FICZ reduced the expression of IL-6 and TNF-α (Fig. 6A, B). We also examined the effect of FICZ on the NF-κB/NLRP3 pathway in LPS-treated cardiomyocytes. The upregulations of MyD88, NF-κB, and NLRP3 were reversed with FICZ treatment (Fig. 6C-H). The above results demonstrated that the activation of AhR exerted an anti-inflammatory effect, which was consistent with the results of IPA-treated cells.

IPA inhibited cardiomyocyte inflammation and attenuated cardiac dysfunction in septic cardiomyopathy through the AhR/NF-kB/NLRP3 mechanism. Our in vivo findings showed that IPA protected cardiac function by attenuating cardiomyocyte inflammation. Furthermore, vitro researches have demonstrated IPA activated AhR and thus inhibited the NF-κB/NLRP3 pathway in cardiomyocytes. Our data indicated IPA had protective effects on septic cardiomyopathy.

Sepsis has been defined as a dysregulated host response to infection, which results in life-threatening multiple organ dysfunction²². A prolonged inflammatory state may lead to persistent organ damage and long-term mortality[22]. Sepsis often causes congestive heart failure with reduced EF, which worsens the patients' prognosis and increases the mortality[23, 24]. Several researches have tried to elucidate the pathophysiological mechanisms of septic cardiomyopathy. Release of inflammatory factors, infiltration of macrophages and activation of inflammatory pathways have been observed in LPS-treated animal models.[15, 25]. These studies suggest that inflammation in cardiomyocytes contributes to the progression of septic cardiomyopathy. Our study showed that intraperitoneal injection of LPS (10 mg/kg) into rats for 24 h not only induced septic myocardial dysfunction, but also promoted the expression of inflammatory factors in cardiac tissue, including IL-1β, TNF-α and IL-6.

The NF-κB/NLRP3 signaling pathway is critical in the pathophysiology of septic cardiomyopathy. Upon LPS stimulation, TLR4 was specifically activated, followed by activation of the downstream NF-κB/NLRP3 signaling pathway to produce inflammatory cytokines [26, 27]. IL-1β, TNF-α, and IL-6 are major inflammatory factors contributing to myocardial dysfunction in sepsis. NF-κB is activated and upregulates NLRP3 expression following LPS recognition by TLR4. NLRP3 inflammasome participated in the development of septic cardiomyopathy, and inhibition of the NLRP3 signaling axis reduced LPS-induced cardiac injury[28]. In the current study, we examined the changes in NF-κB/NLRP3 pathway-related proteins in septic cardiomyopathy. We found that the NF-κB/NLRP3 pathway was activated in LPS-treated group in vivo models. We acquired the same results by treating H9c2 cells with LPS. Our results confirmed the rapid and severe cardiac inflammation damage caused by sepsis.

Gut microbiota and its metabolites are associated with human health and disease[29–31]. Tryptophan is an essential amino acid that is critical for maintaining physiological homeostasis. In the intestine, dietary tryptophan is mainly converted to IPA via Clostridium sporogenes[32]. IPA has been proven to regulate intestinal barrier function and decrease intestinal inflammation through binding to the pregnane X receptor (PXR)[33, 34]. In septic mice, IPA ameliorated sepsis-induced mortality by modulating intestinal flora and reduced serum levels of inflammatory cytokines[7]. In human and murine models of sepsis, IPA improved survival and host control of infection[14]. IPA supplementation attenuates diastolic dysfunction, oxidative stress, inflammation, and intestinal epithelial barrier damage in the preserved ejection fraction (HFpEF) mouse model[35]. Our study showed that IPA treatment attenuated cardiac dysfunction and myocardial inflammatory injury in septic cardiomyopathy rats. Similarly, IPA inhibited the NF-κB/NLRP3 pathway activation and reduced the expression of inflammatory factors in LPS-treated H9c2 cells.

AhR is a ligand-activated transcription factor that integrates environmental, dietary, microbial, and metabolic cues to regulate complex transcriptional programs[36]. AhR is expressed in multiple tissues and is involved in many aspects of health and disease. Increasing studies have shown that endogenous metabolites performed anti-inflammatory effects in various tissues by activating AhR. Zhuang et al. found that 3-IAld (Indole-3-aldehyde) attenuated inflammation in IL-1β-induced chondrocytes through AhR/NF-κB signaling pathway[37]. Qiao et al. revealed that quinolinic acid suppressed NLRP3 inflammasome activation and inflammatory cytokine secretion through activating AhR in a model of psoriasis[38]. Moreover, dietary supplementation with tryptophan or AhR ligands protected mice from E. coli-induced mastitis by activating the AhR[39]. These studies demonstrated that AhR activation could inhibit the NF-kB/NLRP3 pathway, which in turn exerted anti-inflammatory effects. Our results demonstrated that inhibition of the AhR diminished the anti-inflammatory effects of IPA, and activation of the AhR produced the same anti-inflammatory effects. This revealed that the endogenous ligand IPA suppressed the NF-κB/NLRP3 signaling pathway through activation of AhR.

Our study has some limitations. A major shortcoming is that our exploration of AhR function was limited to cells and in future studies we should investigate it in animal models. In addition, our animal and cellular models were obtained from rats, whereas primary cardiomyocyte samples from human patients would make this work even more meaningful.

Collectively, our results demonstrated that IPA attenuated LPS-treated cardiomyocyte inflammation and suppressed NF-κB/NLRP3 signaling through AhR, which effectively improved cardiac function and alleviated myocardial inflammation in septic cardiomyopathy rat models. This offered a potentially therapeutic strategy for septic cardiomyopathy.

Funding

This work was supported by the National Key R&D Program of China (2019YFA0802300 to Yue Wu).

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Contributions

All authors contributed to the study conception and design. Yiqiong Zhang performed animal experiments and all in vitro experiments. Shanshan Li performed histologic analysis. Yiqiong Zhang and Shanshan Li analyzed the data. Yue Wu and Xiaojuan Fan supervised the work. All authors read and approved the final paper.

Ethics declarations

Competing interests

The authors declare no competing interests.

Cecconi M, Evans L, Levy M, Rhodes A: Sepsis and septic shock. Lancet 2018, 392(10141):75–87.
Rudd KE, Johnson SC, Agesa KM, Shackelford KA, Tsoi D, Kievlan DR, Colombara DV, Ikuta KS, Kissoon N, Finfer S et al: Global, regional, and national sepsis incidence and mortality, 1990–2017: analysis for the Global Burden of Disease Study. Lancet 2020, 395(10219):200–211.
Kempker JA, Martin GS: A global accounting of sepsis. Lancet 2020, 395(10219):168–170.
Flynn A, Mani BC, Mather PJ: Sepsis-induced cardiomyopathy: a review of pathophysiologic mechanisms. Heart Fail Rev 2010, 15(6):605–611.
Liu YC, Yu MM, Shou ST, Chai YF: Sepsis-induced Cardiomyopathy: Mechanisms and Treatments. Front Immunol 2017, 8.
Su XM, Gao YH, Yang RC: Gut Microbiota-Derived Tryptophan Metabolites Maintain Gut and Systemic Homeostasis. Cells-Basel 2022, 11(15).
Fang H, Fang MX, Wang YR, Zhang HD, Li JX, Chen JC, Wu QR, He LL, Xu J, Deng J et al: Indole-3-Propionic Acid as a Potential Therapeutic Agent for Sepsis-Induced Gut Microbiota Disturbance. Microbiol Spectr 2022, 10(3).
Du L, Qi RL, Wang J, Liu ZH, Wu ZL: Indole-3-Propionic Acid, a Functional Metabolite of, Promotes Muscle Tissue Development and Reduces Muscle Cell Inflammation. Int J Mol Sci 2021, 22(22).
Zhuang HM, Ren XS, Jiang FZ, Zhou PH: Indole-3-propionic acid alleviates chondrocytes inflammation and osteoarthritis via the AhR/NF-κB axis. Mol Med 2023, 29(1).
Rothhammer V, Mascanfroni ID, Bunse L, Takenaka MC, Kenison JE, Mayo L, Chao CC, Patel B, Yan R, Blain M et al: Type I interferons and microbial metabolites of tryptophan modulate astrocyte activity and central nervous system inflammation via the aryl hydrocarbon receptor. Nat Med 2016, 22(6):586-+.
Zhao ZH, Xin FZ, Xue YQ, Hu ZM, Han YM, Ma FG, Zhou D, Liu XL, Cui AY, Liu ZS et al: Indole-3-propionic acid inhibits gut dysbiosis and endotoxin leakage to attenuate steatohepatitis in rats. Experimental and Molecular Medicine 2019, 51.
Li KY, Hao ZH, Du JY, Gao YM, Yang SY, Zhou YL: relieves colon inflammation by activating aryl hydrocarbon receptor and modulating CD4T cell homeostasis. International Immunopharmacology 2021, 90.
Niu B, Pan T, Xiao Y, Wang HC, Zhu JL, Tian FW, Lu WW, Chen W: The therapeutic potential of dietary intervention: based on the mechanism of a tryptophan derivative-indole propionic acid on metabolic disorders. Crit Rev Food Sci 2023.
Huang ZB, Hu Z, Lu CX, Luo SD, Chen Y, Zhou ZP, Hu JJ, Zhang FL, Deng F, Liu KX: Gut microbiota-derived indole 3-propionic acid partially activates aryl hydrocarbon receptor to promote macrophage phagocytosis and attenuate septic injury. Front Cell Infect Mi 2022, 12.
Luo M, Yan DS, Sun QS, Tao JL, Xu L, Sun H, Zhao HM: Ginsenoside Rg1 attenuates cardiomyocyte apoptosis and inflammation via the TLR4/NF-kB/NLRP3 pathway. J Cell Biochem 2020, 121(4):2994–3004.
Liu Q, Zhu J, Kong B, Shuai W, Huang H: Tirzepatide attenuates lipopolysaccharide-induced left ventricular remodeling and dysfunction by inhibiting the TLR4/NF-kB/NLRP3 pathway. International Immunopharmacology 2023, 120.
Sun J, Zhang YH, Kong Y, Ye T, Yu QX, Satyanarayanan SK, Su KP, Liu JM: Microbiota-derived metabolite Indoles induced aryl hydrocarbon receptor activation and inhibited neuroinflammation in APP/PS1 mice. Brain Behavior and Immunity 2022, 106:76–88.
Fang H, Wang YR, Deng J, Zhang HD, Wu QR, He LL, Xu J, Shao X, Ouyang X, He ZM et al: Sepsis-Induced Gut Dysbiosis Mediates the Susceptibility to Sepsis-Associated Encephalopathy in Mice. Msystems 2022, 7(3).
Zhu XF, Sun M, Guo HM, Lu G, Gu JH, Zhang LL, Shi LC, Gao J, Zhang DD, Wang WJ et al: Verbascoside protects from LPS-induced septic cardiomyopathy via alleviating cardiac inflammation, oxidative stress and regulating mitochondrial dynamics. Ecotox Environ Safe 2022, 233.
Volkova M, Palmeri M, Russell KS, Russell RR: Activation of the aryl hydrocarbon receptor by doxorubicin mediates cytoprotective effects in the heart. Cardiovascular Research 2011, 90(2):305–314.
Li YY, Wang XJ, Su YL, Wang Q, Huang SW, Pan ZF, Chen YP, Liang JJ, Zhang ML, Xie XQ et al: Baicalein ameliorates ulcerative colitis by improving intestinal epithelial barrier via AhR/IL-22 pathway in ILC3s. Acta Pharmacol Sin 2022, 43(6):1495–1507.
Delano MJ, Ward PA: Sepsis-induced immune dysfunction: can immune therapies reduce mortality? Journal of Clinical Investigation 2016, 126(1):23–31.
Arfaras-Melainis A, Polyzogopoulou E, Triposkiadis F, Xanthopoulos A, Ikonomidis I, Mebazaa A, Parissis J: Heart failure and sepsis: practical recommendations for the optimal management. Heart Fail Rev 2020, 25(2):183–194.
Wardi G, Joel I, Villar J, Lava M, Gross E, Tolia V, Seethala RR, Owens RL, Sell RE, Montesi SB et al: Equipoise in Appropriate Initial Volume Resuscitation for Patients in Septic Shock With Heart Failure: Results of a Multicenter Clinician Survey. J Intensive Care Med 2020, 35(11):1338–1345.
Guo T, Jiang ZB, Tong ZY, Zhou Y, Chai XP, Xiao XZ: Shikonin Ameliorates LPS-Induced Cardiac Dysfunction by SIRT1-Dependent Inhibition of NLRP3 Inflammasome. Front Physiol 2020, 11.
Yan JH, Zhang JW, Wang YA, Liu H, Sun XP, Li AX, Cui PF, Yu LM, Yan XF, He ZY: Rapidly Inhibiting the Inflammatory Cytokine Storms and Restoring Cellular Homeostasis to Alleviate Sepsis by Blocking Pyroptosis and Mitochondrial Apoptosis Pathways. Adv Sci 2023, 10(14).
Guo YJ, Zhang HQ, Lv Z, Du YA, Li D, Fang H, You J, Yu LJ, Li R: Up-regulated CD38 by daphnetin alleviates lipopolysaccharide-induced lung injury via inhibiting MAPK/NF-κB/NLRP3 pathway. Cell Commun Signal 2023, 21(1).
Li N, Zhou H, Wu HM, Wu QQ, Duan MX, Deng W, Tang QZ: STING-IRF3 contributes to lipopolysaccharide-induced cardiac dysfunction, inflammation, apoptosis and pyroptosis by activating NLRP3. Redox Biology 2019, 24.
Zhang T, Cheng JK, Hu YM: Gut microbiota as a promising therapeutic target for age-related sarcopenia. Ageing Res Rev 2022, 81.
Agus A, Clément K, Sokol H: Gut microbiota-derived metabolites as central regulators in metabolic disorders. Gut 2021, 70(6):1174–1182.
Tang WHW, Kitai T, Hazen SL: Gut Microbiota in Cardiovascular Health and Disease. Circ Res 2017, 120(7):1183–1196.
Dodd D, Spitzer MH, Van Treuren W, Merrill BD, Hryckowian AJ, Higginbottom SK, Le A, Cowan TM, Nolan GP, Fischbach MA et al: A gut bacterial pathway metabolizes aromatic amino acids into nine circulating metabolites. Nature 2017, 551(7682):648-+.
Venkatesh M, Mukherjee S, Wang HW, Li H, Sun K, Benechet AP, Qiu ZJ, Maher L, Redinbo MR, Phillips RS et al: Symbiotic Bacterial Metabolites Regulate Gastrointestinal Barrier Function via the Xenobiotic Sensor PXR and Toll-like Receptor 4. Immunity 2014, 41(2):296–310.
Li JJ, Zhang L, Wu T, Li YF, Zhou XJ, Ruan Z: Indole-3-propionic Acid Improved the Intestinal Barrier by Enhancing Epithelial Barrier and Mucus Barrier. J Agr Food Chem 2021, 69(5):1487–1495.
Wang Y-C, Koay YC, Pan C, Zhou Z, Tang W, Wilcox J, Li XS, Zagouras A, Marques F, Allayee H et al: Indole-3-Propionic Acid Protects Against Heart Failure With Preserved Ejection Fraction. Circ Res 2024, 134(4):371–389.
Rothhammer V, Quintana FJ: The aryl hydrocarbon receptor: an environmental sensor integrating immune responses in health and disease. Nat Rev Immunol 2019, 19(3):184–197.
Zhuang HM, Li B, Xie T, Xu CG, Ren XS, Jiang FZ, Lei TR, Zhou PH: Indole-3-aldehyde alleviates chondrocytes inflammation through the AhR-NF-ΚB signalling pathway. International Immunopharmacology 2022, 113.
Qiao P, Zhang C, Yu J, Shao S, Zhang J, Fang H, Chen J, Luo Y, Zhi D, Li Q et al: Quinolinic Acid, a Tryptophan Metabolite of the Skin Microbiota, Negatively Regulates NLRP3 Inflammasome through AhR in Psoriasis. Journal of Investigative Dermatology 2022, 142(8):2184–2193.e2186.
Zhao CJ, Hu XY, Bao LJ, Wu KY, Feng LJ, Qiu M, Hao HY, Fu YH, Zhang NS: Aryl hydrocarbon receptor activation by tryptophan metabolism alleviates-induced mastitis in mice. Plos Pathog 2021, 17(7).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Indole-3-propionic acid improves cardiac function in septic cardiomyopathy through the AhR/NF-κB/NLRP3 pathway

Status:

Version 1

Abstract

Figures

1. Introduction

2. Methods

2.1. Materials

2.2. Animals

2.3. Echocardiography

2.4. ELISA

2.5. Immunohistochemistry

2.6. Cell culture and treatment

2.7. Western blot

2.8. Real-time PCR

2.9. Statistical analysis

3. Results

3.1. IPA improved cardiac dysfunction in septic cardiomyopathy

3.2. IPA attenuated cardiac inflammation in septic cardiomyopathy

3.3. IPA inhibited the NF-κB/NLRP3 signaling pathway in septic cardiomyopathy

3.4. IPA reduced inflammation and inhibited NF-κB/NLRP3 signaling in cell model of septic cardiomyopathy

3.5. Protective effects of IPA were dependent on AhR

3.6. The activation of AhR inhibited inflammation and NF-κB/NLRP3 signaling

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1