Trimethylamine N-oxide Aggravates Neuro-inflammation via lncRNA Fendrr/miR-145-5p/PXN axis in Vascular Dementia Rats

doi:10.21203/rs.3.rs-3999274/v1

Download PDF

Research Article

Trimethylamine N-oxide Aggravates Neuro-inflammation via lncRNA Fendrr/miR-145-5p/PXN axis in Vascular Dementia Rats

https://doi.org/10.21203/rs.3.rs-3999274/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Vascular dementia (VaD) is the second most common dementia in the world, and our previous investigation demonstrated that Trimethylamine-N-oxide (TMAO) exacerbates cognitive impairment and neuropathological alterations in VaD rats. Thus, this study is to evaluate the potential mechanism of TMAO in VaD. The rats using the bilateral common carotid artery (2VO) model were administered TMAO (120 mg/kg) for 8 consecutive weeks, 4 weeks preoperatively and 4 weeks postoperatively. High-throughput sequencing was conducted to investigate the effects of TMAO treatment on lncRNA expression in rat hippocampus and bioinformatics analysis was performed to identify potential downstream targets. Learning and spatial memory capacities were measured, as well as inflammatory factors. Nissl staining was used to observe neuronal injury in the CA1 area of the hippocampus. TMAO administration upregulated lncRNA Fendrr expression in the rat hippocampus, while the damaging effects of TMAO were counteracted after knockdown of Fendrr. Fendrr exhibits highly expressed in 2VO rats and sponged miR-145-5p, which targets PXN. Silencing of Fendrr or PXN, or promotion of miR-145-5p improved neurological function injury, reduced neuronal damage, as well as repressed inflammation response. Inhibition of miR-145-5p abrogated up Fendrr knockdown mediated influence on 2VO rats. To summarize, the results of this study indicated that TMAO inhibits the miR-145-5p/PXN axis by increasing the Fendrr expression, thus exacerbating the development of VaD.

Trimethylamine N-oxide

Neuroinflammation

Fendrr

MiR-145-5p

PXN

Vascular dementia

Vascular dementia (VaD) is characterized by the loss of cognitive function caused by cerebrovascular and cardiovascular pathologic changes, mainly manifested as learning and memory dysfunction [1]. It has a poor prognosis, with a 5-year mortality rate of 61%, significantly higher than most dementia types [2]. The available therapeutic agents for VaD are cholinesterase inhibitors, but these drugs may cause a large range of adverse events, including headache, joint pain and gastrointestinal reactions, etc., while whether they can improve the patients is uncertain [2]. Meanwhile, previous studies have found that several regulatory mechanisms participate in the pathologic process of VaD, including inflammation, apoptosis, and oxidative stress [3, 4]. Therefore, there is an urgent need to further explore the pathological changes of VaD and the need for possible therapeutic targets.

The intestinal microbiota has been shown by a growing number of researchers to be strongly associated with human health [5, 6]. Trimethylamine N-oxide (TMAO) is a specialized metabolite processed by the intestinal microbiota. The intestinal microbiota processed certain ingested substances such as L-carnitine into trimethylamine (TMA), which is followed by transformation to TMAO via hepatic flavin monooxygenase 3 (FMO3) within the intestines [7]. More importantly, numerous studies indicate that TMAO is associated with neurological disorders. For instance, plasma concentrations of TMAO were positively related to NIHSS scores after stroke [8]. Patients with Alzheimer's disease (AD) had higher concentrations of TMAO in cerebrospinal fluid and increased TMAO was relevant to biomarkers of AD pathology and neuronal degeneration [9]. In addition, chronic choline diet-induced high plasma TMAO increased perihematomal inflammation in intracerebral hemorrhage mice [10]. Our previous study figured out that TMAO could impair cognitive function and activate the NLRP3 inflammasome in VaD rats [11]. However, the mechanism by which TMAO promotes VaD injury is currently unknown.

Long noncoding RNA (lncRNA) participates in a wide range of fundamental physiological and pathological process [12, 13]. Recently, lncRNAs have been found to be correlated with cerebrovascular disease. For instance, lncRNA Fendrr could upregulate VEGFA via miR-126, which promoted apoptosis of cerebral microvascular endothelial cells and thus exacerbated hypertensive intracerebral hemorrhage in mice [14]. Also, lncRNA Fendrr was observed to be involved in pyroptosis and inflammation of microglia in diabetes-cerebral ischemia/reperfusion (I/R) mice [15]. Nevertheless, the potential mechanisms of action of Fendrr in the development of VaD have not yet been explored. Therefore, this research was to explore the effects of TMAO on neuroinflammation in VaD and the downstream molecular mechanisms of lncRNAs involved, which could offer novel targets for the progression of pharmacotherapy for VD.

2.1 Ethics Statement

All animal experiments were approved by the Animal Ethics Committee of Nanjing First Hospital (protocol number: DWSY-2104386) and were carried out according to the National Institutes of Health “Guidelines for Care and Use of the Laboratory Animals”. Do everything possible to minimize animal suffering.

2.2 VaD animal model and corresponding treatment

Healthy adult male SD rats (8 weeks old; weight 280–300 g) were provided by the Model Animal Research Center of Nanjing University (Nanjing, China) and raised under the a 12-h dark/light cycle, appropriate temperature, suitable humidity and ad libitum feed. 4% isoflurane anesthetized the rats at 48 h before surgery. TMAO was administered and 2VO model was established following our previous research protocol [11]. In brief, The rats were anesthetized and bilateral common carotid arteries were isolated and ligated gently. The sham operation group performed the same procedure, but did not include the ligating step. The 2VO rats were continuously administered TMAO before and after surgery, while the rats were instilled with sterile water in the sham group.

TMAO (catalog number: 317594, purity: 95%, CAS: 1184-78-7) was purchased from Sigma-Aldrich. The lentivirus vectors (LV-sh-Fendrr, agomir-145-5p, antagomir-145-5p, and LV-sh-PXN ) and lentiviral vector negative control were supplied by GenePharma (Shanghai, China). As previously reported [16], lentivirus vectors were injected into the CA1 area of hippocampus 7 days before 2VO surgery. First, the stereotaxic devicefixed the anesthetized rats (RWD LifeScience, CA, USA ). Injection axes was as flows with reference to bregma: mediolateral, ± 3.2 mm; anteroposterior, − 4.52 mm; dorsoventral − 3.16 mm using coordinates under the surface of skull. Two microliters of lentiviral vector were injected into the hippocampal CA1 region using a 10 µL syringe (Hamilton). After the injection is over, the needle was held in place for a moment and then removed extremely slowly to prevent he solution from flowing back. After removal of the needle, the drill holes were closed with bone wax and the incisions were sutured to rehabilitate the rats.

2.3 LncRNA Sequencing

The Gene Denovo Biotechnology Co., Ltd (Guangzhou, China) provided the RNA-sequencing analysis. Total RNA was extracted from rat hippocampal tissue using the Trizol kit (Life Technologies, CA, USA) and the sample RNA quality was evaluated by a 2100 Bioanalyzer (Agilent Technologies, CA, USA). After removing the ribosomal RNA, the total RNA obtained was reverse-transcribed to cDNA and then quantified as well as pooled using the ABI StepOnePlus Real-Time PCR System (Life Technologies). Finally, we performed up-sequencing according to the PE150 mode of Illumina novaseq 6000. Raw reads containing splice or low-quality bases were filtered by fastp (version 0.18.0). Ribosomal RNA (rRNA) was removed using the comparison tool bowtie2, and clean reads of paired ends were compared to a reference genome (Rattus norvegicus Ensembl_release106) using HISAT2 (version 2.1.0). StringTie software was used to perform quantitative analysis of lncRNA. Genes differential expression analysis was performed by DESeq2 software. Parameter |log2(Foldchange)| ≥ 1 and P-value < 0.05 were defined as significantly differentially expressed lncRNAs. The sequencing database is archived in GenBank (GSE249873).

2.4 Functional enrichment analysis

The predicted differentially expressed mRNAs were analyzed by Gene Ontology (GO) analyses and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis using the R package clusterProfiler. The p-value of < 0.05 was deemed significant for statistical analysis.

2.5 Open Field Test (OFT)

The rats were placed in the center of a square black box and were allowed to move freely. The camera connected to an Any-maze® tracker recorded and calculated (New Soft Information Technology Co., Ltd.™., Shanghai, China) the time spent by the rats and the total travel distance into the center. After each trial, the chamber was washed with 75% ethanol and left to dry to avoid olfactory cues.

2.6 Morris Water Maze Test (MWM)

The water maze device, which is equally divided into four quadrants was employed and a transparent circular stage was under the water surface. Every rat was exposed to four training trials on 5 successive days. The rats were randomly put in the water from four quadrants each day until they found the stage and stayed for 15 s out of 60 s. When the stage was not found less than 60 s, the rats were brought into the stage. On the second day of the last trial, the path length of the rats to reach the stage was recorded by the video tracker (Noldus Information Technology B.V.™, Wageningen, Netherlands) after moving out of the stage, and the means of the four trials were determined.

2.7 Nissl Staining

Nissl staining was used to detect Nissl bodies in neurons. The paraffin-embedded brain tissues of rats were cut into 5 µm-thick sections, which were stained with Nissl staining solution for 1 h at 56 ℃ (Solarbio, Beijing, China) after dewaxing and rehydration. Next, the sections were dried with gradient concentrations of ethanol, rinsed with xylene, and sealed with neutral gum. The sections were carefully observed and photographed with an Olympus microscope (Olympus™, Tokyo, Japan).

2.8 Luciferase report assay

The wild-type (wt) or mutant-type (mut) 3′-UTRs of Fendrr or PXN were cloned into the pmirGLO vector (Promega, USA). HEK-293 T cells were seeded in 24-well plates. When the fusion reached 70% − 80%, cells were co-transfected with wt or mut 3′-UTRs of Fendrr or PXN luciferase reporter plasmids, together with agomir-NC or agomir-145-5p by Lipofectamine 2000. The cells were harvested 24 h after transfection, and assayed for luciferase activity.

2.9 Fluorescence in Situ Hybridization (FISH)

FISH was applied to assay the localization of Fendrr, miR-145-5p and PXN expression in the sections of hippocampal tissue of 2VO rats with the FISH kit in accordance with the instructions of the manufacturer. In brief, the sections of paraffin-embedded hippocampus were soaked in xylene I (Guoyao, Shanghai, China) for 15 min, in xylene II for 15 min, and subsequently in pure ethanol (Guoyao, Shanghai, China) for 5 min. Then, the sections were digested with proteinase K (20 µg/mL, Servicebio, Wuhan, China) solution at 37°C for 25 min. For each section was added with the pre-hybridization solution (Riobo biotech, Guangzhou, China) for 1 h at 37°C. Hybridization buffer (Riobo biotech, Guangzhou, China) with 50 nM biotin-labeled lncFendrr (Gene Pharma, Shanghai, China) or miR-145-5p (Gene Pharma, Shanghai, China) was heated to 65 ℃ for 5 min and added dropwise to the sections, which were then allowed to hybridize at 37 ℃ overnight with or without anti-PXN (1:1000; #50195; CST; Boston, MA, USA). After washes and blocking, sections were incubated with DAPI (Servicebio, Wuhan, China) to stain the cell nuclei. The sections were observed with a Nikon upright fluorescence microscope (Nikon, Tokyo, Japan) and photographed. The sequence of the Fendrr probe was as follows: ATGTTCTAAATGTTTCTTGATTCTG; The sequence of the mir-145-5p probe was as follows: AGGGATTCCTGGGAAAACTGGAC.

2.10 RNA immunoprecipitation (RIP) assay

Ago2-RIP assays were carried out using an EZ-Magna RIP RNA kit (#17–704, Millipore, MA, USA). Hippocampal tissue was lysed in RIP lysis buffer and incubated with negative control IgG (Millipore, MA) or anti-Ago2 (#ab32381, Abcam) conjugated magnetic beads. Immunoprecipitated RNA was isolated by Proteinase K buffer and analyzed by RT-qPCR.

2.11 Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA of rat hippocampal tissues was isolated using Trizol reagent (Invitrogen, CA, USA). The obtained total RNA was reverse-transcribed to cDNA using the cDNA Synthesis Supermix kit (Takara, Japan). Then, the target genes were quantified with SYBR® Premix Ex TaqTM II (Takara, Japan) on the ABI 7500 fast real-time PCR system (Applied Biosystems, USA). The expression of target genes was analyzed by the 2^−ΔΔCT method using U6 and β-actin as internal references for miRNA and mRNA, respectively. Primer sequences are listed in Supplemental Table S1.

2.12 Western Blot Analysis

Rat hippocampal tissues were homogenized with RIPA lysate buffer and the protein concentration was quantified with a BCA Protein Assay Kit (Thermo Fisher Scientific, Inc.™, Carlsbad, CA, USA). Equal amounts of samples were used to perform sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The total protein was transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore), which is blocked with 5% skimmed milk for 2 hours. PVDF membrane was incubated with anti-PXN (1:1000; #50195; CST; Boston, MA, USA) or β-actin (1:1000, #4970; CST, Boston, MA, USA), overnight at 4 ^◦C, and anti-rabbit IgG HRP (1:4000; CST, Boston, MA, USA) for 2h at room temperature. The bands were finally visualized with the ECL kit (Millipore™, Merck, Darmstadt, Germany) and using the Image J to quantify the protein band density. All data were standardized to β-actin.

2.13 Enzyme-linked immunosorbent assay (ELISA)

TNF-α, IL-1β and IL-6 ELISA kits (Abcam, MA, USA) were used in accordance with the manufacturer’s instructions aimed to evaluate the inflammatory cytokine levels in the hippocampus. The levels of these cytokines were measured by absorbance using a micro enzyme-linked immunosorbent assay reader (Tecan, USA).

2.14 Statistical analysis

The experiments data were represented as the mean ± SD and analyzed by Prism 8 software (GraphPad™, San Diego, CA, USA). Comparison between the two groups weas made using the t-test, and comparison among multiple groups was adopted using one-way or two-way analysis of variance (ANOVA) followed by Tukey’s post-test. Each experiment was repeated at least 3 times. Data were deemed to be statistically significant when P < 0.05.

3.1 TMAO promoted hippocampal inflammatory response within 2VO Rats

To identify the role of TMAO treatment on function and signaling pathways in 2VO rats, we carried out GO enrichment analysis and KEGG signaling pathway analyses of the differential genes (DEGs) from transcriptome analysis. Figure 1A-C shows the top ten enriched GO terms. Biological processes are primarily associated with immune responses, defense responses, stimulus responses, and immune system processes. Most of the genes in cellular components are involved in the external side of plasma membrane and cell surface. Among the molecular functions, protein binding, immune receptor activity and receptor binding are significantly affected. The KEGG pathway analysis indicated that the DEGs were predominantly enriched in the B cell receptor signaling pathway, formation of neutrophil extracellular traps, NF-kappa B signaling pathway, Fc gamma R-mediated phagocytosis, and NOD-like receptor signaling pathway. Besides, other enrichment pathways involved the Toll-like receptor signaling pathway, the JAK-STAT signaling pathway and the PI3K-Akt signaling pathway (Fig. 1D). These pathways have been confirmed to regulate cellular immunity and inflammatory responses [17–19]. Based on the above, we examined the levels of TNF-α, IL-1β and IL-6 in the hippocampus of TMAO-treated 2VO rats, and the results showed that TMAO treatment significantly increased the secretion of inflammatory factors in the 2VO rats hippocampus (Fig. 1E-G).

3.2 TMAO up-regulates hippocampal lncRNA Fendrr expression in 2VO Rats

In order to explore the detailed mechanisms underlying the action of TMAO on 2VO rats, we performed high-throughput sequencing of hippocampus from 2VO rats and rats administered with TMAO, and identified a total of 56 differentially expressed lncRNAs, including 19 lncRNAs upregulated and 37 lncRNAs down-regulated (Fig. 2A). The heat map showed the DEGs of the top 15 up-regulated and down-regulated lncRNAs (Fig. 2B). According to previous reports, Fendrr could activate intracerebral inflammation in mice with diabetic cerebral I/R injury [15]. Furthermore, the knockdown of Fendrr reduced pro-inflammatory cytokine secretion in caerulein or lipopolysaccharide-induced acute pancreatitis (AP) mouse model [20]. Hence, we hypothesized that the detrimental effect of TMAO on VaD was dependent on Fendrr. At first, Fendrr expression was measured by RT-qPCR in the hippocampal tissues of 2VO and TMAO-treated 2VO rats, and the expression of Fendrr was found to be obviously elevated in the 2VO group, which was more pronounced in the TMAO-treated 2VO rats (Fig. 2C). Next, we predicted and validated the subcellular localization of Fendrr. The lncLocator software result indicated that Fendrr was localized in both the nucleus and the cytoplasm and was mainly located in the cytoplasm (Fig. 2D). As predicted, FISH experiments further confirmed that Fendrr was located in the cytoplasm (Fig. 2E).

3.3 Knockdown of Fendrr can significantly improve neurological function injury in 2VO rats

To investigate the effects of Fendrr on neurological function in 2VO rats, lentivirus vectors knocking down Fendrr (LV-sh-Fendrr) and the negative control LV-sh-NC were injected stereotactically into the bilateral hippocampus of rats and the the knockout efficiency of Fendrr was measured. RT-qPCR result indicated that Fendrr expression was significantly reduced following sh-Fendrr intervention (Fig. 3A). Next, OFT and MWM assays were performed to evaluate the spatial learning and memory capacity of the rats, and our findings revealed that the total distance traveled and the percentage of time spent in the center were substantially higher in the sh-Fendrr group when compared to the sh-NC group (Fig. 3B, C). Later, MWM dataset suggested that the mean escape latency was decreased when Fendrr was knocked down (Fig. 3D). Notable difference in swimming speed did not exist between the two groups (Fig. 3E). These observations together demonstrated that knockdown of Fendrr could significantly improve the cognitive function deficits of 2VO rats. Furthermore, Nissl staining assessed the effect of Fendrr knockdown on hippocampal neuronal damage in 2VO rats. Injected with sh-Fendrr considerably increased the Nissl-positive cells in the CA1 region of hippocampus in comparison with the rats injected with sh-NC (Fig. 3F, G). Afterward, we tested the inflammatory parameters levels in rat hippocampus by ELISA and found that in 2VO rats injected with sh-Fendrr, TNF-α, IL-1β and IL-6 were suppressed in comparison with vector group (Fig. 3H-J). In summary, these data indicated that down-regulation of Fendrr inhibited the inflammatory response in hippocampal tissue and attenuated cognitive impairment in 2VO rats.

3.4 Fendrr negatively regulates miR-145-5p expression

There is increasing evidence that lncRNAs can be competing endogenous RNAs (ceRNAs) to bind miRNAs by sequence complementarity, which in turn is involved in the regulation the occurrence and development of disease [21–23]. The experiments described above have shown that Fendrr is mainly localized in the cytoplasm, so we speculated that Fendrr can sponge miRNAs via ceRNA. As shown in Fig. 4A, through miRDB database prediction, it was found that there are 14 miRNAs that may be potential targets of Fendrr. Among them, only miR-145-5p was studied and reported to find its expression decreased in the cortex of 2VO rats [24]. Besides, some studies have reported that miR-145-5p was negative correlation with inflammation. For instance, miR-145-5p could attenuate the apoptosis, oxidative stress and inflammatory response through the inhibition of NOH-1, eventually reducing myocardial I/R damage [25]. The exosomes containing miR-145-5p could attenuate inflammatory responses via regulating the TLR4/NF-κB signaling pathway in spinal cord injury [26]. Hence, we selected miR-145-5p as the downstream research target of Fendrr. RNAhybrid (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/) was used to predict, and the results implied the potential binding sites between miR-145-5p and Fendrr. The minimum free energy was found < -25kcal/mol (Fig. 4B). In addition, the binding sites in the Starbase database (http://starbase.sysu.edu.cn) were consistent with the predicted results (Fig. 4C). Afterwards, the binding relationship were further validated by dual luciferase reporter assays and RIP assays. The luciferase activity of Fendrr-WT was greatly reduced with transfection of agomir-145-5p in the dual luciferase reporter, whereas Fendrr-MUT showed no significant difference (Fig. 4D). RIP experiments demonstrated enhanced enrichment of Fendrr and miR-145-5p under Ago2 treatment under Ago2 treatment (Fig. 4E). Moreover, we detected their co-localization in hippocampal tissue by FISH, and discovered that Fendrr and miR-145-5p co-localized in the cytoplasm of hippocampal tissue (Fig. 4F). Furthermore, we examined the expression of miR-145-5p in 2VO rats injected with sh-Fendrr and detected upregulation of miR-145-5p (Fig. 4G). Shortly, miR-145-5p is a target gene of Fendrr and can be negatively regulated by Fendrr.

3.5 Upregulation of miR-145-5p can reduce neurological function injury in 2VO rats

Based on the above studies, we first detected miR-145-5p expression in hippocampus of rats in sham-operated and 2VO groups, and the outcomes showed that miR-145-5p did display low level in 2VO rats (Fig. 5A). We implemented miR-145-5p up-regulation assay in rats and the RT-qPCR outcome indicated that the expression of miR-145-5p was amplified by the injection with agomir-145-5p (Fig. 5B). In behavioral tests, we observed that the total distance traveled and the percentage of time spent in the center was significantly increased in agomir-145-5p group (Fig. 5C, D), while the mean escape latency was significantly lowered (Fig. 5E). Significant differences in swimming speed did not exist between the two groups (Fig. 5F). Histological observation of brain tissues depicted an increase in the number of Nissl bodies in the CA1 region of rat hippocampal after treatment of agomir-145-5p (Fig. 5G, H). Besides, ELISA assay results uncovered obvious decreases in TNF-α, IL-1β, and IL-6 concentrations in 2VO rats with overexpression of miR-145-5p (Fig. 5I-K). Therefore, the amplification of miR-145-5p was found to improve neurological function recovery in 2VO rats.

3.6 PXN is the target of miR-145-5p

In order to have a further investigation of the possible targets of miR-145-5p, we used three bioinformatics tools, TargetScan, miRDB and miRMap to predict the targets of miR-145-5p. There were a sum of 122 genes located in cross-sets of three databases (Fig. 6A). In addition, we plotted the corresponding lncRNA-miRNA-mRNAs interaction network on the basis of predicted results (Fig. 6B). Among these candidate genes, Trim2, PXN, and Nedd4l were reported to be significantly upregulated in the cortex of 2VO rats [24, 27]. Then, the minimum free energies of binding between them and miR-145-5p were − 31.5, -35.1, and − 32.8 kcal/mol, respectively, predicted by the RNAhybrid (Fig. 6C), which suggested that PXN is most likely to bind to miR-145-5p. Also, Targetscan database predictions indicated that a potential binding region existed between miR-145-5p and PXN (Fig. 6D). Similarly, dual luciferase reporter gene assays further clarified the binding of miR-145-5p to PXN. The luciferase activity was clearly decreased in cells transfected with agomir-145-5p and WT-PXN (Fig. 6E). RIP experiment displayed the augmented enrichment of miR-145-5p and PXN under Ago2 treatment (Fig. 6F). In addition, FISH analysis revealed that miR-145-5p and PXN co-localize in the cytoplasm of the hippocampus tissues (Fig. 6G). Next, we detected the miR-145-5p effect on PXN level, and found that the expression of PXN was inhibited after miR-145-5p up-regulation in RT-qPCR and Western Blot assay (Fig. 6H-J). The above results demonstrated that PXN is a downstream target of miR-145-5p.

3.7 Knockdown of PXN can reduce neurological function injury in 2VO rats

To explore the effect of PXN on VaD, we first found that PXN expression in the hippocampus of 2VO rats were increased by RT-qPCR and Western Blot (Fig. 7A-C). Then LV-sh-NC and LV-sh-PXN were injected into the bilateral hippocampus of 2VO model rats, respectively. RT-qPCR and Western Blot confirmed that injection of sh-PXN significantly lowered the expression of PXN in 2VO rats. (Fig. 7D-F). After silencing PXN, it was found that the learning and spatial memory abilities of rats were significantly reduced (Fig. 7G-I). The specific performances were an increase in the percentage of time spent in the center and the total distance traveled, a decrease of the mean escape latency. Notable difference in swimming speed did not exist between the two groups (Fig. 7J). Moreover, in 2VO rats injected with sh-PXN, there were increased nissl bodies in the hippocampal CA1 region (Fig. 7K, L). The inflammatory parameters were also explored in the hippocampus, with the results presenting that concentrations of TNF-α, IL-1β and IL-6 were suppressed (Fig. 7M-O). Overall, down-regulating PXN promoted the recovery of neurologic function in 2VO rats.

3.8 Inhibition of miR-145-5p reversed the Fendrr knockdown-mediated influence on 2VO rats

In the hippocampus of 2VO rats, we noticed that PXN expression went down-regulate after treatment of sh-Fendrr (Fig. 8A-C). In this regard, to verify whether Fendrr affects VaD through miR-145-5p/PXN axis, rats were stereotactically injected with sh-Fendrr and antagomir-145-5p and the negative control lentivirus vectors into the bilateral hippocampus, respectively. In 2VO rats, injection of sh-Fendrr would enhance neurological function, including the improvement of behavioral tests and the increase in the number of Nissl bodies in the CA1 region of the hippocampus, while the effects of sh-Fendrr would be weakened by antagomir-145-5p (Fig. 8D-I). In addition, the silenced miR-145-5p reversed the decrease in PXN expression by sh-Fendrr (Fig. 8J-L) and suppression of inflammatory response (Fig. 8M-O). In summary, Fendrr exacerbated neurological impairment and inflammatory responses in 2VO rats by targeting PXN via sponge miR-145-5p.

3.9 TMAO aggravated the neurological function of 2VO rats by upregulating Fendrr targeting miR-145-5p

To investigate whether TMAO exacerbates VaD injury by regulating Fendrr/miR-145-5p expression, we stereotactically injected the sh-Fendrr and antagomir-145-5p into the bilateral hippocampus of TMAO-administrated 2VO rats. After sh-Fendrr injection, the 2VO rats administered with TMAO have the increased percentage of time spent in the center and total distance traveled, while the decreased mean escape latency. But, these effects of sh-Fendrr were reversed via the inhibition of miR-145-5p (Fig. 9A-C). Notable difference in swimming speed did not exist among groups (Fig. 9D). Nissl staining elicited that sh-Fendrr ameliorated hippocampal tissue damage in TMAO-treated 2VO rats, but the inhibition of miR-145-5p expression remarkably abolished this effect (Fig. 9E, F). Besides, injection of sh-Fendrr attenuated the upregulation of PXN in TMAO-treated 2VO rats, but injection of antagomir-145-5p reversed this expression (Fig. 9G-I). The decrease in miR-145-5p counteracted the suppressive effects of Fendrr on the inflammatory cytokines in TMAO-treated 2VO rats (Fig. 9J-L). Collectively, TMAO impaired neural function in 2VO rats by affecting the expression of Fendrr/miR-145-5p.

VaD, featuring degradation of memory and cognitive capacity, is the second commonest form of dementia due to chronic cerebral underperfusion [28]. In our previous investigation, we have demonstrated that increased circulating TMAO could exacerbate cognitive impairment in the 2VO model (a model widely used in VaD studies) rats[11]. However, the molecular mechanism by the TMAO promoted VaD injury remains unknown. The current research is the first to confirm that upregulation of Fendrr induced by TMAO is implicated in the pathogenesis of VaD. TMAO aggravated neuro-inflammation and cognitive dysfunction via Fendrr/miR-145-5p/PXN axis in 2VO rats.

Several new evidence emphasize that pathological changes in VaD lead to excessive neuroinflammation, which further causes various forms of cell death including neurons [29–31]. A previous study conducted the GO and KEGG enrichment analysis of differentially expressed miRNA/TF-associated genes in the cortex of 2VO rats and found that these genes were primarily connected to hypoxia, inflammation and apoptosis pathways of VaD [24]. Similarly, we performed KEGG analysis of DEGs in the hippocampus of TMAO-treated 2VO rats and found that pathways involving target genes were also associated with the regulation of inflammation and cellular immunity. Accordingly, we examined the changes in inflammatory factors of the 2VO rats hippocampus. After TMAO administration, the levels of TNF-α, IL-1β and IL-6 were markedly elevated. Compatible with our study findings, Zhang et al. have manifested that the high levels of circulating TMAO enhanced the release of inflammatory mediators and increased the NF-kB activity in inflammatory model rats [32]. In addition, elevated circulating TMAO levels downregulated IL-10, exacerbated vascular oxidative stress and inflammation, and resulted in endothelial dysfunction [33]. Collectively, TMAO could promote neuroinflammation in the VaD rat model.

Thereafter, we explored the molecular mechanisms by which TMAO promotes neuroinflammation in VaD. As recorded, TMAO could promote atherosclerosis through regulating the lncRNA enriched abundant transcript 1 (NEAT1) [34]. The link between lncRNAs and cognitive impairments has recently gained attention. LncRNA MALAT1 has been observed to target miR-9-3p to upregulate SAP97 in the VaD mice, thereby promoting VaD progression [35]. The knockdown of lncRNA XIST alleviated BACE1 alteration via miR-124/BACE1 signaling pathways in the 2VO-induced Alzheimer’s disease model [36]. We analyzed the hippocampus of rats in the 2VO and TMAO-administrated 2VO groups by high-throughput sequencing to screen for differentially expressed lncRNAs. Significantly, the expression of Fendrr in hippocampus of 2VO rats was remarkably elevated after TMAO administration. Fendrr was initially found to be associated with the development of a variety of human malignant tumors, such as prostate cancer, renal cell carcinoma and cervical cancer [37–39]. Of interest, available evidence suggests that Fendrr may rugulate pyroptosis and inflammation of microglia in diabetes-cerebral I/R mice [15]. Fendrr could modulate inflammation by binding PRC2 to inhibit the epigenetic role of ATG7 in acute pancreatitis [20]. Nevertheless, the function of Fendrr in VaD is unclear. Therefore, we injected sh-Fendrr into the bilateral hippocampus of 2VO rats for Fendrr loss-of-function assay, and it was discovered the protective effects of Fendrr silencing on 2VO rats, including improving cognitive deficits, reducing neuronal damage and markedly inhibiting the inflammatory factors.

There is growing evidence that lncRNAs could act as sponges for miRNAs and thus mediate gene expression regulation functions [22, 40]. In our study, miR-145-5p was predicted and demonstrated to be the target of Fendrr by dual luciferase reporter gene, RIP and FISH assays. Qi et al. discovered that miR-145-5p expression was significantly downregulated in MCAO mice whereas suppressing miR-145-5p enhanced the levels of proinflammatory factors TNF-α and NO in activated microglia cells [41]. Overexpression of miR-145-5p could attenuate inflammatory responses in mouse cardiomyocytes hypoxia/reoxygenation (H/R) modeling [42]. To be noted, a sequencing report found that miR-145-5p is lowly expressed in the cortex of 2VO rats [24]. However, the potential effect of miR-145-5p in VaD has not been identified by the researchers. Concordant with the sequencing result, our study found that miR-145-5p expression was reduced in the hippocampus of 2VO-treated rats. Furthermore, gain-of-function assays indicated that miR-145-5p upregulation attenuated 2VO-induced injury via improving neurological recovery, attenuating neuronal death, and repressing inflammatory responses.

Indeed, miR-145-5p was reported to target PXN to attenuate cardiac hypertrophy caused by angiotensin II [43]. Another literature also stated that miR-145 may act as a colon cancer inhibitor by targeting PXN [44]. As an inflammatory gene [45], PXN expression was upregulated after middle cerebral artery occlusion in mice, especially following 1 hour of ischemia, and the upregulation of PXN may promote inflammation and the development of acute ischemic stroke [46, 47]. Besides, a sequencing result observed that PXN was notably elevated in the cortex of 2VO rats [24]. Aligned with previous studies, we found elevated levels of PXN in the hippocampus of 2VO rats and confirmed its binding relationship with miR-145-5p. Next, loss-of-function assay of PXN was conducted and the experiment revealed that PXN depletion attenuated brain damage in 2VO rats. Finally, to investigate whether TMAO exacerbates neurological injury by regulating the expression of Fendrr/miR-145-5p/PXN in 2VO rats, we inhibited the expression of Fendrr and PXN in TMAO-treated 2VO rats. The outcomes indicated that the down-expression of Fendrr ameliorated the damaging effects of TMAO on 2VO rats, but suppression of miR-145-5p expression reversed this effect.

In summary, the present study elucidated, for the first time, that TMAO exacerbates neuroinflammation in VaD through the lncRNA Fendrr/miR-145-5p/PXN axis. Down-regulating Fendrr attenuates the VaD-induced cerebral injury via ceRNA interaction with miR-145-5p to suppress PXN expression. This offers a new insight into the mechanism of TMAO damage to VaD, which may facilitate a deeper comprehension of the pathological process of VaD and provide new options for clinical prevention or treatment.

Vascular dementia, VaD；bilateral common carotid artery, 2VO; Trimethylamine-N-oxide, TMAO; trimethylamine, TMA; flavin monooxygenase 3, FMO3; Alzheimer's disease, AD; Long noncoding RNA, lncRNA; micro RNA, miRNA; messenger RNA, mRNA; ischemia/reperfusion, I/R; hypoxia/reoxygenation, H/R; Gene Ontology, GO; Kyoto Encyclopedia of Genes and Genomes, KEGG; Open Field Test, OFT; Morris Water Maze Test, MWM; Fluorescence in Situ Hybridization, FISH; RNA immunoprecipitation, RIP; Reverse transcription-quantitative polymerase chain reaction, RT-qPCR; Enzyme-linked immunosorbent assay, ELISA; differential genes, DEGs; acute pancreatitis, AP; lentivirus vectors knocking down Fendrr, LV-sh-Fendrr; the negative control, LV-sh-NC; competing endogenous RNAs, ceRNAs; lentivirus vectors knocking down PXN, LV-sh-PXN; NOD-like receptor protein 3, NLRP3

Acknowledgements Not applicable.

Authors’ contributions DY, ZJQ and HY designed and performed experiments, analyzed data, and prepared the manuscript. PQ and LZY helped with the mice model construction. SC and GSH performed experiments; CXL, ZYD, and DR directed the study and prepared the manuscript. All authors read and approved the final manuscript.

Funding This work was supported by the National Natural Science Foundation of China (82301609), China Postdoctoral Science Foundation (2022M711666), Natural Science Foundation of Jiangsu Province (BK20220196), the Medical Science and Technology Program of Nanjing (JQX20007), and Xinghuo Talent Program of Nanjing First Hospital.

Data Availability The datasets used or analyzed during the study are available from the corresponding author upon reasonable request.

Ethics Approval All animal experiments were approved by the Animal Research and Ethics Committee of Nanjing First Hospital (protocol number: DWSY-2104386). and were implemented according to the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publication no. 80-23, revised 1996).

Consent to Participate Not applicable.

Consent for publication Not applicable.

Competing interests The authors declare no competing interests.

Lourida I, Soni M, Thompson-Coon J, Purandare N, Lang IA, Ukoumunne OC, Llewellyn DJ (2013) Mediterranean diet, cognitive function, and dementia: a systematic review. Epidemiology 24(4):479–489. 10.1097/EDE.0b013e3182944410
Farooq MU, Min J, Goshgarian C, Gorelick PB (2017) Pharmacotherapy for Vascular Cognitive Impairment. CNS Drugs 31(9):759–776. 10.1007/s40263-017-0459-3
Mulugeta E, Molina-Holgado F, Elliott MS, Hortobagyi T, Perry R, Kalaria RN, Ballard CG, Francis PT (2008) Inflammatory mediators in the frontal lobe of patients with mixed and vascular dementia. Dement Geriatr Cogn Disord 25(3):278–286. 10.1159/000118633
Wang XX, Zhang B, Xia R, Jia QY (2020) Inflammation, apoptosis and autophagy as critical players in vascular dementia. Eur Rev Med Pharmacol Sci 24(18):9601–9614. 10.26355/eurrev_202009_23048
Manor O, Zubair N, Conomos MP, Xu X, Rohwer JE, Krafft CE, Lovejoy JC, Magis AT (2018) A Multi-omic Association Study of Trimethylamine N-Oxide. Cell Rep 24(4):935–946. 10.1016/j.celrep.2018.06.096
Zeisel SH, Warrier M (2017) Trimethylamine N-Oxide, the Microbiome, and Heart and Kidney Disease. Annu Rev Nutr 37:157–181. 10.1146/annurev-nutr-071816-064732
Chen Y, Weng Z, Liu Q, Shao W, Guo W, Chen C, Jiao L, Wang Q, Lu Q, Sun H, Gu A, Hu H, Jiang Z (2019) FMO3 and its metabolite TMAO contribute to the formation of gallstones. Biochim Biophys Acta Mol Basis Dis 1865(10):2576–2585. 10.1016/j.bbadis.2019.06.016
Wu C, Xue F, Lian Y, Zhang J, Wu D, Xie N, Chang W, Chen F, Wang L, Wei W, Yang K, Zhao W, Wu L, Song H, Ma Q, Ji X (2020) Relationship between elevated plasma trimethylamine N-oxide levels and increased stroke injury. Neurology 94(7):e667–e677. 10.1212/WNL.0000000000008862
Vogt NM, Romano KA, Darst BF, Engelman CD, Johnson SC, Carlsson CM, Asthana S, Blennow K, Zetterberg H, Bendlin BB, Rey FE (2018) The gut microbiota-derived metabolite trimethylamine N-oxide is elevated in Alzheimer's disease. Alzheimers Res Ther 10(1):124. 10.1186/s13195-018-0451-2
Li C, Zhu L, Dai Y, Zhang Z, Huang L, Wang TJ, Fu P, Li Y, Wang J, Jiang C (2022) Diet-Induced High Serum Levels of Trimethylamine-N-oxide Enhance the Cellular Inflammatory Response without Exacerbating Acute Intracerebral Hemorrhage Injury in Mice. Oxid Med Cell Longev 2022:1599747. 10.1155/2022/1599747
Deng Y, Zou J, Hong Y, Peng Q, Fu X, Duan R, Chen J, Chen X (2022) Higher Circulating Trimethylamine N-Oxide Aggravates Cognitive Impairment Probably via Downregulating Hippocampal SIRT1 in Vascular Dementia Rats. Cells 11(22). 10.3390/cells11223650
Chen C, Tang Y, Sun H, Lin X, Jiang B (2019) The roles of long noncoding RNAs in myocardial pathophysiology. Biosci Rep 39(11). 10.1042/BSR20190966
Ferrè F, Colantoni A, Helmer-Citterich M (2016) Revealing protein-lncRNA interaction. Brief Bioinform 17(1):106–116. 10.1093/bib/bbv031
Dong B, Zhou B, Sun Z, Huang S, Han L, Nie H, Chen G, Liu S, Zhang Y, Bao N, Yang X, Feng H (2018) LncRNA-FENDRR mediates VEGFA to promote the apoptosis of brain microvascular endothelial cells via regulating miR-126 in mice with hypertensive intracerebral hemorrhage. Microcirculation 25(8):e12499. 10.1111/micc.12499
Wang L-Q, Zheng Y-Y, Zhou H-J, Zhang X-X, Wu P, Zhu S-M (2021) LncRNA-Fendrr protects against the ubiquitination and degradation of NLRC4 protein through HERC2 to regulate the pyroptosis of microglia. Mol Med 27(1):39. 10.1186/s10020-021-00299-y
Yang Y, Ju J, Deng M, Wang J, Liu H, Xiong L, Zhang J (2017) Hypoxia Inducible Factor 1α Promotes Endogenous Adaptive Response in Rat Model of Chronic Cerebral Hypoperfusion. Int J Mol Sci 18(1). 10.3390/ijms18010003
Euler M, Hoffmann MH (2019) The double-edged role of neutrophil extracellular traps in inflammation. Biochem Soc Trans 47(6):1921–1930. 10.1042/BST20190629
Song Y, Wu Z, Zhao P (2022) The protective effects of activating Sirt1/NF-κB pathway for neurological disorders. Rev Neurosci 33(4):427–438. 10.1515/revneuro-2021-0118
Fukata M, Vamadevan AS, Abreu MT (2009) Toll-like receptors (TLRs) and Nod-like receptors (NLRs) in inflammatory disorders. Semin Immunol 21(4):242–253. 10.1016/j.smim.2009.06.005
Zhao S-P, Yu C, Yang M-S, Liu Z-L, Yang B-C, Xiao X-F (2021) Long Non-coding RNA FENDRR Modulates Autophagy Through Epigenetic Suppression of ATG7 via Binding PRC2 in Acute Pancreatitis. Inflammation 44(3). 10.1007/s10753-020-01395-7
Han D, Gao Q, Cao F (2017) Long noncoding RNAs (LncRNAs) - The dawning of a new treatment for cardiac hypertrophy and heart failure. Biochim Biophys Acta Mol Basis Dis 1863(8):2078–2084. 10.1016/j.bbadis.2017.02.024
Lin W, Zhou Q, Wang C-Q, Zhu L, Bi C, Zhang S, Wang X, Jin H (2020) LncRNAs regulate metabolism in cancer. Int J Biol Sci 16(7):1194–1206. 10.7150/ijbs.40769
Vasudeva K, Dutta A, Munshi A (2021) Role of lncRNAs in the Development of Ischemic Stroke and Their Therapeutic Potential. Mol Neurobiol 58(8):3712–3728. 10.1007/s12035-021-02359-0
Zhao K, Zeng L, Cai Z, Liu M, Sun T, Li Z, Liu R (2022) RNA sequencing-based identification of the regulatory mechanism of microRNAs, transcription factors, and corresponding target genes involved in vascular dementia. Front Neurosci 16:917489. 10.3389/fnins.2022.917489
Tan L, Liu L, Yao J, Piao C (2021) miR-145-5p attenuates inflammatory response and apoptosis in myocardial ischemia-reperfusion injury by inhibiting (NADPH) oxidase homolog 1. Exp Anim 70(3):311–321. 10.1538/expanim.20-0160
Jiang Z, Zhang J (2021) Mesenchymal stem cell-derived exosomes containing miR-145-5p reduce inflammation in spinal cord injury by regulating the TLR4/NF-κB signaling pathway. Cell Cycle 20(10). 10.1080/15384101.2021.1919825
Fang C, Li Q, Min G, Liu M, Cui J, Sun J, Li L (2017) MicroRNA-181c Ameliorates Cognitive Impairment Induced by Chronic Cerebral Hypoperfusion in Rats. Mol Neurobiol 54(10):8370–8385. 10.1007/s12035-016-0268-6
Duncombe J, Kitamura A, Hase Y, Ihara M, Kalaria RN, Horsburgh K (2017) Chronic cerebral hypoperfusion: a key mechanism leading to vascular cognitive impairment and dementia. Closing the translational gap between rodent models and human vascular cognitive impairment and dementia. Clin Sci (Lond) 131(19):2451–2468. 10.1042/CS20160727
Sha S, Tan J, Miao Y, Zhang Q (2021) The Role of Autophagy in Hypoxia-Induced Neuroinflammation. DNA Cell Biol 40(6):733–739. 10.1089/dna.2020.6186
Belkhelfa M, Beder N, Mouhoub D, Amri M, Hayet R, Tighilt N, Bakheti S, Laimouche S, Azzouz D, Belhadj R, Touil-Boukoffa C (2018) The involvement of neuroinflammation and necroptosis in the hippocampus during vascular dementia. J Neuroimmunol 320:48–57. 10.1016/j.jneuroim.2018.04.004
Tian Z, Ji X, Liu J (2022) Neuroinflammation in Vascular Cognitive Impairment and Dementia: Current Evidence, Advances, and Prospects. Int J Mol Sci 23(11). 10.3390/ijms23116224
Zhang Y, Zhang C, Li H, Hou J (2019) The Presence of High Levels of Circulating Trimethylamine N-Oxide Exacerbates Central and Peripheral Inflammation and Inflammatory Hyperalgesia in Rats Following Carrageenan Injection. Inflammation 42(6):2257–2266. 10.1007/s10753-019-01090-2
Chen H, Li J, Li N, Liu H, Tang J (2019) Increased circulating trimethylamine N-oxide plays a contributory role in the development of endothelial dysfunction and hypertension in the RUPP rat model of preeclampsia. Hypertens Pregnancy 38(2). 10.1080/10641955.2019.1584630
Liu A, Zhang Y, Xun S, Sun M (2022) Trimethylamine N-oxide promotes atherosclerosis via regulating the enriched abundant transcript 1/miR-370-3p/signal transducer and activator of transcription 3/flavin-containing monooxygenase-3 axis. Bioengineered 13(1):1541–1553. 10.1080/21655979.2021.2010312
Wang P, Mao S, Yi T, Wang L (2023) LncRNA MALAT1 Targets miR-9-3p to Upregulate SAP97 in the Hippocampus of Mice with Vascular Dementia. Biochem Genet 61(3):916–930. 10.1007/s10528-022-10289-2
Yue D, Guanqun G, Jingxin L, Sen S, Shuang L, Yan S, Minxue Z, Ping Y, Chong L, Zhuobo Z, Yafen W (2020) Silencing of long noncoding RNA XIST attenuated Alzheimer's disease-related BACE1 alteration through miR-124. Cell Biol Int 44(2):630–636. 10.1002/cbin.11263
Zhang G, Han G, Zhang X, Yu Q, Li Z, Li Z, Li J (2018) Long non-coding RNA FENDRR reduces prostate cancer malignancy by competitively binding miR-18a-5p with RUNX1. Biomarkers 23(5):435–445. 10.1080/1354750X.2018.1443509
He W, Zhong G, Wang P, Jiang C, Jiang N, Huang J (2019) Downregulation of long noncoding RNA FENDRR predicts poor prognosis in renal cell carcinoma. Oncol Lett 17(1):103–112. 10.3892/ol.2018.9624
Zhu Y, Zhang X, Wang L, Zhu X, Xia Z, Xu L, Xu J (2020) FENDRR suppresses cervical cancer proliferation and invasion by targeting miR-15a/b-5p and regulating TUBA1A expression. Cancer Cell Int 20:152. 10.1186/s12935-020-01223-w
Ang CE, Trevino AE, Chang HY (2020) Diverse lncRNA mechanisms in brain development and disease. Curr Opin Genet Dev 65:42–46. 10.1016/j.gde.2020.05.006
Qi X, Shao M, Sun H, Shen Y, Meng D, Huo W (2017) Long non-coding RNA SNHG14 promotes microglia activation by regulating miR-145-5p/PLA2G4A in cerebral infarction. Neuroscience 348. 10.1016/j.neuroscience.2017.02.002
Liang C, Wang S, Zhao L, Han Y, Zhang M (2022) Effects of miR-145-5p on cardiomyocyte proliferation and apoptosis, GIGYF1 expression and oxidative stress response in rats with myocardial ischemia-reperfusion. Cell Mol Biol (Noisy-le-grand) 68(1):147–159. 10.14715/cmb/2022.68.1.19
Lin K-H, Kumar VB, Shanmugam T, Shibu MA, Chen R-J, Kuo C-H, Ho T-J, Padma VV, Yeh Y-L, Huang C-Y (2021) miR-145-5p targets paxillin to attenuate angiotensin II-induced pathological cardiac hypertrophy via downregulation of Rac 1, pJNK, p-c-Jun, NFATc3, ANP and by Sirt-1 upregulation. Mol Cell Biochem 476(9):3253–3260. 10.1007/s11010-021-04100-w
Qin J, Wang F, Jiang H, Xu J, Jiang Y, Wang Z (2015) MicroRNA-145 suppresses cell migration and invasion by targeting paxillin in human colorectal cancer cells. Int J Clin Exp Pathol 8(2):1328–1340
Wang W, Hu D, Feng Y, Wu C, Song Y, Liu W, Li A, Wang Y, Chen K, Tian M, Xiao F, Zhang Q, Chen W, Pan P, Wan P, Liu Y, Lan H, Wu K, Wu J (2020) Paxillin mediates ATP-induced activation of P2X7 receptor and NLRP3 inflammasome. BMC Biol 18(1):182. 10.1186/s12915-020-00918-w
Erdö F, Trapp T, Mies G, Hossmann K-A (2004) Immunohistochemical analysis of protein expression after middle cerebral artery occlusion in mice. Acta Neuropathol 107(2):127–136
Liu J, Zhou C-X, Zhang Z-J, Wang L-Y, Jing Z-W, Wang Z (2012) Synergistic mechanism of gene expression and pathways between jasminoidin and ursodeoxycholic acid in treating focal cerebral ischemia-reperfusion injury. CNS Neurosci Ther 18(8):674–682. 10.1111/j.1755-5949.2012.00348.x

No competing interests reported.

Supplementaltable1.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Trimethylamine N-oxide Aggravates Neuro-inflammation via lncRNA Fendrr/miR-145-5p/PXN axis in Vascular Dementia Rats

Status:

Version 1

Abstract

Figures

1 Introduction

2 Materials and Methods

2.1 Ethics Statement

2.2 VaD animal model and corresponding treatment

2.3 LncRNA Sequencing

2.4 Functional enrichment analysis

2.5 Open Field Test (OFT)

2.6 Morris Water Maze Test (MWM)

2.7 Nissl Staining

2.8 Luciferase report assay

2.9 Fluorescence in Situ Hybridization (FISH)

2.10 RNA immunoprecipitation (RIP) assay

2.11 Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

2.12 Western Blot Analysis

2.13 Enzyme-linked immunosorbent assay (ELISA)

2.14 Statistical analysis

3 Results

3.1 TMAO promoted hippocampal inflammatory response within 2VO Rats

3.2 TMAO up-regulates hippocampal lncRNA Fendrr expression in 2VO Rats

3.3 Knockdown of Fendrr can significantly improve neurological function injury in 2VO rats

3.4 Fendrr negatively regulates miR-145-5p expression

3.5 Upregulation of miR-145-5p can reduce neurological function injury in 2VO rats

3.6 PXN is the target of miR-145-5p

3.7 Knockdown of PXN can reduce neurological function injury in 2VO rats

3.8 Inhibition of miR-145-5p reversed the Fendrr knockdown-mediated influence on 2VO rats

3.9 TMAO aggravated the neurological function of 2VO rats by upregulating Fendrr targeting miR-145-5p

4 Discussion

5 Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1