2.1 Human breast cancer sample and bioinformatics analysis
20 pairs of breast cancer tissues and adjacent normal tissues were collected from Affiliated Zhongnan Hospital of Wuhan University and diagnosed by the Department of Pathology. All patients were informed and agreed. Our research was supported by the Ethics Board of School of Basic Medical Sciences, Wuhan University and was based on all relevant principles of the Declaration of Helsinki.
To analyze WDR5, MYC and VASP mRNA expression level in breast cancer. The mRNA and clinical data were download from The Cancer Genome Atlas (TCGA).
To analyze the correlation between WDR5, MYC, H3K4me3 expression levels and breast cancer cell migration ability, the ChIP-seq data of WDR5, MYC, and H3K4me3 in breast cancer cells were downloaded from the GEO databases (GEO dataset number is GSE60897, GSE70098, GSE75169) (Messier et al., 2016; Sun et al., 2015; Thomas, Wang, et al., 2015). The ChIP-seq data of the WDR5, MYC, and H3K4me3 in reported breast cancer were analyzed to visualize Genomic Annotation and distribution of transcription factor-binding loci relative to Transcription Start Site (TSS) using the Chipseeker R package, and the genes enriched by WDR5, MYC and H3K4me3 were intersected and the signal pathway analysis was performed on the co-enriched genes. The co-enrichment sites of WDR5, MYC, and H3K4me3 on the gene of VASP were analyzed and determined by Integrative Genomics Viewer (IGV).
2.2. Plasmids, siRNA, and antibody
To overexpress a protein in cells, the coding sequence of WDR5 (NM_017588.2) or MYC (NM_002467.5) was cloned into the pCMV5 vector (Clontech Laboratories Inc.) and pFLAG-CMV (Clontech Laboratories Inc.). In order to label proteins in cells, the coding sequences of WDR5 or MYC were cloned into pEGFP-C1 (Clontech Laboratories Inc.) vector and pDsRed2-C1(Clontech Laboratories Inc.), respectively. For the luciferase assay, different lengths of VASP transcription start sites upstream sequences were cloned into pGL3-Basic vector (Clontech Laboratories Inc.), the mutation vector was constructed based on pGL3-VASP995, the sequence -852 GGCCAGGTGGC -842 was muted into -852 GGCCGGCATGC -842.
WDR5 and MYC shRNA interference sequence (WDR5 target sequence: 5’-CCAACCTTATTGTCTCAGGAT-3’; MYC target sequence: 5’-CCTGAGACAGATCAGCAACAA-3’) was constructed into pLKO.1 vector (Clontech Laboratories Inc.). VASP was interfered by three pairs of siRNAs (siRNA#1, sense: 5’- AAGGAAAGCCACGCAAGUUTT -3’, antisense: 5’- AACUUGCGUGGCUUCCUUTT -3’; siRNA#2, sense: 5’-GGAGCCAAACUCAGGAAAGTT -3’, antisense: 5’- CUUCCUG AGUUGGCUCCTT-3; siRNA#3, sense: 5’- GCCUCUACUUGACUUGGAATT -3’, antisense: 5’- UCCAAGUCAAGUAG AGGCTT-3’).
The following primary antibodies were used for Western blotting:H3K4me3 (Proteintech, USA), WDR5 (Proteintech, USA), MYC (Proteintech, USA), H3 (Proteintech, USA), GAPDH (Proteintech, USA); and following ChIP grade antibodies were used for chromatin immunoprecipitation (ChIP) and co-immunoprecipitation (Co-IP):H3K4me3 (Abclonal, USA), WDR5 (Abclonal, USA), MYC (Abclonal, USA), H3 (Abclonal, USA) and rabbit IgG(Abclonal, USA).
2.3 Cell culture
Human normal mammary epithelial cells (MCF-10A) and the breast cancer cell (MCF-7, MDA-MD-231) were used in this study. The cell lines were purchased from the China Centerfor Type Culture Collection (CCTCC, Chinese Academy of Sciences, Shanghai, China). Their culture conditions are not exactly same. MCF-10A used a special medium (DMEM/F12 medium), 5% horse serum, 20 ng/ml EGF, 100 ng/ml cholera, 0.01 mg/ml insulin, and 500 ng/ml cortisolwere extraly added. MCF-7 and MDA-MB-231 were cultured in DMEM medium, and this cell culture medium was included 10% fetal bovine serum (FBS)and 1% penicillin and streptomycin. The cells were cultured in a incubator with 5% CO2, 37 °C (Esco, Singapore).
2.4 Reverse transcription and quantitative polymerase chain reaction (RT-qPCR)
The mRNA expression level of gene was examined by qPCR (SYBR Green Supermix, Bio-rad, China) normalized to expression of GAPDH. First, Total RNAwas extracted from cells using Trizol reagent (Applied Biosystem Inc., USA according to the manufacturer's protocol. The cDNA was obtained by RevertAidTM First Strand cDNA Synthesis Kit (Fermentas,Canada). Then the expression level of target genes was analyzed by cDNA. Mixed 2×SYBR Green PCR Master Mix 5 µl, forward and reverse primers 2 µl (MYC Forward: GGCTCCTGGCAAAAGGTCA, Reverse: CTGCGTAGTTGTGCTGATGT; WDR5 Forward: AATTCAGCCCGAATGGAGAGT, Reverse: AGGCTACATCGGATATTCCCAG; VASP Forward: CTGGGAGAAGAACAGCACAACC, Reverse: AGGTCCGAGTAATCACTGGAGC; GAPDH Forward: CCCAGCCATCAGTTATTCAG, Reverse: GAGTTGGCACCGTTACAGTG), appropriate amount of cDNA, and ddH2O to 10µl volume. qPCR conditions consisted of the following: 95˚C for 3 min for denaturation; 95˚C for 20 sec for annealing; and 72˚C for 5 min for extension, for 40 cycles. The relative expression of each gene was calcuated by using the 2-∆∆Ct method. Each experiment was repeated three times.
2.5 Western blot
Cells were collected, and the protein was extracted with RIPA lysate. Then theprotein was denatured by boiling at 99 °C for 5 min, and quantified with BCA Protein Assay Kit (Beyotime Biotechnology Co,Jiangsu,China). After SDS-PAGE electrophoresis and transmembrane, the proteins were binded to PVDF membrane, then blocked the nonspecific sites with 5% Skimmed milk powder. Meanwhile, a primary antibody (Including MYC dilution of 1:1000, WDR5 dilution of 1:1000, VASP dilution of 1:1000, GAPDH dilution of 1:500) should be prepared, and then incubating the PVDF membrane overnight at 4 °C. The membrane was incubated with the corresponding secondary antibody horseradish peroxidase (dilution of 1:1000) for 1 h at room temperature, and finally detected by ECL reagents (Tanon, Shanghai, China). The optical density of bands was measured by a computer-assisted imaging analysis system (Tanon, Shanghai, China) and the relative protein expression levels were normalized to GAPDH.
2.6 Co-Immunoprecipitation
Co-immunoprecipitation (Co-IP) is one of the most widely used methods to identify novel proteins that associate with a protein of interest or to determine complex formation between known proteins. In this experiment, the interactions between the proteins H3K4me3, MYC and WDR5 were identified. Cells were lysed with IP lysis buffer. After centrifugation, 2% of the supernatant was taken as Input. The rest of the supernatant was used as test groups, then H3K4me3, MYC or WDR5 specific antibodies were added to capture the target protein, and IgG was used as a negative control group. The antibody-bound protein and proteins that bind to the protein of interest were precipitated using immunomagnetic beads. Proteins that were not bound to the protein of interest were removed by a series of washes. The resulting immunocomplexes were analyzed by western blot.
2.7 Immunofluorescence
The immunofluorescence is used to detect the distribution of protein MYC and WDR5 in the cell to detect whether there is a co-location between the two proteins. After the cells in the logarithmic growth period are inoculated on the circular slide, the cells are co-transfected with pEGFP-WDR5 and pDsRed-MYC. Then the protein labeled fluorescent (WDR5 with green fluorescence, MYC with red fluorescence) was observed under fluorescence microscope (Olympus, Janpan) after 48h.
2.8 Wound healing assay
Wound healing assay can be used to detect the ability of cell migrate. In this experiment, It was used to detect changes in the migration ability of breast cancer cell lines after cells were treated. Cells (2×105 cells/mL,) were cultured in a 6-well plate, meanwhile a set of negative controls was set up. When the cells reached 80% to 90% confluence, cells were scratched. And the cells were continued to culture for 0, 24, and 48 h in the serum-free medium. Then cells were fixed and photographed under a microscope (Olympus, Japan), the ability of the cells to migrate was determined by calculated the number of cells that migrated to the scratched area.
2.9 Transwell assay
Some 24-well plates and a polyvinyl-pyrrolidone-free polycarbonate filter (8 µm pore size) were needed in the experiment. when the transwell assay was used to detect the ability cell invasion, the 8 micronpore was coated with Matrigel Matrix (BD, USA). Cells at a density of 1 × 105 in 100 μL serum-free medium, and the lower chamber contained 700 μL of culture medium with 20% FBS, a set of negative controls also was set up. After cells were cultured for 20 h, cells were fixed, stained, and counted the cell number in the surface of the lower chamber under light microscope (Olympus, Japan).
2.10 Chromatin immunoprecipitation (ChIP)
The cells were treated with a final concentration of 1% formaldehyde for DNA and protein cross-linking. The lysed nuclear extract was fragmented by microsphere enzyme and ultrasound. 2% volume of lysate was used as inputs, and the remaining lysate was co-immunoprecipitated with proteinG beads and corresponding antibody overnight to enrich DNA protein cross-linking complex. The DNA fragment was purified after washing and elution. Two enrichment sites on VASP promoter region were detected by PCR. The primers were designed as follows: VASP (-54~-194) Forward: 5’-CCCGGCATTCGCCCG-3’, Reverse: 5’-ATTGGGGAGAGGAGCGA
GAT-3’; VASP (-754~-1102) Forward: 5’-CCAAAATTCCACTCCCCGCA-3’, Reverse: 5’-CCAAAATTCCACTCCCCGCA-3’.
2.11 Luciferase assay
Based on the predicted binding site of MYC and the promoter of VASP using JASPAR, we constructed wild-type and mutant plasmids carrying different lengths of the VASP promoter including pGL3-VASP362,pGL3-VASP995,pGL3-VASP1527,pGL3-VASP748 and pGL3-VASP842mut. pGL3-Basic (Promega, Madison, WI, USA) acts as the blank control. HEK293T was cultured in 24-well plates and transfected with the mixture containing 400 ng of pGL3-VASP/pGL3-Basic, 400 ng of pEGFP-MYC/pEGFP-C1 and 10 ng of pRL-TK using Lipofectammine 2000 (Invitrogen). Cells were harvested 48 hours after transfection. The activity of firefly luciferase and Renilla luciferase were detected by the Dual Luciferase Reporter Assay System (Promega, Wisconsin, USA). The value of firefly luciferase was standardized with the corresponding Renilla luciferase activity.
2.12 Statistical analysis
Statistical analysis was performed using software SPSS. Repeat 3 times for each set of experiments. The data was expressed as the mean ± standard deviation (SD). Differences between groups were analyzed using Student’s t-test. P<0.05 was considered statistically significant.