Cell lines
The normal human bronchial epithelial cell line BEAS-2B; the human NSCLC cell lines A549, H1299, HCC827, PC9 and H1975; the Lewis lung cancer (LLC) cell line were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China) and preserved by our laboratory. The HEK293T cell line was preserved by our laboratory. All the cell lines were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS (Invitrogen, USA) and 1% penicillin/streptomycin at 37°C with 5% CO2.
Cell transfection and treatment
circMBOAT2 overexpression and shRNA plasmids as well as the corresponding control lentivirus were designed and synthesized by Hanbio Biotechnology (Shanghai, China). The Ctcf silencing plasmids were obtained from the Public Protein/ Plasmid Library (Nanjing, China). The virus-containing supernatant was collected 72 h after lentivirus packaging. Then, A549 and H1299 cells were infected with the viruses overexpressing or silencing circMBOAT2. LLC cells were transfected with scrambled (control) shRNA or Ctcf shRNA. Later, the infected cells were selected with 2 µg/mL puromycin (Hanbio Biotechnology) to establish stable overexpression and knockdown cell lines.
Specific small interfering RNAs (siRNAs) targeting CTCF and negative control (NC) were obtained from Hanbio (Shanghai, China). Lipofectamine 3000 (Invitrogen, Carlsbad, CA) was used to transfect cells with si-CTCF or NC plasmids according to the manufacturer’s instructions. All the shRNA, siRNA and overexpression sequences used are listed in Supplementary Table S1.
For the norepinephrine (NE) treatment experiments, A549 and H1299 cells with or without transfection were treated with NE for different time, then, cells were subjected to subsequent experiments.
RNA extraction, genomic DNA (gDNA) extraction and quantitative real-time PCR (qRT–PCR)
Total RNA was extracted from cells and tumor tissues with TRIzol reagent (Invitrogen, Carlsbad, CA). Genomic DNA (gDNA) was extracted from A549 and H1299 cells according to the TIANamp Genomic DNA Kit protocol (TIANGEN, Beijing). The RNA was then reverse transcribed to cDNA using the PrimeScript™ RT reagent Kit (TAKARA, Japan). qRT‒PCR analysis was performed with a TB Green Premix Ex Taq™ II kit (Takara, Japan). GAPDH (Sangon, Shanghai) was used as an internal control. Relative RNA expression was calculated using the 2−ΔΔCt method. The primers used for MMU_CIRCpedia_14285 and U1 were obtained from RiboBio. The other sequences of primers used are listed in Supplementary Table S2.
Sanger sequence analyses
RNA was extracted from A549 and H1299 cells and then reverse transcribed into cDNA. The PCR products were subjected to Sanger sequencing by Sangon Biotech Company (Shanghai, China).
Nucleic acid electrophoresis
The gDNA and cDNA PCR products were analysed via 1% agarose gel electrophoresis with 0.01% GelRed. DNA was separated by electrophoresis at 100 V for 50 min. The bands were visualized by UV irradiation.
RNase R treatment and Actinomycin D assay
RNase R and Actinomycin D assays were used to evaluate the stability of circMBOAT2. Total RNA isolated from A549 and H1299 cells was treated with or without 3 U/µg RNase R (Epicenter, Madison, USA) and incubated for 30 min at 37°C for RNase R experiments. Actinomycin D (2 µg/ml) was used to treat A549 and H1299 cells for 0, 4, 8, 12, 16 or 24 h before RNA was isolated. The relative expression levels of circMBOAT2 and MBOAT2 were measured using qRT‒PCR.
Isolation of nuclear and cytoplasmic fractions
A549 and H1299 cells were harvested for nuclear and cytoplasmic isolation using a Cytoplasmic & Nuclear RNA Purification Kit (Norgen Biote, Canada), and the RNA levels of circMBOAT2, MBOAT2, GAPDH and U1 in the nuclear and cytoplasmic fractions were tested via qRT‒PCR.
Fluorescence in situ hybridization (FISH)
The subcellular localization of circMBOAT2 was tested by FISH. The Cy3-labelled circMBOAT2 (5' AAGTTGACCATCATGAATTTCGCAA 3') probe was synthesized by GenePharma (Shanghai, China). A549 and H1299 cells were fixed in 4% formaldehyde and hybridized at 37°C overnight. Then, the cells were dyed with DAPI working solution. Finally, the cells were imaged using a fluorescence microscope.
CCK-8 assay
A549 and H1299 cells (3000 per well) were seeded into 96-well plates. Ten microliters of Cell Counting Kit-8 (CCK-8) solution (NCM Biotech, Suzhou, China) was added to each well after the cells were incubated at 37°C for 24–120 hours. The optical density (OD) was then measured at 450 nm.
Colony formation assay
Fifty to one hundred A549 and H1299 cells were seeded into 6-well plates and cultured for approximately 10–14 days. Then, the colonies were fixed with methanol and stained with 0.1% crystal violet for 15 min (Sangon, China). The colony formation rate was calculated by counting the number of stained colonies.
Transwell migration and Matrigel invasion assays
100 µl of serum-free medium containing A549 or H1299 cells (5×104 cells/ml) was added to the upper chamber with (for the invasion assays) or without (for the migration assays) Matrigel (BD Biosciences), 600 µl of medium containing 10% FBS was added to the lower chamber. After the Transwells were incubated at 37°C for 24 hours, the invaded or migrated cells were fixed, stained with 0.1% crystal violet and counted under a microscope (Olympus, Tokyo, Japan).
Scratch healing assay
A549 and H1299 cells (2× 105/mL) were grown to 100% confluence in six-well plates for 24 hours. Then, the cells were wounded with a 10 µl pipette tip. Images of the wounds were recorded at 0 h and 24 h using a microscope. The percentage of wound closure was calculated by ImageJ (version 1.8.0; National Institute of Health, Bethesda, MD, USA) software.
Animal experiments
Mice: Female C57BL/6 mice aged 6–8 weeks were purchased from Shanghai JSJ Laboratory Animal Co., Ltd. (Animal Quality Certificate: 20180004050501) and maintained in a SPF-grade laboratory for one week to adapt to the environment.
CUMS mouse model: Mice were subjected to CUMS as previously described(32) for 8 weeks to establish the CUMS model, as shown in the flow chart of the experimental design (Fig. S3).
Subcutaneous xenograft LLC model: Mice were subcutaneously injected with 1×107/ml LLC-NC or LLC-shCTCF cells in 100 µl of PBS to establish a subcutaneous xenograft tumor model. Tumor volume was measured every three days.
Injection of antisense oligonucleotides (ASOs): Three ASOs targeting MMU-CIRC-pedia-14285 (circMBOAT2) were designed and synthesized by RiboBio and subsequently transfected into LLC cells. The silencing efficiency of ASO-3 (sequence: AGGATGAAGAACTGACTCCG) was most notable in LLC cells according to qRT‒PCR (Fig. S4). Thus, after modification, 10 µM ASO-3 was injected intratumorally into the tumor three times per week for three weeks.
All the animal experimental protocols were approved by the Institutional Ethics Committee of Shanghai University of Medicine & Health Sciences Affiliated Sixth People’s Hospital South Campus. All mice were euthanized at the indicated time points, xenograft tumors were photographed, weighed, and fixed with 4% paraformaldehyde solution/or snap-frozen.
Behavioral tests(39)
As described before(17), The open-field test (OFT) was performed to evaluate locomotor and exploratory behavioral differences before and after CUMS in a quiet room using a ZS-ZFT Video Analysis System (ZSDC Science and Technology Co., Ltd., Beijing, China). The sucrose preference test (SPT) was also used to observe depression-like behavior.
Microarray Analysis for circRNA
Total RNA of tumor tissues in the tumor group and the tumor + CUMS group (three in each group) was extracted as above mentioned. The Agilent Mouse lncRNA Microarray 2019(4*180k, Design ID:086242) was used for microarray analysis and data analysis of the 6 RNA samples were conducted by OE Biotechnology Co., Ltd., (Shanghai, China).
Hematoxylin and eosin (H&E) staining
The tumor tissues were cut into thin sections with a thickness of 5 µm. These sections were then subjected to staining using H&E procedures.
Statistical analysis
All the data are presented as mean ± standard deviation (SD). The GraphPad Prism 8.0 software package was used for statistical analysis and visualization. The data were analyzed with an unpaired Student’s t test and one-way analysis of variance. P < 0.05 was considered to indicate statistical significance.