RSL3 enhances ROS-mediated cell apoptosis of myelodysplastic syndrome cells through MYB/Bcl-2 signaling pathway

doi:10.21203/rs.3.rs-4019283/v1

Download PDF

Article

RSL3 enhances ROS-mediated cell apoptosis of myelodysplastic syndrome cells through MYB/Bcl-2 signaling pathway

https://doi.org/10.21203/rs.3.rs-4019283/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 02 Jul, 2024

Read the published version in Cell Death & Disease →

You are reading this latest preprint version

Myelodysplastic syndromes (MDS) are clonal hematopoietic malignancies and seriously threatens people’s health. Current therapies include bone marrow transplantation and several hypomethylating agents. However, many elderly patients cannot benefit from bone marrow transplantation and many patients develop drug resistance to hypomethylating agents, making it urgent to explore novel therapy. RSL3 can effectively induce ferroptosis in various tumors and combination of RSL3 and hypomethylating agents is promising to treat many tumors. However, its effect in MDS was unknown. In this study, we found that RSL3 inhibited MDS cell proliferation through inducing ROS-dependent apoptosis. RSL3 inhibited Bcl-2 expression and increased caspase 3 and PARP cleavage. RNA-seq analysis revealed that MYB may be a potential target of RSL3. Rescue experiments showed that overexpression of MYB can rescue MDS cell proliferation inhibition caused by RSL3. Cellular thermal shift assay showed that RSL3 binds to MYB to exert its function. Furthermore, RSL3 inhibited tumor growth and decreased MYB and Bcl-2 expression in vivo. More importantly, RSL3 decreased the viability of bone marrow mononuclear cells (BMMCs) isolated from MDS patients, and RSL3 had a synergistic effect with DAC in MDS cells. Our studies have uncovered RSL3 as a promising compound and MYB/Bcl-2 signaling pathway as a potential target for MDS treatment.

Myelodysplastic syndromes (MDS) are highly heterogeneous clonal hematological malignancies characterized by ineffective hematopoiesis, intractable cytopenia and high risk of transforming to acute myeloid leukemia (AML)^{1, 2}. MDS incidence increases with age, especially in individuals older than 70 years³. Hematopoietic cell transplantation (HCT) could cure MDS patients, but fewer than 10% of them received this treatment¹. Currently, hypomethylation chemotherapy and immunomodulatory drugs are the major clinical treatment strategies⁴. However, many patients have intrinsic drug resistance or develop acquired resistance⁵. Therefore, there is an urgent need to explore the pathogenesis of MDS and develop novel therapy.

Apoptosis is an important type of programmed cell death. Previous studies have shown that apoptosis plays a critical role in the pathophysiology of MDS⁶. Clonal marrow cells isolated from patients with early MDS are prone to apoptosis, whereas cells isolated from patients with advanced MDS can evade proapoptotic signals⁷.

Reactive oxygen species (ROS) are the main type of free radical present in biological systems. ROS are usually produced in mitochondria^{8, 9}. Low levels of ROS result in the initiation, development, and progression of malignancies, whereas high levels of ROS can lead to apoptosis of cancer cells^{10, 11}. Many drugs exert antitumor effects by activating ROS-dependent apoptosis. For example, celastrol was reported to induce apoptosis via Prdx2-mediated ROS accumulation in gastric cancer¹². Sodium selenite and selenomethionine can individually induce ROS-mediated apoptosis in myelodysplastic cells¹³.

MYB has been identified as a transcription factor crucial for hematopoiesis and erythropoiesis¹⁴. MYB expression is aberrantly increased and plays important roles in many hematopoietic malignancies including MDS^{15, 16}. In adult zebrafish, MYB hyperactivity leads to myelodysplasia and organ infiltration and promotes progression to AML¹⁵. These studies indicated that MYB is a potential therapeutic target in MDS. Bcl-2 was downstream antiapoptotic protein of MYB. Notably, Bcl-2 is highly expressed in various hematological malignancies, including AML and MDS¹⁷. High-risk MDS have less apoptosis associated with increased expression of the pro-survival Bcl-2-related proteins¹⁸. Targeted inhibition of Bcl-2 proteins is a rational therapeutic option for hematological malignancies that are dependent on antiapoptotic Bcl-2 proteins¹⁹. Bcl-2 inhibition in combination with hypomethylating agents has been proved to be effective in acute myeloid leukemia (AML)²⁰. Venetoclax (a Bcl-2 inhibitor) combinations was superior to chemoimmunotherapy in chronic lymphocytic leukemia (CLL)²¹. Impressive responses to venetoclax have been observed in MDS patients, indicating the excellent clinical application potential of this drug²².

RSL3 is a known ferroptosis inducer that directly inhibits GPX4, constituting a novel therapeutic approach for various cancers^{16, 23, 24}. However, the antitumor effect of RSL3 in MDS is not yet clear. In this study, we found that RSL3 induces apoptosis to inhibit MDS cell proliferation, and this effect was dependent on ROS production. Importantly, MYB was significantly downregulated after RSL3 treatment. Rescue experiments further showed that RSL3 promoted MDS cell apoptosis through MYB/Bcl-2 pathway. In vivo, RSL3 suppressed the growth of MDS xenograft tumor. Notably, RSL3 inhibits the viability of mononuclear cells in MDS patients and has a synergistic effect with decitabine. Our study provides a novel therapeutic target and a potential agent for MDS treatment.

Cell lines

MDS cell lines (MDS-L and SKM-1) were obtained from ATCC (Manassas, USA). RPMI-1640 medium (Gibco, USA) supplemented with 10% FBS (EveryGreen, China) was used to maintain MDS-L and SKM-1 cells. MDS-L cells additionally required supplementation with IL-3. Cells were cultured at 37°C in an atmosphere containing 5% CO₂ and were identified by short tandem repeat (STR) profiling.

Cell viability assay

Cell viability was measured using a Cell Counting Kit-8 (CCK-8) assay (Zeta-Life, Menlo Park, USA). After cells were treated with RSL3, 10% CCK-8 solution was added to each well, and the cells were incubated for 2 h. The absorbance of the samples was then measured at 450 nm using a microplate reader (BioTek, VT, USA).

Soft agar clonogenic assay

Three thousand cells were resuspended in 0.33% agar and were then seeded into a 12-well plate. After 2 weeks, images of the 12-well plate were acquired using a Gene Genius Bio-imaging System (Bio-Rad, Hercules, USA), and the colonies were counted using ImageJ (National Institutes of Health, Bethesda, USA).

Protein extraction and western blotting

Cell lysates were prepared using radioimmunoprecipitation assay buffer supplemented with a protease inhibitor²⁵. Protein concentrations were quantified using a Bicinchoninic Acid Protein Assay Kit (Thermo Fisher Scientific, Waltham, USA). Equal quantities of proteins were separated using sodium dodecyl sulfate‒polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes (Santa Cruz Biotechnology, Dallas, TX, USA). The membranes were blocked by 5% non-fat dry milk and incubated with primary antibodies against cleaved caspase 3 (1:1000, TA7022S, Abmart, China), MYB (1:2000, 05175, Sigma-Aldrich, America) and GAPDH ((1:1000, sc-32233; Santa Cruz Biotechnology, USA) at 4°C overnight. The HRP-conjugated secondary antibodies were used at 1:3000 dilution for 1.5 h at room temperature. Signals were detected by ECL HRP substrate (Millipore).

Quantitative real-time polymerase chain reaction (qRT–PCR)

Total RNA was extracted with TRIzol (Vazyme, Nanjing, China) using the standard procedure. RNA was then reverse transcribed into cDNA using the HiScript® Q RT SuperMix for qPCR Kit (Vazyme). qRT–PCR was performed using a Mastercycler® ep realplex system (Eppendorf, Hamburg, Germany), and mRNA expression levels were then calculated using the 2–ΔΔCT method. The primer sequences were as follows: MYB forward: GCAGGTGCTACCAACACAGA, reverse: CGAGGCGCTTTCTTCAGGTA and GAPDH forward: GGAGCGAGATCCCTCCAAAAT, reverse: GGCTGTTGTCATACTTCTCATGG.

Cell apoptosis assay

Apoptosis was measured using an Annexin V-FITC/PI Apoptosis Kit (Vazyme, Nanjing, China) according to the manufacturer's instructions. In brief, cells were harvested and washed with DPBS buffer and resuspended in 100 µL of binding buffer. Annexin V-FITC (5 µL) and propidium iodide (PI; 5 µL) were then added, and the cell suspension was incubated in the dark for 10 min. The fluorescence intensity was measured by flow cytometry (FACSCalibur, BD Biosciences).

Cellular thermal shift assay

MDS-L cells were treated by DMSO or RSL3 (Selleck, USA) for 1 h. The cells were washed for three times with precooled PBS and resuspended with 50 µL PBS. The cells were divided into three group and separately put into wash bath at 37℃, 42℃, 47℃. 3 minutes later, the cells were put into a liquid nitrogen container. The frozen cells were thawed on the ice. Repeated freezing and thawing for three times. Then the cell lysis solution was used for western blot analysis.

Myelodysplastic syndrome xenograft mouse model

Hairless NCG mice were purchased from GemPharmatech Confidential (Jiangsu, China). Mice were subcutaneously inoculated in the flanks with 8×10⁶ SKM-1 cells in 100 µL of DPBS. When the tumors were measurable, the mice were randomized into two groups and were treated with either DMSO (control group) or RSL3 (20 mg/kg) by intraperitoneal injection. Tumor volume and body weight were checked daily. Mice were euthanized at the end of the experiment. Tumors were quickly exfoliated, and their weight was recorded along with the group category, and photographed after the arrangement. Tumors were fixed with 10% formaldehyde and embedded in paraffin. Hematoxylin and eosin (H&E) staining, immunofluorescence staining and a TUNEL assay were performed according to standard protocols. Images were acquired using a Nikon fluorescence microscope.

Isolation of primary human bone marrow cells from patients

All samples from human MDS patients and animal models used in the study were ethically approved by the Institutional Review Board Committee on human experimentation and animal care of Xiangya Hospital of Central South University and processed with the procedure approved by the committee. Cell viability was measured with a CCK-8 assay (Vazyme) following the manufacturer’s protocol. Ten microliters of CCK-8 solution were added to each well after treatment of the cells with the drug, and the cells were then incubated for 3 h. The absorbance was measured at 450 nm with a microplate reader.

Statistical analysis

Prism 8 (GraphPad Software, San Diego, USA) was used to present the data in bar graphs, with all values presented as the means ± standard deviations (SDs). Comparisons between two groups were performed using an unpaired, two-tailed t test. *p < 0.05, **p < 0.01, and ***p < 0.001.

Data Sharing Statement

The datasets generated and/or analysed during the current study are available from GSE256525.

RSL3 induces apoptosis in MDS cells.

To determine whether RSL3 has some roles in MDS cells, MDS-L and SKM-1 cells were treated with different concentrations of RSL3 at specific times, and cell viability was analyzed by manual counting and soft agar clonogenic assays. The results showed that RSL3 significantly inhibited MDS cell expansion (Fig. 1A). And soft agar clonogenic assay also demonstrated that RSL3 inhibited colony formation of MDS-L and SKM-1 cells compared with control groups (Fig. 1B). Furthermore, we explored the mechanism by which RSL3 suppresses MDS cell proliferation. It was found that RSL3 treatment led to a series of morphological changes, including reduced volume, ruptured cytomembrane and decreased cell density, in both MDS-L and SKM-1 cells (Fig. 1C). Therefore, we speculated that RSL3 induces MDS cell death to inhibit cell proliferation. Ferroptosis, apoptosis, autophagy, and necroptosis are common types of programmed cell death²⁶. To identify which kind of cell death was involved, MDS cells were treated with RSL3 alone or in combination with liproxstatin-1 (Lip-1; a ferroptosis inhibitor targeting GPX4), ferrostatin-1 (Fer-1; a ferroptosis inhibitor targeting SCL7A11), deferoxamine (DFO; a chelator), Z-VAD-FMK (an apoptosis inhibitor targeting caspase), chloroquine (CQ; an autophagy inhibitor), or necrostatin-1 (Nec-1; a necroptosis inhibitor). The results showed that only Z-VAD-FMK notably reversed the inhibition of proliferation induced by RSL3 in a concentration-dependent manner (Fig. 1D, E). Western blot results showed that the levels of cleaved PARP, cleaved caspase3 and γ-H2AX were increased and Bcl-2 was decreased with increasing concentrations of RSL3 in both MDS-L and SKM-1 cells (Fig. 1F), further confirming RSL3 induces apoptosis in MDS cells. Flow cytometric analysis also showed that RSL3 significantly induced MDS cell apoptosis and that Z-VAD-FMK restored cell viability (Fig. 1G). Taken together, these data showed that RSL3 suppressed the malignant proliferation of MDS cells through inducing apoptosis.

RSL3-mediated apoptosis is dependent on ROS.

ROS accumulation occurs during apoptosis²⁷. Based on the above results, we measured ROS levels in RSL3-treated MDS cells. MDS cells were treated for with RSL3 alone or in combination with NAC (a ROS inhibitor) and subsequently analyzed by flow cytometry. RSL3 increased ROS levels in MDS cells in a dose-dependent manner (Fig. 2A). And NAC partially reversed the RSL3-induced ROS accumulation (Fig. 2B). Furthermore, fluorescence staining also revealed that RSL3 treatment increased ROS fluorescence in MDS cells and NAC could attenuate this effect (Fig. 2C). These results showed the accumulation of ROS in RSL3-treated MDS cells. At the meanwhile, cell proliferation assay showed NAC can rescue the proliferation inhibition induced by RSL3 treatment in MDS cells in a dose-dependent manner, indicating that ROS production plays an important role in the RSL3-induced MDS cell proliferation inhibition (Fig. 2D). Importantly, the levels of cleaved PARP, Bcl-2 and cleaved caspase 3, were greatly reduced after NAC treatment (Fig. 2E), and NAC reduced the RSL3-mediated apoptosis rates in MDS-L and SKM-1 cells (Fig. 2F), indicating that inhibition of ROS prevented RSL3-induced apoptosis. Thus, RSL3-triggered cell apoptosis is dependent on ROS.

MYB is an efficacious target of RSL3-mediated apoptosis.

To explore the detailed molecular mechanism of RSL3-induced cell death, RNA-seq was performed in MDS-L cells treated with RSL3 or DMSO. Principal component analysis (PCA) showed clustering of triplicated samples in each group (Fig. 3A). Volcano plot showed the differential expression of all genes. Compared with control group, there were 3099 genes significantly up-regulated and 2265 genes significantly down-regulated in RSL3 treatment group (Fig. 3B). Importantly, GSEA analysis showed that apoptosis pathway was significantly enriched in RSL3 treated cells, which was consistent with RSL3’s roles (Fig. 3C). We further performed Venn diagram analysis to compare downregulated genes identified by RNA-seq with upregulated genes in MDS patients identified in a GEO dataset (GSE114869). The Venn diagram contained 26 overlapping molecules, which were visualized in a heatmap (Fig. 3D). These molecules could promote the initiation and development of MDS and be potential targets of RSL3. Our previous study found that MYB is overexpressed in clinical MDS samples compared with normal samples and that MYB regulates MDS-L and SKM-1 cell viability via PI3K-AKT pathway. Interestingly, RNA-seq results showed that RSL3 treatment decreased MYB expression (Fig. 3D), which was further confirmed by quantitative PCR (Fig. 3E). RNA seq analysis showed that MYB was downregulated and ferroptosis-associated genes like EGLN1 and KEAP1 had no significant changes after RSL3 treatment (Supplemental Fig. 1A).

To further explore whether RSL3-mediated MDS cell apoptosis was related with decreased MYB levels. We did rescue assays by transfected MDS-L and SKM-1 cells with MYB overexpression plasmids. Western blot result confirmed the over-expression efficiency (Fig. 3F). And cell proliferation assay showed that MYB overexpression partially rescued the decrease in MDS cell viability caused by RSL3 (Fig. 3G). Flow cytometric analysis showed that RSL3 increased ROS production in MDS-L and SKM-1 cells and overexpression of MYB reverted this effect (Fig. 3H). More importantly, western blot results showed that MYB overexpression elevated the Bcl-2 protein level, decreased the cleaved caspase 3 and γ-H2AX and reversed the effects of apoptotic protein expression caused by RSL3 (Fig. 3I). And the apoptosis rate in the RSL3-treated group was significantly decreased upon MYB overexpression (Fig. 3J). Taken together, RSL3 induced apoptosis in MDS cells at least partially via decreasing MYB expression.

RSL3 reduces MYB expression via binding MYB.

We further explored the mechanism of RSL3 regulating MYB expression. Western blot results showed that RSL3 treatment decreased MYB protein in dose and time-dependent manners (Fig. 4A-B). And in both MDS-L and SKM-1 cells, RSL3 treatment dramatically decreased MYB protein levels in as short as 6 hours (Fig. 4B). This fast reduction of protein levels usually involves stabilization and degradation pathway. Indeed, proteasome inhibitor MG132 treatment can rescue decreased MYB protein levels led by RSL3 treatment (Fig. 4C). Furthermore, cellular thermal shift assay (CETSA) result showed that RSL3 protected MYB from thermal degradation, indicating that RSL3 can directly bind to MYB protein (Fig. 4D). In summary, these results demonstrated that RSL3 decreased MYB expression via directly binding to MYB protein and mediating its degradation via proteasome-ubiquitin pathway.

RSL3 inhibits tumor growth in vivo.

To further explore the antitumor role of RSL3, SKM-1 cells were inoculated subcutaneously into the flanks of female BALB/c mice (Fig. 5A). After the tumor volume increased to 50–100 mm³, the mice were divided into the RSL3-treated group and the control group. RSL3 (20 mg/kg) or vehicle was administered intraperitoneally into mice once every two days. It was shown that tumor volume and weight were markedly smaller in RSL3-treated mice than control mice, while the body weight did not differ significantly between the RSL3-treated group and control group, indicating the safety of RSL3 administration (Fig. 5B-E). Importantly, immunofluorescence staining results showed that RSL3 treatment decreased MYB and Bcl-2 expression in the tumor tissues, which was further confirmed in western blot results (Fig. 5F-H). In conclusion, RSL3 inhibits tumor growth in vivo.

RSL3 treatment had therapeutic efficiency in MDS patients’ derived samples.

To determine the potential clinical significance of RSL3 in MDS, we first treated peripheral blood mononuclear cells (PBMCs) from MDS patients with RSL3. Our results showed that RSL3 had an inhibitory effect in mononuclear cells from MDS patients but almost no effect in cells from the healthy counterparts (Fig. 6A-D). In clinical, resistance to hypomethylating agents (HMA) such as azacitidine (AZA) and decitabine (DAC) leads to treatment failure in MDS patients. Given the advantage of RSL3 in decreasing the MDS cells, we tested that whether RSL3 can synergize with HMA via combining RSL3 and DAC to treat MDS cells. The results showed that RSL3 had an obvious synergistic effect with DAC in MDS cell lines (Fig. 6E-F). Taken together, these results indicated that RSL3 inhibited the cell viability of MDS patients and was promising in combination with HMA agents to treat MDS cells.

In clinical, hypomethylating agents such as azacytidine and decitabine have been proven to benefit the survival of MDS patients. However, many patients develop drug resistance²⁸. Thus, the development of novel therapy including single reagent or drug combination to treat MDS is in urgent needs. Herein, we found that RSL3 inhibited proliferation of MDS cells via mediating MYB degradation and resultantly inducing cell apoptosis. More importantly, RSL3 had a synergistic effect with decitabine to treat MDS. Our findings demonstrated novel roles and related mechanisms of RSL3 in MDS and provided a promising choice for MDS patients.

RSL3 is a widely used as a ferroptosis inducer. In colorectal cancer, RSL3 triggers ferroptosis by promoting ROS accumulation and increasing the cellular labile iron pool²⁹. RSL3 was also found to significantly decrease prostate cancer cell viability, growth, migration and invasion. Importantly, it had no obvious side effects³⁰. These studies showed the anticancer effect of RSL3 dependent on ferroptosis. However, we found that RSL3 decreased MDS-L and SKM-1 cells’ proliferation via inducing apoptosis instead of ferroptosis. The rescue assays during which only apoptosis inhibitor, not ferroptosis inhibitors nor other cell death inhibitors, can rescue the proliferation inhibition induced by RSL3, supported our conclusion. Furthermore, RNA-seq data showed that RSL3 treatment affect the expression levels of several molecules involving ferroptosis pathway, which further confirm RSL3’s roles independent ferroptosis in MDS cells.

Cellular ROS accumulation is closely related to apoptosis³¹. In our study, a series of biochemistry assays and ROS scavenger (NAC) rescue assay demonstrated that RSL3 induced cell apoptosis via increasing ROS accumulation. Clinically, repeated blood transfusion, inefficient erythropoiesis and abnormal hepcidin expression cause iron overload in 50–80% of MDS patients³². Iron overload in these patients leads to an increase in ROS levels and induces apoptosis in bone marrow mesenchymal stromal cells, which can be partially reversed by treatment with iron chelators or antioxidants^{33, 34}. A study showed that iron overload in patients with MDS caused ROS-dependent erythrocyte apoptosis³⁵. DFO (an iron chelator) partially blocked RSL3-induced cell death. Therefore, RSL3-induced ROS-dependent apoptosis could be mediated by elevated Fe²⁺ levels. Through deep analysis of transcriptome sequencing data, we found that RSL3 increased ROS levels via decreasing MYB expression levels. The finding that MYB regulates ROS level is consistent with previous study¹⁶. Interestingly, ROS levels also affected MYB expression (Supplemental Fig. 1B), indicating there was regulation loop existed.

Many studies have reported that abnormal MYB expression affects cancer cell expansion, differentiation, and apoptosis. MYB was associated with poor prognosis through inhibition of apoptosis in colorectal cancer³⁶. Defects in the acetyltransferase p300 were found to promote MYB expression to accelerate MDS progression³⁷. Most importantly, our previous work showed that MYB, as a transcription factor, promoted the malignant progression of MDS⁴. Herein, we found that RSL3 treatment decreased MYB protein levels in both dose-dependent and time-dependent manners. Importantly, RSL3 can directly binds to MYB protein and protect its thermal degradation. Even though MYB mRNA levels also decreased after RSL3 treatment, it was possible that RSL3 decreased MYB protein levels before its mRNA levels for that MYB can transcriptionally regulate itself³⁸. Our findings demonstrated that RSL3 acted as MYB inhibitor in MDS cells, and it is worth to explore whether this mechanism is conserved in other cells, especially in MYB induced cancer.

It was reported that venetoclax (VEN), a selective Bcl-2 inhibitor in combination with HMAs improved efficacy for multiply relapsed/refractory patients with MDS³⁹. In our study, RSL3 decreased expression levels of MYB and BCL-2, and RSL3 not only inhibited MDS cell proliferation as a single drug, but also had synergistic effects with DAC to treat MDS cells, indicating promising clinical applications of RSL3 in the future. Unexpectedly, the results in MDS-L cells are more obvious than SKM-1 cells, which may be related to their different origins⁴⁰.

In conclusion, our data revealed that RSL3 is a promising compound to inhibit MDS cell growth and overcome hypomethylating agent resistance. Mechanistically, RSL3 inhibits MYB to induce apoptosis by downregulating Bcl-2 expression. And we found that MYB could be a direct drug target of RSL3 and RSL3 is a potent MYB inhibitor that can be used to treat MDS and other hematopoietic diseases (Fig. 7).

Declaration of competing interest

The authors have declared that no competing interest exists.

Acknowledgements

This work was funded by the National Natural Science Foundation of China (No. 82170138, 81870105), Natural Science Foundation of Hunan Province (No. 2021JJ30022), Scientific Research Fund Project of Hunan Provincial Health Commission (No. 20201921).

Author Contributions

LL, CYY, LZ, YYW, JZ, JL, LL, XH participated in the design of the study and drafted the manuscript. LL, CYY, LZ and YYW carried out the experiments and performed the statistical analysis. FXZ and PFC provided assistance for patients’ specimens collection. JZ and XH revised the manuscript. All authors approved the final manuscript.

Li H, Hu F, Gale RP, Sekeres MA, Liang Y. Myelodysplastic syndromes. Nat Rev Dis Primers. 2022;8(1):74.
DeRosa PA, Roche KC, Nava VE, et al. Concurrent Waldenstrom's Macroglobulinemia and Myelodysplastic Syndrome with a Sequent t(10;13)(p13;q22) Translocation. Curr Oncol. 2022;29(7):4587-92.
Volpe VO, Garcia-Manero G, Komrokji RS. Myelodysplastic Syndromes: A New Decade. Clin Lymphoma Myeloma Leuk. 2022;22(1):1-16.
Liu Z, Wang P, Yuan S, et al. LncRNA BC200/miR-150-5p/MYB positive feedback loop promotes the malignant proliferation of myelodysplastic syndrome. Cell Death Dis. 2022;13(2):126.
Šimoničová K, Janotka Ľ, Kavcová H, et al. Different mechanisms of drug resistance to hypomethylating agents in the treatment of myelodysplastic syndromes and acute myeloid leukemia. Drug Resist Updat. 2022;61:100805.
Kerbauy DB, Deeg HJ. Apoptosis and antiapoptotic mechanisms in the progression of myelodysplastic syndrome. Exp Hematol. 2007;35(11):1739-46.
Yang X, Ma L, Zhang X, Huang L, Wei J. Targeting PD-1/PD-L1 pathway in myelodysplastic syndromes and acute myeloid leukemia. Exp Hematol Oncol. 2022;11(1):11.
Yuan LQ, Wang C, Lu DF, et al. Induction of apoptosis and ferroptosis by a tumor suppressing magnetic field through ROS-mediated DNA damage. Aging (Albany NY). 2020;12(4):3662-81.
Fang S, Sun S, Cai H, et al. IRGM/Irgm1 facilitates macrophage apoptosis through ROS generation and MAPK signal transduction: Irgm1(+/-) mice display increases atherosclerotic plaque stability. Theranostics. 2021;11(19):9358-75.
Narayanan P, Farghadani R, Nyamathulla S, et al. Natural quinones induce ROS-mediated apoptosis and inhibit cell migration in PANC-1 human pancreatic cancer cell line. J Biochem Mol Toxicol. 2022;36(5):e23008.
Aggarwal V, Tuli HS, Varol A, et al. Role of Reactive Oxygen Species in Cancer Progression: Molecular Mechanisms and Recent Advancements. Biomolecules. 2019;9(11).
Chen X, Zhao Y, Luo W, et al. Celastrol induces ROS-mediated apoptosis via directly targeting peroxiredoxin-2 in gastric cancer cells. Theranostics. 2020;10(22):10290-308.
Gonçalves AC, Barbosa-Ribeiro A, Alves V, Silva T, Sarmento-Ribeiro AB. Selenium compounds induced ROS-dependent apoptosis in myelodysplasia cells. Biol Trace Elem Res. 2013;154(3):440-7.
Wang X, Angelis N, Thein SL. MYB - A regulatory factor in hematopoiesis. Gene. 2018;665:6-17.
Liu W, Wu M, Huang Z, et al. c-myb hyperactivity leads to myeloid and lymphoid malignancies in zebrafish. Leukemia. 2017;31(1):222-33.
Li S, He Y, Chen K, et al. RSL3 Drives Ferroptosis through NF-κB Pathway Activation and GPX4 Depletion in Glioblastoma. Oxid Med Cell Longev. 2021;2021:2915019.
Bewersdorf JP, Carraway H, Prebet T. Emerging treatment options for patients with high-risk myelodysplastic syndrome. Ther Adv Hematol. 2020;11:2040620720955006.
Slape CI, Saw J, Jowett JB, et al. Inhibition of apoptosis by BCL2 prevents leukemic transformation of a murine myelodysplastic syndrome. Blood. 2012;120(12):2475-83.
Kapoor I, Bodo J, Hill BT, Hsi ED, Almasan A. Targeting BCL-2 in B-cell malignancies and overcoming therapeutic resistance. Cell Death Dis. 2020;11(11):941.
Janssen M, Schmidt C, Bruch PM, et al. Venetoclax synergizes with gilteritinib in FLT3 wild-type high-risk acute myeloid leukemia by suppressing MCL-1. Blood. 2022;140(24):2594-610.
Eichhorst B, Niemann CU, Kater AP, et al. First-Line Venetoclax Combinations in Chronic Lymphocytic Leukemia. N Engl J Med. 2023;388(19):1739-54.
Fischer MA, Song Y, Arrate MP, et al. Selective inhibition of MCL1 overcomes venetoclax resistance in a murine model of myelodysplastic syndromes. Haematologica. 2023;108(2):522-31.
Yang J, Mo J, Dai J, et al. Cetuximab promotes RSL3-induced ferroptosis by suppressing the Nrf2/HO-1 signalling pathway in KRAS mutant colorectal cancer. Cell Death Dis. 2021;12(11):1079.
Ghoochani A, Hsu EC, Aslan M, et al. Ferroptosis Inducers Are a Novel Therapeutic Approach for Advanced Prostate Cancer. Cancer Res. 2021;81(6):1583-94.
Wang Z, Wang P, Zhang J, et al. The novel GATA1-interacting protein HES6 is an essential transcriptional cofactor for human erythropoiesis. Nucleic Acids Res. 2023.
Liu L, Li H, Hu D, et al. Insights into N6-methyladenosine and programmed cell death in cancer. Mol Cancer. 2022;21(1):32.
Xu G, Wang H, Li X, Huang R, Luo L. Recent progress on targeting ferroptosis for cancer therapy. Biochem Pharmacol. 2021;190:114584.
Liu Y, Bewersdorf JP, Stahl M, Zeidan AM. Immunotherapy in acute myeloid leukemia and myelodysplastic syndromes: The dawn of a new era? Blood Rev. 2019;34:67-83.
Sui X, Zhang R, Liu S, et al. RSL3 Drives Ferroptosis Through GPX4 Inactivation and ROS Production in Colorectal Cancer. Front Pharmacol. 2018;9:1371.
Chen Z, Jiang Q, Zhu P, et al. NPRL2 enhances autophagy and the resistance to Everolimus in castration-resistant prostate cancer. Prostate. 2019;79(1):44-53.
Kang R, Li R, Dai P, et al. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ Pollut. 2019;251:689-98.
Weber S, Parmon A, Kurrle N, Schnütgen F, Serve H. The Clinical Significance of Iron Overload and Iron Metabolism in Myelodysplastic Syndrome and Acute Myeloid Leukemia. Front Immunol. 2020;11:627662.
Huang L, Liu Z, Liu H, et al. Iron Overload Impairs Bone Marrow Mesenchymal Stromal Cells from Higher-Risk MDS Patients by Regulating the ROS-Related Wnt/β-Catenin Pathway. Stem Cells Int. 2020;2020:8855038.
Zheng Q, Zhao Y, Guo J, et al. Iron overload promotes mitochondrial fragmentation in mesenchymal stromal cells from myelodysplastic syndrome patients through activation of the AMPK/MFF/Drp1 pathway. Cell Death Dis. 2018;9(5):515.
Gu S, Zhao Y, Guo J, et al. High expression of APAF-1 elevates erythroid apoptosis in iron overload myelodysplastic syndrome. Tumour Biol. 2014;35(3):2211-8.
Biroccio A, Benassi B, D'Agnano I, et al. c-Myb and Bcl-x overexpression predicts poor prognosis in colorectal cancer: clinical and experimental findings. Am J Pathol. 2001;158(4):1289-99.
Man N, Mas G, Karl DL, et al. p300 suppresses the transition of myelodysplastic syndromes to acute myeloid leukemia. JCI Insight. 2021;6(19).
Nicolaides NC, Gualdi R, Casadevall C, Manzella L, Calabretta B. Positive autoregulation of c-myb expression via Myb binding sites in the 5' flanking region of the human c-myb gene. Mol Cell Biol. 1991;11(12):6166-76.
DiNardo CD, Rausch CR, Benton C, et al. Clinical experience with the BCL2-inhibitor venetoclax in combination therapy for relapsed and refractory acute myeloid leukemia and related myeloid malignancies. Am J Hematol. 2018;93(3):401-7.
Nakagawa T, Matozaki S. The SKM-1 leukemic cell line established from a patient with progression to myelomonocytic leukemia in myelodysplastic syndrome (MDS)-contribution to better understanding of MDS. Leuk Lymphoma. 1995;17(3-4):335-9.

(Not answered)

Supplementalfigure.jpg

Download PDF

Journal Publication

published 02 Jul, 2024

Read the published version in Cell Death & Disease →

Editorial decision: revise
12 Apr, 2024
Review #1 received at journal
08 Apr, 2024
Reviewer #1 agreed at journal
27 Mar, 2024
Reviewers invited by journal
26 Mar, 2024
Submission checks completed at journal
06 Mar, 2024
Editor assigned by journal
05 Mar, 2024
First submitted to journal
05 Mar, 2024

You are reading this latest preprint version

RSL3 enhances ROS-mediated cell apoptosis of myelodysplastic syndrome cells through MYB/Bcl-2 signaling pathway

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and Methods

Cell lines

Cell viability assay

Soft agar clonogenic assay

Protein extraction and western blotting

Quantitative real-time polymerase chain reaction (qRT–PCR)

Cell apoptosis assay

Cellular thermal shift assay

Myelodysplastic syndrome xenograft mouse model

Isolation of primary human bone marrow cells from patients

Statistical analysis

Data Sharing Statement

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1