Cell culture
The HCC lines, namely, SMMC-7721, QGY-7703 and Huh7 were purchased from Academy of Sciences of Shanghai (Shanghai, China). HCC lines were maintained at 37 °C with 5% CO2 and cultured in RPMI1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA).
Tissue samples
45 HCC tissues were enrolled in this study. HCC diagnosis was based on histopathology. The study was carried out under the approval by the Ethics Committee of Affiliated Lishui Hospital of Zhejiang University. Participants all provided their informed written consent.
EdU assay
EdU assay was performed in HCC cells. Briefly, HCC cells were plated into 96-well plates. HCC cells were cultured for 2 hours after treated with 50 μM EdU. Cells were fixed with 4% paraformaldehyde then stained by Hoechst 33342 and Apollp reaction cocktail. Results were counted five random fields by using a fluorescence microscopy.
Cell transfection
LV- circ_0013731 and sh- circ_0013731 were purchased from GeneCreate Biological Engineering Co., Ltd. (China). Mimic- miR-877-3p or inhibition-miR-877-3p was purchased from (RiboBio Corporation, Guangzhou, China). Cells were transfected with LV/sh- circ_0013731 or mimic/inhibitor-miR-877-3p by using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).
qRT-PCR
Total RNA was obtained using TRIzol reagent. RT-PCR was conducted using a SYBR Premix Ex Taq (TaKaRa, Dalian, China). Relative expression of genes was calculated by 2−ΔΔCT.and SLC7A11, GAPDH and Tubulin expression levels were examined using the following specific primers:
SLC7A11: F-5’TCTCCAAAGGAGGTTACCTGC3’ and
R-5’ AGACTCCCCTCAGTAAAGTGAC3’;
GAPDH: F-5’GGAGCGAGATCCCTCCAAAAT3’ and
R-5′GGCTGTTGTCATACTTCTCATGG3′;
Tubulin: F-5’ GGCCAAGGGTCACTACACG3’ and
R-5’ GCAGTCGCAGTTTTCACACTC3’.
Western blot
HCC cells and tissues were lysed and protein concentration of total cell lysates was tested by the BCA assay. Protein samples (25-30ug) were loaded to electrophoresis and then transferred to PVDF membrane. After blocked in 5.5% non-fat milk for 2 hours, primary antibodies were used for incubation. Specific primary antibodies were used in this research included anti-SLC7A11, anti-GAPDH and anti-Tubulin (Abcam, Cambridge, UK, 1:1000) for overnight at 4°C. Finally, the membrane was analyzed by the QuantityOne software (BioRad, Hercules, CA, USA).
Luciferase activity assay
The potential putative sequences of the binding site in MAN1A2 promoter/E2F1, circ_0013731/miR-877-3p and miR-877-3p/ SLC7A11 and corresponding mutated sequences were cloned into pGL3 vector. About 1.8×105 HCC cells were seeded in 48-well plate before transfection. After transfection with inhibitor-miR-877-3p, LV- circ_0013731 or corresponding negative control, the relative luciferase absorbance value of each group was examined by Dual-Luciferase Reporter Assay System (Promega, #E1910).
Immunofluorescent staining
Histological section was fixed by cold acetone for 10 min and incubated in a 1% BSA/PBS solution. Antibodies against SLC7A11 (1:100, Santa Cruz, Dallas, TX, USA) was used for incubation with section overnight at 4°C. Next, secondary antibody (1:500, Santa Cruz, Dallas, TX, USA) were incubated with section. Wide-field fluorescence microscopy (Carl Zeiss, Jena, Germany) was used to visualize the slide.
RNA Immunoprecipitation
Magna RIP RNA Binding Protein Immunoprecipitation Kit was used for RNA Immunoprecipitation. HCC cell extract was incubated with RIPA buffer with magnetic beads conjugated with human Ago2 antibody for 9 h. Normal IgG was used for negative control. Finally, immunoprecipitated RNA was collected and subjected to qRT-PCR analysis.
Biotin labeled probe pull down assay
HCC cells were lysed in lysis buffer. Next, 3μg biotin labeled probe was added to the buffer lysis and incubated for 4 hours at 25°C. To pull down the circRNA-microRNA complex, strepavidin magnetic beads (Thermo Fisher) were added to the buffer and slowly rotated for another 4 hours. Then, washing step was carried out for 4 times. Finally, the binding RNA was extracted with TRIzol reagent and subjected to qRT-PCR analysis.
Lipid ROS assays
Following instructions [22], HCC cells were treated by C11-BODIPY (10 µM) and incubated for half hour. Afterward, washing step was performed twice times. C11-BODIPY was removed by cold PBS. The fluorescence of C11-BODIPY581 was examined by the simultaneous acquisition of green (484/510 nm) and red signals (581/610 nm) using a flow cytometer.
Iron assays
Following instructions [23], Iron Assay Kit (Sigma Aldrich) was used to detect total iron or Fe2+ in HCC. Following instructions, Iron Assay buffer and Iron Reducer were added in turn to the samples. In dark conditions, samples were mixed well and incubated for half hour after adding Iron Reducer. Samples were incubated for one hour after adding Iron Probe. Lastly, the absorbance was examined at 593 nm (A593).
In vivo study
Female nude mice (5 weeks old) were purchased from Shanghai Vital River Animal Company. A circ_0013731 stable overexpression or knockout SMMC-7721 and QGY-7703 cell line was constructed by LV-circ_0013731 or sh-circ_0013731. Xenograft tumors model were established by subcutaneous transplantation. For the xenograft tumor model, 6.4 × 106 cells were subcutaneously injected into the left inguinal of nude mice. The volume of tumor was counted for 0, 7, 14, 21, 28 days. Tumor weight was counted at 28 days. This work was under the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.
Statistical analysis
All the data were analyzed using SPSS software. Student t test was used to compare the difference of data between groups. P<0.05 represents significant difference. The asterisks *, ** and *** stand for p<0.05, p<0.01 and p<0.001, respectively.